ID: 1034524457

View in Genome Browser
Species Human (GRCh38)
Location 7:151648407-151648429
Sequence GCCCCCTGCTTTGGGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034524449_1034524457 12 Left 1034524449 7:151648372-151648394 CCTGAAAGCATCTTGCATCCCAC 0: 1
1: 1
2: 2
3: 14
4: 175
Right 1034524457 7:151648407-151648429 GCCCCCTGCTTTGGGAAAACTGG 0: 1
1: 0
2: 3
3: 10
4: 134
1034524452_1034524457 -7 Left 1034524452 7:151648391-151648413 CCACCGTGGTCCTCATGCCCCCT 0: 1
1: 0
2: 2
3: 19
4: 254
Right 1034524457 7:151648407-151648429 GCCCCCTGCTTTGGGAAAACTGG 0: 1
1: 0
2: 3
3: 10
4: 134
1034524448_1034524457 15 Left 1034524448 7:151648369-151648391 CCGCCTGAAAGCATCTTGCATCC 0: 1
1: 1
2: 0
3: 20
4: 157
Right 1034524457 7:151648407-151648429 GCCCCCTGCTTTGGGAAAACTGG 0: 1
1: 0
2: 3
3: 10
4: 134
1034524447_1034524457 22 Left 1034524447 7:151648362-151648384 CCTTGTACCGCCTGAAAGCATCT 0: 1
1: 0
2: 1
3: 10
4: 78
Right 1034524457 7:151648407-151648429 GCCCCCTGCTTTGGGAAAACTGG 0: 1
1: 0
2: 3
3: 10
4: 134
1034524453_1034524457 -10 Left 1034524453 7:151648394-151648416 CCGTGGTCCTCATGCCCCCTGCT 0: 1
1: 0
2: 2
3: 25
4: 403
Right 1034524457 7:151648407-151648429 GCCCCCTGCTTTGGGAAAACTGG 0: 1
1: 0
2: 3
3: 10
4: 134
1034524451_1034524457 -6 Left 1034524451 7:151648390-151648412 CCCACCGTGGTCCTCATGCCCCC 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1034524457 7:151648407-151648429 GCCCCCTGCTTTGGGAAAACTGG 0: 1
1: 0
2: 3
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034524457 Original CRISPR GCCCCCTGCTTTGGGAAAAC TGG Intronic
900544114 1:3218982-3219004 GACCCCTCCTTTGGGAGAGCTGG - Intronic
900573220 1:3370174-3370196 GGCCTCTGCTTTGGGGAGACTGG + Intronic
903552734 1:24169298-24169320 GCCCTCTGCTTTGGGGAAGTGGG + Intronic
903693853 1:25193247-25193269 GCCCCCAGCTCTGGGCATACAGG - Intergenic
907194166 1:52672935-52672957 GACCCCTGCTTGGGGAGAAGTGG - Intergenic
909191592 1:72559179-72559201 GTTCCCTGATTTGGGAAAGCTGG + Intergenic
910991526 1:93061559-93061581 GCCTCCTGAGTTGGGACAACAGG + Intergenic
915895190 1:159806595-159806617 GTTCCCTGTGTTGGGAAAACTGG + Exonic
916243564 1:162663751-162663773 TCTCCCTGCTCTGGGAAGACCGG + Intronic
919069990 1:192742180-192742202 GGCCCATGCTTAGGGAAAAAAGG - Intergenic
919787400 1:201268555-201268577 GCCCCCTGCTGTGAGAAGACTGG - Intergenic
919807048 1:201386384-201386406 GCCCCCTGCTTTGCCAAAGAGGG + Exonic
921688611 1:218121073-218121095 GCACCCTGCTTTGGGGGAACTGG - Intergenic
922962560 1:229661378-229661400 TCCCCCTGCCTTGGGAATGCTGG + Intergenic
1063019590 10:2114487-2114509 GCCCCCTGCGAAGGGAACACAGG + Intergenic
1064388357 10:14919795-14919817 GCTCCGTACTTTGGGAAGACCGG + Exonic
1064989389 10:21242935-21242957 CACCCCTGCCTTGGGAAATCAGG + Intergenic
1067251111 10:44587769-44587791 GCCCCCTGCTATGGCAAGGCTGG + Intergenic
1068573870 10:58661370-58661392 CCCACCTCCTTTAGGAAAACTGG + Intronic
1069156579 10:65037496-65037518 GGCCACTGCTTTGGGAATACAGG - Intergenic
