ID: 1034533230

View in Genome Browser
Species Human (GRCh38)
Location 7:151710405-151710427
Sequence CAGTGTGGCAGCGGAGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034533230_1034533235 -2 Left 1034533230 7:151710405-151710427 CCCTTTGCTCCGCTGCCACACTG 0: 1
1: 0
2: 2
3: 8
4: 185
Right 1034533235 7:151710426-151710448 TGAGGCCACATGAACCTTCGTGG No data
1034533230_1034533236 -1 Left 1034533230 7:151710405-151710427 CCCTTTGCTCCGCTGCCACACTG 0: 1
1: 0
2: 2
3: 8
4: 185
Right 1034533236 7:151710427-151710449 GAGGCCACATGAACCTTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034533230 Original CRISPR CAGTGTGGCAGCGGAGCAAA GGG (reversed) Intronic
902580759 1:17406098-17406120 CAGTTTGGGAGAGGAGGAAACGG - Intergenic
904007738 1:27372709-27372731 CAGGGAGGCAGCAGAGTAAAAGG - Intronic
904058375 1:27686981-27687003 CAGTGTGGCGGCCGAGCTCATGG + Intergenic
906124294 1:43417397-43417419 CTGGGTAGCAGCAGAGCAAAAGG + Intronic
906473469 1:46150678-46150700 CAGAGTGGAAGCAGAGAAAATGG + Intronic
910980990 1:92960581-92960603 CAGACTGGCAGCGGAACAGAGGG + Intronic
912594040 1:110856395-110856417 CACTGTGGCAGCGGAGGAGATGG - Intergenic
916721036 1:167484929-167484951 CAGTCTGGCAGCAGAGCAGCAGG - Intronic
920065483 1:203266657-203266679 CGGGGTGGCAGCTGAGCAGAGGG + Intronic
921624337 1:217361521-217361543 CTGTTTGGCAGAGGAGCAACAGG - Intergenic
922038700 1:221874779-221874801 CTTTGTGGCAGAGGAGCACATGG - Intergenic
1063031888 10:2243929-2243951 GAGTGAGGAAGCGAAGCAAACGG + Intergenic
1064090041 10:12375484-12375506 CAATGTGGCAGCCAAGGAAAAGG - Intronic
1068099746 10:52537271-52537293 TAGTGAGGCTGCGGAGAAAAAGG - Intergenic
1069867454 10:71512568-71512590 CAGGATGGCAGCTGAGCAATGGG - Intronic
1073011393 10:100362720-100362742 CAGTGTGGCAGGGGAGCACAGGG - Exonic
1073179852 10:101577200-101577222 CACTGAGGCAGAGGAGCTAATGG - Intronic
1083151140 11:60792555-60792577 CAGTGAGGCAGAGAAGGAAATGG + Intronic
1086986524 11:93255995-93256017 CAGTGTGGCTCAGGAGCAGATGG + Intergenic
1087012965 11:93530661-93530683 CATTGTGTCAGGGGAGGAAAGGG - Intronic
1090849101 11:130555779-130555801 CAGTGATGCAGCGGAGGACAAGG + Intergenic
1091337935 11:134786372-134786394 CAGTGAGGCAGTGGCGTAAATGG - Intergenic
1091835803 12:3584809-3584831 CAATGGGGCAGCTGGGCAAAGGG - Intronic
1092882948 12:12901954-12901976 CAGCCTGGGAGAGGAGCAAAGGG - Intronic
1094005116 12:25741110-25741132 CAGTGTGGCATCGGGTTAAACGG - Intergenic
1096762745 12:53856263-53856285 CAGTGGGGCAGCAGAGCATGGGG + Intergenic
1099265868 12:80447040-80447062 CAGTGTGGATGCAGAGAAAAGGG - Intronic
1101427178 12:104597882-104597904 CAGTGTGGCAGCTGAGACCATGG + Intronic
1103350224 12:120278532-120278554 CAGGGTGGCAGCCGGGCAGAGGG + Intergenic
1103985193 12:124762260-124762282 CACTGTGGCCCCAGAGCAAAGGG + Intergenic
