ID: 1034527465

View in Genome Browser
Species Human (GRCh38)
Location 7:151674679-151674701
Sequence TAGGATGCCCTCTTTGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034527465 Original CRISPR TAGGATGCCCTCTTTGGAAG GGG (reversed) Intronic
900814845 1:4835809-4835831 TAGGCTGCCCACTTTCAAAGAGG - Intergenic
902751458 1:18514540-18514562 TGGGATGACCACTTTGTAAGAGG - Intergenic
903156882 1:21451466-21451488 TAGACAGGCCTCTTTGGAAGGGG - Intronic
903637045 1:24827803-24827825 TAGGGAGGTCTCTTTGGAAGAGG + Intronic
908392393 1:63695523-63695545 TAGGGTGCCCTTTTTGGAAGTGG + Intergenic
908427502 1:64021735-64021757 TAGGATATCCTTTCTGGAAGGGG + Intronic
908515697 1:64890656-64890678 TACAATGCCCTTTTTGCAAGAGG + Intronic
911527422 1:99004284-99004306 TAGAATGTCCTCTGGGGAAGGGG + Intronic
911660159 1:100492348-100492370 GAGGTTTCCCCCTTTGGAAGTGG - Intronic
912562875 1:110562879-110562901 TATTATGCCCTCTTTGGATTTGG + Intergenic
913815811 1:122972219-122972241 TTTGAGGCCTTCTTTGGAAGCGG + Intergenic
913819752 1:123042214-123042236 TTTGAGGCCTTCTTTGGAAGCGG + Intergenic
913821248 1:123069071-123069093 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
913839574 1:123397202-123397224 TTTGAGGCCTTCTTTGGAAGCGG + Intergenic
913842541 1:123450223-123450245 TTAGATGCCTTCTTTGGAAACGG + Intergenic
913863567 1:123828012-123828034 TTTGAGGCCTTCTTTGGAAGCGG + Intergenic
914372047 1:147034794-147034816 TAGGTTGAACTCTTTGGAATAGG + Intergenic
916677801 1:167078543-167078565 TATATTGCCCTCCTTGGAAGGGG - Intronic
920938588 1:210459071-210459093 TAAGATGGCCCGTTTGGAAGTGG + Intronic
921129619 1:212208588-212208610 TAGGCTGCACCCTTTTGAAGAGG + Intergenic
921358267 1:214306574-214306596 GAGGGTGCCTTCTTTTGAAGAGG + Intronic
924461833 1:244266492-244266514 TAGGGTTCCCTCACTGGAAGGGG - Intergenic
1065258737 10:23902504-23902526 TAGGATGCATTCTTTGCATGTGG + Intronic
1066825248 10:39563821-39563843 TTTGAGGCCTTCTTTGGAAGCGG + Intergenic
1066827238 10:39611062-39611084 TTTGAGGCCTTCTTTGGAAGCGG + Intergenic
1066833870 10:39788579-39788601 TTTGAGGCCTTCTTTGGAAGCGG + Intergenic
1066849731 10:40087526-40087548 TTGGAGGCCTTCGTTGGAAGCGG + Intergenic
1066860647 10:40304175-40304197 TATGATCCCTTCTTTGGAAACGG + Intergenic
1066890167 10:40888925-40888947 TTTGAGGCCTTCTTTGGAAGCGG + Intergenic
1067703909 10:48592854-48592876 CTGGCTGCCCTCTTTTGAAGAGG - Intronic
1068027443 10:51664640-51664662 TAAGATACCCTCTTTGAAAATGG + Intronic
1069605337 10:69735428-69735450 AAGAGTGCCCTCTGTGGAAGGGG - Intergenic
1071871532 10:89800466-89800488 TAGGTTGCCCTCTATGGAGCTGG + Intergenic
1075511143 10:123073838-123073860 TAGGATGCCCTGTCTGCCAGAGG + Intergenic
1076517525 10:131056481-131056503 TGAGACGCCCTCTGTGGAAGAGG + Intergenic
1078731872 11:13982437-13982459 TAGGATGACCTTTGTGGCAGAGG - Intronic
1082159505 11:48872504-48872526 TTGGAGCCCCTCTTTGGAAACGG + Intergenic
1082164898 11:48935722-48935744 TTTGAGGCCTTCTTTGGAAGAGG - Intergenic
1083632315 11:64102183-64102205 CAGGAACCCCTCTTTGGAAAAGG - Intronic
1088471637 11:110193632-110193654 TAGAGTGTCTTCTTTGGAAGAGG - Intronic
1093548855 12:20382994-20383016 TAGGATGCCTCATTTGGCAGTGG - Intronic
1094880336 12:34718035-34718057 TTGGAGGCCTTCTTTGGAAATGG - Intergenic
1095029892 12:37259245-37259267 TTGGAGGCCCTCTTTGGAAAAGG - Intergenic
1095293579 12:40503772-40503794 TAGCATGACTTGTTTGGAAGCGG + Intronic
1095293834 12:40506370-40506392 TAGGATGACTTTTTTGGGAGTGG + Intronic
1095294139 12:40509325-40509347 TAGGATGACTTGTTTGGAAGTGG + Intronic
1102687383 12:114735442-114735464 GAGGAAGCCCTGTTGGGAAGAGG - Intergenic
1104439030 12:128780253-128780275 TAGGCTGTCTCCTTTGGAAGGGG - Intergenic
1106455712 13:29924849-29924871 CAGGAAGCCCTCCTTGGCAGAGG - Intergenic
1107345202 13:39452814-39452836 TAGGATGCCCTATTTTTAAATGG - Intronic
1108176778 13:47800587-47800609 TGGGATGCCCCCTTTGAAACAGG - Intergenic
1114000526 14:18237377-18237399 TTTGAGGCCTTCTTTGGAAGCGG - Intergenic
1114000645 14:18239257-18239279 TTGGAGGCCTTCTTTGGAAACGG - Intergenic
1114461682 14:22890174-22890196 TAGGATGGTCTTTTGGGAAGAGG + Intergenic