1069704116 10:70446885-70446907 GGGCCCTGCTTTGGGAATATGGG - Intronic
1069813656 10:71180089-71180111 CACCCCTGCTTGGGGAAGACGGG - Intergenic
1071022020 10:81068679-81068701 GCACCCTGCCTTGGGCAAACAGG - Intergenic
1072670357 10:97425037-97425059 GCACTCTGCTTTGGGAACAGGGG + Intronic
1076728880 10:132428601-132428623 GCCCCCTGCCTTGAGAAATGGGG + Intergenic
1076771077 10:132665173-132665195 TCCCCCTTCTTTGGAAACACAGG - Intronic
1078934181 11:15937777-15937799 GTGTCCTGCTTTGGGAAACCAGG - Intergenic
1081968627 11:47184248-47184270 GCGCCCTGCTTTGGGGACAAAGG - Intronic
1082174816 11:49048274-49048296 GCCCGCTGCTTTGGAAGAAGAGG - Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1088920366 11:114256501-114256523 GACCCCTGCTTTGAGAACTCTGG - Intergenic
1089357142 11:117861429-117861451 GCCCTCTGGTGTGGGAACACAGG - Intronic
1091776879 12:3190430-3190452 GCCCACTGCTCCTGGAAAACAGG - Intronic
1102931120 12:116863092-116863114 GCCACCTGCTTTAGAATAACGGG - Intronic
1105434529 13:20365120-20365142 GCCCCCATCTTTGGGAAAACTGG + Intergenic
1105899844 13:24745034-24745056 GTCCACTGCTGTGGGAAAAGGGG - Intergenic
1107479424 13:40772986-40773008 ATCTCCTGCTTTTGGAAAACTGG + Intergenic
1119964500 14:78899169-78899191 ATCCTCTGCTTTGGGAAAACAGG + Intronic
1121024251 14:90602905-90602927 GCCACCCGCCTTGGGAAGACGGG + Intronic
1121958983 14:98240944-98240966 GCCCCCTGCTTTGTGTGTACAGG + Intergenic
1122786739 14:104167455-104167477 GGCCCCTGCCATGGGAAAGCGGG + Intronic
1122940046 14:104977182-104977204 CCCCACTCCTTGGGGAAAACAGG - Intronic
1129141578 15:73602968-73602990 GCCTTCTGCTTTGGAAAAATAGG + Intronic
1129713251 15:77832301-77832323 GCCCCCTGCCTTGGGGGACCTGG + Intergenic
1133218080 16:4305560-4305582 GCCCCCTCTTTTGAGAAACCTGG + Intergenic
1133415132 16:5600620-5600642 GCCCACTGCTTGGTGTAAACTGG + Intergenic
1134812639 16:17180645-17180667 ACCCCCTACCATGGGAAAACTGG + Intronic
1136501281 16:30670653-30670675 GCCTGCTGCTTTGGGAAGGCTGG - Exonic
1138144871 16:54599376-54599398 GCCCCTTCCTTAGGGAAAATGGG - Intergenic
1139724394 16:68884997-68885019 GCCAGCTGCAGTGGGAAAACAGG + Intronic
1140272657 16:73480624-73480646 GCATCCTGCTGTGGGGAAACAGG - Intergenic
1142429297 16:90017992-90018014 CCCTCCTCCTTTGGGAAAAAAGG - Intronic
1145302005 17:21647438-21647460 GGACCCTGCTTTGGGAGACCTGG + Intergenic
1145328351 17:21850194-21850216 GGACCCTGCTTTGGGAGACCTGG + Intergenic
1145415276 17:22709484-22709506 GGACCCTGCTTTGGGAGACCTGG + Intergenic
1145695133 17:26781538-26781560 GGACCCTGCTTTGGGAGACCTGG + Intergenic
1146672755 17:34753137-34753159 ATCCCTTTCTTTGGGAAAACAGG + Intergenic
1150125065 17:62629919-62629941 GCCCCGTGCTCTGGGCACACAGG - Intronic
1162175604 19:8827907-8827929 GCTCCCTGCACTGGGAACACAGG - Intronic
1167117813 19:47498252-47498274 GCCACCTGCTTGGGGAAGCCAGG + Intronic
1168072603 19:53961293-53961315 GCCCCCTGCTATGGGAGTACAGG + Intergenic
926024108 2:9524773-9524795 GTTCTCTGATTTGGGAAAACTGG + Intronic
926950085 2:18232891-18232913 GGACCTTGCTTCGGGAAAACGGG + Intronic