1104034131 12:125086899-125086921 CAGTGAGGCAGGGCAGGAAAGGG + Intronic
1104448102 12:128848955-128848977 CAGTGAGGCAGTGGGGAAAATGG - Intergenic
1104833876 12:131774111-131774133 CAGTGTGGCTGCGGGGCACGGGG + Intronic
1106243143 13:27925785-27925807 CAGTGTGGAACTGGAGCACAGGG - Exonic
1107163625 13:37260399-37260421 CAGTGTGGAAAGGGAGTAAAGGG + Intergenic
1108813301 13:54257642-54257664 CAGTGTGGAAGTGGAGGAGAAGG - Intergenic
1110443248 13:75548927-75548949 CACTGTGGCTGCAGAGTAAAGGG - Intronic
1110636722 13:77775314-77775336 CAGTGTGTTAGTGGAGCCAACGG - Intergenic
1113093469 13:106638842-106638864 TAGTGTGGCAGGGGAACAAGTGG - Intergenic
1117563095 14:56965102-56965124 CAGTGTGACAGGAAAGCAAAGGG + Intergenic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1120521004 14:85528705-85528727 CAAGGTGGCAGCAGAGCATAGGG - Exonic
1120946763 14:90005150-90005172 GAGTGTGGCTGCAGAGCAGATGG - Intronic
1121096378 14:91220635-91220657 GAGTGTGGCAGCGGGAGAAACGG - Intronic
1121449506 14:93998354-93998376 CAGTGTGGCTTGGAAGCAAATGG + Intergenic
1123183121 14:106488478-106488500 CAGTGTGGGAGTGGAGCTAATGG - Intergenic
1125577420 15:40765048-40765070 CATTTTGGCAGCTGAGCAGATGG - Intronic
1125756498 15:42068990-42069012 CAGCCTGGCAGCGGCGCACAGGG + Intronic
1126212420 15:46114728-46114750 CAGTGTGGAAGGGAAGCAACTGG - Intergenic
1128556462 15:68635198-68635220 AAGTCTGGCAGGGGATCAAATGG - Intronic
1129363311 15:75038235-75038257 GGGTGTGGCAGCAGAGCAAGGGG - Intronic
1130526932 15:84715758-84715780 CACTGAGGCAGGGGAGCAAATGG - Intronic
1132974800 16:2705917-2705939 CAGTGTGGCATCTGAGCATCCGG - Intronic
1133722627 16:8509014-8509036 CGGTGGGGCTGCGGAGAAAAGGG + Intergenic
1134216553 16:12321135-12321157 CAGTGTGGCAGCTGACAGAAGGG - Intronic
1135633034 16:24050998-24051020 CAGCCTGGCCGTGGAGCAAAAGG - Intronic
1137688999 16:50407351-50407373 CAGTGTGCCATCAGAGCTAAAGG - Intergenic
1138946089 16:61851769-61851791 CAGTGTAGCATCAGAGAAAATGG - Intronic
1139306148 16:65987978-65988000 CTTTGTGACAGCGGAGCAATGGG - Intergenic
1139334232 16:66219884-66219906 CTGTGTGGCAGGGGAGGACAGGG + Intergenic
1141765045 16:86052487-86052509 CAGTGTGTGAGGGCAGCAAAGGG + Intergenic
1142434319 16:90047323-90047345 CAGTGGGGCAGGGGAGCCACAGG - Intergenic
1142513441 17:411989-412011 CAGTGTGGGAAGGGAGCAATGGG + Intronic
1143502396 17:7347047-7347069 CAGGGTGGCAGCAGAGCCTATGG - Exonic
1143651638 17:8267138-8267160 CTGTGTGGCAGAGGAGGAACGGG + Exonic
1144215417 17:13050779-13050801 TAGTGTTTCAGCTGAGCAAAAGG - Intergenic
1144658161 17:17051289-17051311 GAGTGTGGCAGCGAGGCACAGGG + Intronic
1144942306 17:18950196-18950218 GAGGGTGGCAGCGGAGGACATGG - Intergenic
1145973237 17:28969267-28969289 CAGTCTGGCAGCTAAGCAGATGG + Intronic
1147184136 17:38704775-38704797 CAGAGTGGCCTCGGAGGAAAGGG + Intergenic
