ID: 1034527593

View in Genome Browser
Species Human (GRCh38)
Location 7:151675572-151675594
Sequence CAAGCAGCACACGTTTCCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 102}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034527593_1034527600 5 Left 1034527593 7:151675572-151675594 CCAGGGGAAACGTGTGCTGCTTG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1034527600 7:151675600-151675622 TTGGGTGGGTGTTGACGGAGAGG 0: 1
1: 0
2: 1
3: 21
4: 231
1034527593_1034527602 13 Left 1034527593 7:151675572-151675594 CCAGGGGAAACGTGTGCTGCTTG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1034527602 7:151675608-151675630 GTGTTGACGGAGAGGAGGAGAGG 0: 1
1: 0
2: 4
3: 37
4: 430
1034527593_1034527598 -9 Left 1034527593 7:151675572-151675594 CCAGGGGAAACGTGTGCTGCTTG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1034527598 7:151675586-151675608 TGCTGCTTGGTCACTTGGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 176
1034527593_1034527601 8 Left 1034527593 7:151675572-151675594 CCAGGGGAAACGTGTGCTGCTTG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1034527601 7:151675603-151675625 GGTGGGTGTTGACGGAGAGGAGG 0: 1
1: 0
2: 0
3: 28
4: 446
1034527593_1034527604 20 Left 1034527593 7:151675572-151675594 CCAGGGGAAACGTGTGCTGCTTG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1034527604 7:151675615-151675637 CGGAGAGGAGGAGAGGCCGGAGG 0: 1
1: 0
2: 6
3: 96
4: 890
1034527593_1034527599 0 Left 1034527593 7:151675572-151675594 CCAGGGGAAACGTGTGCTGCTTG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1034527599 7:151675595-151675617 GTCACTTGGGTGGGTGTTGACGG 0: 1
1: 0
2: 1
3: 8
4: 191
1034527593_1034527603 17 Left 1034527593 7:151675572-151675594 CCAGGGGAAACGTGTGCTGCTTG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1034527603 7:151675612-151675634 TGACGGAGAGGAGGAGAGGCCGG 0: 1
1: 0
2: 4
3: 81
4: 875
1034527593_1034527597 -10 Left 1034527593 7:151675572-151675594 CCAGGGGAAACGTGTGCTGCTTG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1034527597 7:151675585-151675607 GTGCTGCTTGGTCACTTGGGTGG 0: 1
1: 0
2: 1
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034527593 Original CRISPR CAAGCAGCACACGTTTCCCC TGG (reversed) Exonic