927103347 2:19804771-19804793 GCCCATTCCTTTGGGAAAATGGG - Intergenic
929769498 2:44879803-44879825 GCCTCCTGCTTTTAGAAATCAGG + Intergenic
930353954 2:50293555-50293577 TAGCCCTGCTGTGGGAAAACAGG - Intronic
934331072 2:92070215-92070237 CCTCCCTGTTGTGGGAAAACAGG - Intergenic
935336574 2:102022294-102022316 GCCCCCTGCATTGGGATACCAGG - Intronic
940227992 2:151420478-151420500 GCCTCCCGCTTTGGGACTACAGG - Intronic
941305285 2:163857068-163857090 GCCTCTTGTTTAGGGAAAACTGG - Intergenic
944006452 2:194913904-194913926 GCCCCTTGTTTTGGGGAAGCTGG - Intergenic
944041319 2:195358113-195358135 TCCCACTGCTGTGGGAAGACTGG + Intergenic
947458088 2:230275112-230275134 TCCCCATGCTTTAGGACAACAGG + Intronic
948705938 2:239792502-239792524 GCCCCGTCCTGTGGGAAAGCAGG - Intronic
1170739555 20:19043332-19043354 ACCACCTGCATTGGGAGAACGGG + Intergenic
1171518589 20:25758840-25758862 GGACCCTGCTTTGGGAGACCTGG + Intergenic
1171558267 20:26097369-26097391 GGACCCTGCTTTGGGAGACCTGG - Intergenic
1174361882 20:50034055-50034077 GCCCGCTGCTGTGGGAAAACGGG + Intergenic
1175443400 20:59005754-59005776 GCACCCTGCTTTGGGAGAGAAGG - Intronic
1175824746 20:61930855-61930877 GTCCCCTGCTCTGGAAACACCGG + Intronic
1176998298 21:15581194-15581216 GGTCTCTGCTTTTGGAAAACTGG - Intergenic
1179125332 21:38585248-38585270 GCCCCCAGCTTTGGTAATAATGG + Intronic
1179553369 21:42157268-42157290 GCCCGCTTCTCTGGGAAGACTGG - Intergenic
1180165401 21:46023102-46023124 GCCCCCTCCTCTGGGGAATCGGG + Intergenic
1180959564 22:19756504-19756526 GCCCCCTGCGCTGGGAGAAATGG + Intergenic
949142404 3:650664-650686 GCTCCCTGCTTTAGGATAAATGG + Intergenic
950503158 3:13377124-13377146 GTCCCCAGCTTGGGGAAAAGGGG + Intronic
950690074 3:14648731-14648753 GCCTTCTGCTGTGAGAAAACTGG + Intergenic
953004940 3:38969459-38969481 GGCCCCTCCTTAGGGAACACAGG + Intergenic
953330974 3:42052866-42052888 GTCCCCAGCTCTGAGAAAACTGG + Intronic
953982400 3:47419253-47419275 GCCTCCTGCATTGGGGAAAGGGG + Intronic
954418519 3:50406088-50406110 GCCCCCTGGTCTGGGATCACAGG + Intronic
960838121 3:121928087-121928109 GCCCTCTCCTTAGGGAACACAGG + Intronic
961781811 3:129324975-129324997 GTCCCCAGCTTGGGGAAAAGGGG + Intergenic
963843322 3:150130277-150130299 GCCCACTGCTCTGGGGAAAAGGG + Intergenic
964941936 3:162168924-162168946 GCCACTTGCCTTGGGAAATCAGG + Intergenic
964954405 3:162334757-162334779 CCCCCCTGCTGTGTGAAACCTGG + Intergenic
970815522 4:20151602-20151624 GCCAGCTGCTTTGGGAAGATTGG - Intergenic
974222891 4:58999358-58999380 GTCTCCAGCTTTTGGAAAACTGG - Intergenic
977574625 4:98663076-98663098 GCCACATGCTCTGGGAAGACTGG + Intergenic
978892844 4:113850526-113850548 GCCTCCTGCGTTGGGATTACAGG + Intergenic
982084523 4:151820016-151820038 GACCCCTGCTTTAGGTGAACTGG - Intergenic
990873760 5:60462039-60462061 GCCCCCTGATTAGGGATACCTGG - Intronic
992080292 5:73230380-73230402 GCGCCCTGGTCTGGGAAAGCAGG + Intergenic
992525413 5:77605354-77605376 AACCCCTGCTTTGGGAAATCTGG - Intronic