1147855400 17:43475906-43475928 CAGTGTGGGAGGGGAGAAACAGG + Intergenic
1147961121 17:44168223-44168245 CATTCCGGCAGCGGAGCAGAAGG + Intergenic
1147991263 17:44334993-44335015 CAGGCTGGGAGCAGAGCAAACGG - Intergenic
1148144624 17:45355245-45355267 CAGAGTTGGAGTGGAGCAAAAGG + Intergenic
1150492936 17:65586849-65586871 CAGGGTGCTAGGGGAGCAAAAGG + Intronic
1152173739 17:78772107-78772129 TAGTGTGGCAACGGAGCAAATGG + Intronic
1153413095 18:4815985-4816007 CAGTGTGGAAGAGGACCAGAGGG - Intergenic
1155443417 18:25885210-25885232 CAGTGGGGTAGAGGAGCAAGTGG + Intergenic
1157081980 18:44535255-44535277 CAGTGTGGCAGCAATGTAAAGGG + Intergenic
1163396100 19:17062514-17062536 GAGTGGGGATGCGGAGCAAAGGG - Intronic
927190869 2:20516073-20516095 CAGTGTGGGAGCAGGGCAGAGGG + Intergenic
928196962 2:29223037-29223059 CAGGGGAGCAGGGGAGCAAAGGG - Intronic
933808244 2:86015637-86015659 CACTGTGGCAGGGGAGGGAAGGG - Intergenic
933902438 2:86859694-86859716 CATTTTGGCTGTGGAGCAAAGGG + Intronic
935778109 2:106489574-106489596 CATTTTGGCTGTGGAGCAAAGGG - Intergenic
938398410 2:130967370-130967392 CAGTGTGGCAGCACAGCTGATGG - Intronic
940203268 2:151174797-151174819 CAGTGTGGCATAGCAGCGAAAGG + Intergenic
940666561 2:156617553-156617575 CAGTGTGGAAGGGGACCCAAGGG + Intergenic
943529136 2:189057007-189057029 CAGGGTGGCATAGGAGAAAAAGG - Exonic
947304331 2:228726834-228726856 CACTGTGGCAGCCAAGGAAATGG + Intergenic
948524085 2:238559754-238559776 CAGTGGGGGAGAGAAGCAAAAGG + Intergenic
1168844192 20:932225-932247 CAGGGTGGCAGCTGACCAGAAGG + Intergenic
1171025699 20:21628680-21628702 CAGTGCTGCAGCTGAGGAAATGG - Intergenic
1173262938 20:41452544-41452566 CATTGTGGTTGCGGAGCATACGG + Intronic
1177413122 21:20757053-20757075 CATTGTAACAGCAGAGCAAAAGG + Intergenic
1177628061 21:23690349-23690371 AGGTGTAGCAGTGGAGCAAAAGG - Intergenic
1179570658 21:42276853-42276875 CAGTGTGGAAGCAGAACAGACGG - Intronic
1183497205 22:38153770-38153792 CAGTGTGGCAGAGCACCAAGAGG + Intronic
949182475 3:1150885-1150907 CAATGAGGCAGCAGAGCAGAGGG + Intronic
950019817 3:9779410-9779432 TAGTGTGGCAGTGGAGCAGTTGG - Intronic
950608132 3:14102871-14102893 CAGTGAGGCTGCAGAGAAAATGG + Intergenic
952966399 3:38623631-38623653 CAGTTTGGCAGCTGTGCATACGG - Intronic
955336308 3:58089004-58089026 CACTGTGGCAGGGGAGGGAAGGG - Intronic
955585222 3:60470685-60470707 CAGTATGGCAGAGGATCAAGTGG - Intronic
955670020 3:61393472-61393494 CAGGGTGGCAGCCGGGCAGAGGG + Intergenic
956256673 3:67290599-67290621 CAGTGTGGCTGCAGAGGAAAGGG - Intergenic
956773873 3:72549317-72549339 CAGAGAGGCAGCAGAGCACAGGG + Intergenic
958747927 3:98160075-98160097 CAGAGAGGCTGCGGAGAAAAAGG + Intergenic
963776337 3:149444900-149444922 CGGGGTGGCAGCCGGGCAAAGGG + Intergenic
964993373 3:162844036-162844058 CAGTGTGGAAGGGGACCCAAGGG + Intergenic