1118816361 14:69317086-69317108 TTGGCTGCCCTCTCTGGAGGGGG - Intronic
1119329530 14:73783853-73783875 TAGAATGCCCTCTTTAGCTGGGG + Intronic
1122464155 14:101918701-101918723 TCGGAGGCTCTCTTTGGAGGTGG - Intronic
1124359938 15:29029247-29029269 AAGGATTCCCTGTTTGTAAGTGG - Intronic
1127416068 15:58758337-58758359 GAGGCTGCCCTCTTTGGACAGGG + Intergenic
1127650269 15:60999954-60999976 TAGGATGCCTTTTTTTGAGGGGG - Intronic
1133924593 16:10182604-10182626 TGGGAGGCCCCCTTGGGAAGGGG - Intronic
1137113075 16:36584402-36584424 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137114502 16:36608173-36608195 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137117944 16:36664912-36664934 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137123050 16:36749279-36749301 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137125987 16:36797836-36797858 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137127812 16:36828079-36828101 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137129876 16:36862392-36862414 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137137842 16:36994843-36994865 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137144448 16:37104252-37104274 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137144525 16:37105612-37105634 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137148696 16:37174227-37174249 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137157658 16:37322294-37322316 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137158433 16:37335199-37335221 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137159769 16:37357614-37357636 TTGGATGCCTTCGTTGGAAACGG + Intergenic
1137164844 16:37441517-37441539 TTAGATGCCTTCTTTGGAAATGG + Intergenic
1137168408 16:37500323-37500345 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137169530 16:37519010-37519032 TTAGATGCCCTCGTTGGAAACGG + Intergenic
1137174462 16:37600518-37600540 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137181741 16:37720764-37720786 TTGGATGCCTTCTTTGGAAACGG + Intergenic
1137188445 16:37832175-37832197 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137188775 16:37837614-37837636 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137192430 16:37898072-37898094 TTAGATGCCTTCTTTGGAAATGG + Intergenic
1137194678 16:37935102-37935124 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137197441 16:37980591-37980613 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137198117 16:37991804-37991826 TTAGATGCCTTCTTTGGAAATGG + Intergenic
1137205775 16:38118156-38118178 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1137206913 16:38136840-38136862 TTAGATGCCCTCGTTGGAAACGG + Intergenic
1137209818 16:38184752-38184774 TAGCATGCCTTCGTTGGAAACGG + Intergenic
1138587164 16:57978055-57978077 TAGGATCCCCTTTGGGGAAGGGG + Intronic
1139291890 16:65866985-65867007 TAAGATGCCCTCCCTAGAAGAGG + Intergenic
1141355113 16:83338402-83338424 CAGAGAGCCCTCTTTGGAAGAGG - Intronic
1145687580 17:26689907-26689929 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1145805015 17:27720438-27720460 TGGGATGTCCTGTTTAGAAGAGG + Intergenic
1146236375 17:31168464-31168486 TAGGATGCGTACTTTGGAATTGG + Intronic
1147156460 17:38546674-38546696 TAGGATGAGCTGTATGGAAGGGG - Intronic
1147245371 17:39116805-39116827 TAGGCAGCCCTCTTTGGACCAGG - Intronic
1147636587 17:41967730-41967752 AAGGACGTCCTCTTTGGAGGTGG - Intronic
1148716639 17:49720497-49720519 CAGGAGCCACTCTTTGGAAGAGG - Intronic
1149030018 17:52072088-52072110 TAGGATGCCCTCAGGGGCAGGGG - Intronic
1156028770 18:32688825-32688847 TAGGAGGGCCACTGTGGAAGAGG + Intronic
1156033348 18:32738981-32739003 TAGGCTGGCCTCTTTCTAAGAGG + Intronic
1165666123 19:37629936-37629958 TAGTATGTCCTCTTTTGAAGGGG + Intronic
930308089 2:49702298-49702320 TAGGTTGTCCTCTTGGGAAGAGG + Intergenic
932135773 2:69227349-69227371 TTGGATGCCCACCTTTGAAGAGG - Intronic
935319299 2:101870381-101870403 TAGAGTGCCCTCCTTGGATGGGG - Exonic
935353207 2:102173267-102173289 TCTGATGTCCTCTTTGAAAGTGG - Intronic
941228736 2:162882393-162882415 TAGTCTGCCCCCTTTAGAAGGGG - Intergenic