996392691 5:122979406-122979428 GCCCACTGCATTGTGAAAAGGGG + Intronic
997611128 5:135216473-135216495 CCCCCATGCTCTGGGAAAGCAGG + Intronic
999602259 5:153280321-153280343 GCCCTCTGCCTTGGGAAAGTTGG + Intergenic
999956604 5:156709858-156709880 GCCCCCTACTCTGGGGAAATGGG + Intronic
1000055488 5:157602554-157602576 GCACCCTTTTTTGGGAAAAGGGG - Intergenic
1001636086 5:173211371-173211393 GCCCCCTCCTTTGTGTAAGCTGG + Intergenic
1004739039 6:18438674-18438696 GACATCTGCTTTGAGAAAACTGG - Intronic
1007464767 6:42044056-42044078 GCCCTCTGCTCTGGGCACACGGG + Intronic
1008309400 6:49947873-49947895 GTCACTTGCTTTGGGAAAAAAGG - Intergenic
1010176437 6:73033186-73033208 GCCCCCTGCTTGGGGAAAAGAGG - Intronic
1010927101 6:81755768-81755790 GCCTCCTGCATTGGGACATCTGG + Intergenic
1011143971 6:84191412-84191434 GCCCCCTACCTTGGGAATAGGGG - Intronic
1014627853 6:123751611-123751633 TCCCTCTGTTTTGGGCAAACTGG - Intergenic
1015165816 6:130198942-130198964 GCCCCGAAATTTGGGAAAACAGG - Intronic
1015754924 6:136597333-136597355 CATTCCTGCTTTGGGAAAACGGG + Intronic
1019578755 7:1749928-1749950 GGCGCCTGCCTTGGGAACACCGG + Intergenic
1019877499 7:3827189-3827211 GACTGCTGCTTTGGGAAACCGGG - Intronic
1022156117 7:27663144-27663166 GCCCTCTGCTTTGGTAAACAAGG - Intergenic
1022668318 7:32431575-32431597 GCCCTGTGCTTCTGGAAAACAGG + Intergenic
1023864599 7:44232778-44232800 GCCTCCTGCCTGGGGAAAGCGGG + Intronic
1023975640 7:45027922-45027944 GACCCCTGCTTTGGGAGGATGGG + Intronic
1032438539 7:131922429-131922451 GCCGACTTCTTAGGGAAAACAGG + Intergenic
1033280669 7:140004238-140004260 TCCCCCTGCTTTGGGAATAAAGG - Intronic
1034524457 7:151648407-151648429 GCCCCCTGCTTTGGGAAAACTGG + Intronic
1035401691 7:158570062-158570084 TCCCCCTGCCTGGGGGAAACGGG - Intronic
1036245266 8:7110779-7110801 GCCCCCTGCTGTGGGGAGAAGGG + Intergenic
1036513281 8:9420407-9420429 AACCCCTGCTTAGAGAAAACAGG + Intergenic
1037496730 8:19447648-19447670 TCCCCCTGCTCTGGGACATCTGG - Intronic
1038752717 8:30312196-30312218 TCCCCTTTCTTTGGGAAACCTGG + Intergenic
1039956021 8:42207694-42207716 TCCCCCTGCTTTATAAAAACAGG - Exonic
1042567663 8:70128892-70128914 GCATACTGCTGTGGGAAAACGGG + Exonic
1047732008 8:127735966-127735988 GCCCTCTGCTTTGGGAACCCGGG - Intronic
1049423832 8:142528487-142528509 GCGCCCTGCTCTCGGAAACCAGG - Intronic
1050037750 9:1455080-1455102 GTCCCCTTCTTTTGGAAATCTGG + Intergenic
1050058544 9:1680655-1680677 GCCCCCTGCTGTGGACAAATGGG - Intergenic
1050219741 9:3373691-3373713 TCCTCCTGCTTTTGGCAAACAGG - Intronic
1052833743 9:33235311-33235333 GGTGCCTGCTTTGGGAAAAGAGG - Intronic
1058045539 9:100353057-100353079 GCCCCCTGCTCTGTGGGAACCGG + Intergenic
1060207164 9:121688927-121688949 GTCCCCTGCCTTGGGAGGACAGG + Intronic
1060844774 9:126827402-126827424 GCCAGCTGCTGTGGGAACACAGG + Intronic
1061725314 9:132579320-132579342 GCCTCCTGCTGTGGGAACAGGGG + Intergenic
1194131680 X:90089261-90089283 GGCCTGTGCTTTGGGAAAATGGG - Intergenic
1199716393 X:150510061-150510083 GCCCACCCCTTTGGGAACACTGG - Intronic