945837617 2:214851457-214851479 TTGGATGGCCTCTCAGGAAGTGG + Intergenic
1171258593 20:23710941-23710963 TGGGCTGCTCCCTTTGGAAGAGG + Intergenic
1171265911 20:23772403-23772425 TGGGCTGCTCCCTTTGGAAGAGG + Intergenic
1171914131 20:30998975-30998997 TTTGATGCCCTCATTGGAAACGG - Intergenic
1173648518 20:44648660-44648682 GAGGCTACCTTCTTTGGAAGAGG - Intronic
1174693765 20:52536651-52536673 TAGGAAGCCATCATTGGAAATGG + Intergenic
1175665645 20:60857551-60857573 TAGAATCCTCTGTTTGGAAGGGG - Intergenic
1176375248 21:6083776-6083798 AAGGATGCCGTCATTGGATGAGG + Intergenic
1176762868 21:12975780-12975802 TTGGAGGCCTTCTTTGGAAACGG - Intergenic
1178967780 21:37139888-37139910 TAGAATGCCTCCTTTGGAACTGG + Intronic
1179116172 21:38494474-38494496 TAAGATTCCCTCTGTGGGAGTGG - Intronic
1179748226 21:43454468-43454490 AAGGATGCCGTCATTGGATGAGG - Intergenic
1180117918 21:45724335-45724357 GAGAATGCAGTCTTTGGAAGTGG + Intronic
1180425040 22:15168176-15168198 TTTGAGGCCTTCTTTGGAAGCGG - Intergenic
952012484 3:28916419-28916441 TTGGATGCCCTATTGGAAAGGGG + Intergenic
952196157 3:31077425-31077447 TAGGATACCATGTTTGGCAGTGG - Intergenic
953052180 3:39354536-39354558 GAGAATGCCCTCTGTGGAGGGGG - Intergenic
954948404 3:54446926-54446948 AAGGATGCACAATTTGGAAGAGG - Intronic
955176021 3:56613474-56613496 TTGGTTCCCCTCTGTGGAAGAGG + Intronic
957894316 3:86401590-86401612 TAGCTTGCCCTCTTAGAAAGTGG + Intergenic
958211537 3:90485904-90485926 TTGGAGGCCTTCTTTGGAAATGG - Intergenic
958213584 3:90527610-90527632 TTGGAGGCCTTCTTTGGAAACGG - Intergenic
958214874 3:90551984-90552006 TTGGAGGCCTTCTTTGGAAACGG - Intergenic
958218103 3:90619596-90619618 TGTGAGGCCCTCTTTGGAAACGG - Intergenic
958222934 3:90719036-90719058 TATGAGGTCTTCTTTGGAAGCGG - Intergenic
958223125 3:90722419-90722441 TATGAGGTCTTCTTTGGAAGCGG - Intergenic
958228257 3:90858722-90858744 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
958237136 3:91008237-91008259 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
958239809 3:91053258-91053280 TCTGAGGCCCTCTTTGGAAACGG + Intergenic
958242195 3:91093191-91093213 TCTGAGGCCCTCTTTGGAAACGG + Intergenic
958244884 3:91138219-91138241 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
958272321 3:91517697-91517719 TTGGAGGCCTTCTTTGGAAGCGG - Intergenic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
973686400 4:53374807-53374829 TGGGATGCCCTGTTTGGAGGTGG + Intergenic
976486379 4:85610188-85610210 TAGGAAGCACCCTTGGGAAGCGG + Intronic
977882384 4:102219928-102219950 TAGAATGCACTCTGTGGTAGTGG - Intergenic
978983028 4:114974533-114974555 TCAGATGCCTTCTTTGAAAGAGG - Intronic
983040643 4:162921407-162921429 TAGGATGCCATTTGTGGATGGGG + Intergenic
989900006 5:47157299-47157321 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989900165 5:47160020-47160042 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989900327 5:47162741-47162763 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989900490 5:47165462-47165484 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989900649 5:47168180-47168202 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989900980 5:47173621-47173643 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989901148 5:47176342-47176364 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989901312 5:47179063-47179085 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989901458 5:47181444-47181466 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989901624 5:47184164-47184186 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989901789 5:47186884-47186906 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989901954 5:47189606-47189628 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989902118 5:47192326-47192348 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989902280 5:47195045-47195067 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989902430 5:47197425-47197447 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989902598 5:47200145-47200167 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989902761 5:47202864-47202886 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989902931 5:47205583-47205605 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989903096 5:47208304-47208326 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989903318 5:47212040-47212062 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989903461 5:47214420-47214442 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989903658 5:47217821-47217843 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989903821 5:47220541-47220563 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989903969 5:47222920-47222942 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989904136 5:47225641-47225663 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989904314 5:47228528-47228550 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989904480 5:47231248-47231270 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989904641 5:47233969-47233991 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989904805 5:47236688-47236710 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989904974 5:47239407-47239429 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989905052 5:47240767-47240789 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989905216 5:47243486-47243508 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989905386 5:47246202-47246224 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989905536 5:47248582-47248604 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989905703 5:47251302-47251324 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989905871 5:47254021-47254043 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989906039 5:47256743-47256765 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989906202 5:47259463-47259485 TATGACGCCTTCTTTGGAAAAGG + Intergenic
989906368 5:47262183-47262205 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989906697 5:47267626-47267648 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989906869 5:47270348-47270370 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989907033 5:47273069-47273091 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989907196 5:47275788-47275810 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989907362 5:47278510-47278532 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989907687 5:47283948-47283970 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989908016 5:47289387-47289409 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989908176 5:47292108-47292130 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989908340 5:47294828-47294850 TATGAGGCCTTCTTTGGAAAAGG + Intergenic
989909455 5:49610018-49610040 TTAGATGCCTTCTTTGGAAACGG - Intergenic
992834085 5:80623090-80623112 TAGGATGCACTCTTTTGATCTGG - Intergenic
993638926 5:90379544-90379566 CAGGAGGCCCTCTTGAGAAGTGG - Intergenic
996349315 5:122520800-122520822 TAAGATGCTCTCTTTAGAGGTGG - Intergenic
996372097 5:122764201-122764223 TAGGATAACCACTTTGGATGGGG - Intergenic
997209317 5:132068198-132068220 TAGGTTTCCCTCATGGGAAGTGG - Intergenic
1001462849 5:171933560-171933582 TGGGATGCCCACATTGTAAGAGG + Intronic
1004715772 6:18215138-18215160 GAGGAAGCCCTCCTTGAAAGGGG + Intronic
1005575057 6:27182790-27182812 GGTGATGCCCTGTTTGGAAGGGG - Intergenic
1009065117 6:58450776-58450798 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009065331 6:58453833-58453855 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009065829 6:58560800-58560822 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009067416 6:58583061-58583083 TTGGAGGCATTCTTTGGAAGAGG + Intergenic
1009068245 6:58594442-58594464 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009068470 6:58597499-58597521 TATGAGGCCTTCTTTGGAAACGG + Intergenic
1009074594 6:58683053-58683075 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009076778 6:58713624-58713646 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009077659 6:58725853-58725875 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009078314 6:58735024-58735046 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009081355 6:58777285-58777307 TATGAGGCCTTCTTTGGAAACGG + Intergenic
1009082447 6:58792574-58792596 TATGAGGCCTTCTTTGGAAACGG + Intergenic
1009099783 6:59033958-59033980 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009103300 6:59082854-59082876 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009108103 6:59149582-59149604 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009115988 6:59259604-59259626 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009121640 6:59338174-59338196 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009122088 6:59344290-59344312 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009122746 6:59353463-59353485 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009127418 6:59418473-59418495 TTGGAGGCCTTCTTTGGAAAAGG + Intergenic
1009135570 6:59531812-59531834 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009136013 6:59537927-59537949 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009137759 6:59562388-59562410 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009143210 6:59637908-59637930 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009144324 6:59653194-59653216 TTGGAGGCCTTCTTTGGAAACGG + Intergenic
1009155808 6:59812981-59813003 TTGGAGGCCTTCTTTGGAAAAGG + Intergenic
1009255378 6:61385762-61385784 TTTGAGGCCTTCTTTGGAAGCGG + Intergenic
1009256495 6:61410605-61410627 TCTGATGCCTTCTTTGGAAACGG + Intergenic
1009256723 6:61415528-61415550 TTTGAGGCCCTCTTTGGAAACGG + Intergenic
1012368278 6:98470034-98470056 TAGGATGCCCCCTTCTAAAGAGG + Intergenic
1013168744 6:107617249-107617271 CACGCTGCCCTCTTTAGAAGCGG - Intronic
1017876905 6:158532278-158532300 TTGAATGCCCTCTTTACAAGTGG - Intergenic
1017928554 6:158931957-158931979 TGGGATGCCAACTTTTGAAGTGG - Intergenic
1018617604 6:165702758-165702780 CAGGATCCCTTCTTCGGAAGAGG - Intronic
1018828788 6:167425988-167426010 TAGGAAGCCCTCTGTGTGAGTGG + Intergenic
1021349994 7:19580598-19580620 TATGATGTGCTCCTTGGAAGAGG - Intergenic
1024533913 7:50414192-50414214 TAGGATCCCATATTTGTAAGTGG - Intergenic
1033174636 7:139112933-139112955 TCGGGTGCCCTATTTGAAAGTGG + Intergenic
1034527465 7:151674679-151674701 TAGGATGCCCTCTTTGGAAGGGG - Intronic
1034883101 7:154777337-154777359 TTGGAGGCCCTCTTGGGAAACGG + Intronic
1036358424 8:8061102-8061124 CAGGATTCCCTCTTTTCAAGGGG - Intergenic
1037967260 8:23144722-23144744 TGGGGTGACCTCATTGGAAGGGG - Intronic
1038672329 8:29592261-29592283 AAGGATGCCCTCTCTGAGAGAGG + Intergenic
1039430248 8:37520089-37520111 GAAGATGCCCTCTTGGGAGGCGG - Intergenic
1039692294 8:39876632-39876654 TAGGATGTCCTGTTTAGAGGGGG - Intergenic
1041162774 8:55061855-55061877 ACGGATGCCCTCCTTGGGAGTGG + Intergenic
1041435410 8:57834500-57834522 TGTGATGGCTTCTTTGGAAGTGG - Intergenic
1041794734 8:61735482-61735504 TAGGTGGCCCTCTCTGGCAGTGG - Intergenic
1047440397 8:124872457-124872479 AACCATGCCCTCTTGGGAAGAGG + Intergenic
1051433478 9:17005183-17005205 GAGGCTGCCCTCTTTGGAGATGG + Intergenic
1052254086 9:26433134-26433156 TAGGAGGCCCTCTAGGAAAGGGG + Intergenic
1057016796 9:91659103-91659125 TTGGATGCCCTCTGTGAAATGGG - Intronic
1060207048 9:121688280-121688302 CAGGAGGCCCTCTGTGGAGGTGG + Intronic
1203405342 Un_KI270530v1:621-643 TTAGATGCCTTCTTTGGAAACGG + Intergenic
1186281270 X:7995461-7995483 CATGATGCCTTCTTTGGAAGTGG - Intergenic
1187285141 X:17897757-17897779 TAGGTTGCCCTCTGAGGGAGAGG - Intergenic
1188274123 X:28178849-28178871 TTGGTTTCTCTCTTTGGAAGAGG + Intergenic
1188301653 X:28511568-28511590 AATGGTGCCCTGTTTGGAAGTGG - Intergenic
1189559131 X:42174759-42174781 TAGGAGCGCATCTTTGGAAGAGG + Intergenic
1191250914 X:58259799-58259821 AAGGAAGCCCCCGTTGGAAGGGG + Intergenic
1191682691 X:63857644-63857666 AAGGATGCCAACTTTGGAAATGG - Intergenic
1195320163 X:103715219-103715241 TAGGATGCCCTCTTAGTAAGTGG - Intronic
1195941262 X:110169828-110169850 GTGGTTGCCCTCTTTAGAAGGGG + Intronic
1196611091 X:117715656-117715678 TAAGTTGCCCTCTTTCGATGGGG + Intergenic
1198299874 X:135325020-135325042 TAAGATGTCTTCTTTGGAAATGG + Intronic