965744278 3:171907499-171907521 CAGTGCGGCGGCGGGCCAAAGGG + Intronic
966183093 3:177204347-177204369 CAGTGCAGCAGCGGACTAAAGGG + Intergenic
966463499 3:180203490-180203512 CAGTGAGGTAGAGGACCAAAGGG + Intergenic
966903731 3:184506909-184506931 CAGTGCAGAAACGGAGCAAAGGG - Intronic
968123307 3:196141422-196141444 CTGTGAGGCAGAGGATCAAATGG + Intergenic
969091629 4:4698261-4698283 CAGTGGGGCAGAGGAGAGAAGGG + Intergenic
969299536 4:6289627-6289649 CAGAGAGGCAGGGGAGGAAAGGG + Intronic
970683811 4:18542500-18542522 CAGTGTAGCAGGGGAGCGGAGGG - Intergenic
970894438 4:21086005-21086027 CAGTGAGGGAGCAGAGGAAATGG - Intronic
971852254 4:31997386-31997408 CAGTGTGGAAGGGGATCCAAGGG - Intergenic
972428238 4:38955459-38955481 CACTGTGGCAGCCCAGAAAAGGG - Intergenic
974290896 4:59928819-59928841 CAGTGTGGCAGCAGTACCAAAGG + Intergenic
976227671 4:82809041-82809063 TAGTGTGGCAGGGGAGAAAGGGG + Intergenic
979812065 4:125048673-125048695 CAGTGAGGATGTGGAGCAAAGGG + Intergenic
980464203 4:133152140-133152162 CAGGGTGGCGGTGGAGGAAAGGG - Exonic
982538373 4:156636457-156636479 CAGTTTGGGAGTGGAGGAAAAGG - Intronic
985731165 5:1549842-1549864 CAGAGTGGGAGCGGATCACAGGG + Intergenic
993202069 5:84829719-84829741 CAGTGTGGAAGGGGACCCAAGGG + Intergenic
995582860 5:113619145-113619167 CAGTGTGGAAGGGGACCCAAGGG + Intergenic
995817279 5:116185488-116185510 CAGGGTGGCATCGGAGAAAAAGG - Intronic
998456986 5:142281069-142281091 CAGTGTGCCAGAGGGGCCAACGG + Intergenic
998859456 5:146428407-146428429 CAGTAGGGCAGCGGGGCAAGAGG + Intergenic
1004776645 6:18853849-18853871 CAGGGTGGCAGCAGAGAAAGAGG + Intergenic
1006453248 6:34117500-34117522 CAGTGTGGCAGCTGAGGTAGTGG - Intronic
1007626068 6:43247063-43247085 CAGTGTGGCGGAGGAGGAAGAGG + Intronic
1010629355 6:78178934-78178956 CAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1010868025 6:81004645-81004667 GAGAGTGGGAGCCGAGCAAAAGG - Intergenic
1011751844 6:90461764-90461786 CAGGGTGGCAGCTGAGGAGAGGG + Intergenic
1012055472 6:94402744-94402766 TAGTGTGGTAGAGGAGCAGAAGG + Intergenic
1013028586 6:106306724-106306746 CAGTGTGGGAGAGTAGCAATGGG - Intronic
1013573881 6:111459775-111459797 CAGTGGGGCTGTGGAGAAAAGGG + Intronic
1014469414 6:121796912-121796934 CTGTGTGCCAGGGGAGCTAATGG - Intergenic
1015905952 6:138116594-138116616 CAGTGTGGCAGCATTCCAAAAGG + Intergenic
1017602562 6:156099756-156099778 CAGGGTGGCAGGAGAGAAAAGGG - Intergenic
1018633802 6:165843288-165843310 CAGAGTGGAAGCGCAGCAGAGGG + Intronic
1020007793 7:4791577-4791599 CAGTGTTGCCTGGGAGCAAAAGG - Exonic
1020485763 7:8718336-8718358 CAGTGTAGCACCTGAGCAATTGG + Intronic
1024170875 7:46784733-46784755 GAGTTTGGCATCTGAGCAAAGGG - Intergenic
1027847476 7:83400231-83400253 CAGTGTGCCAGCAAAGTAAATGG - Exonic
1028600466 7:92595151-92595173 GAGTGTGGAATCGGAGCAAGGGG - Intergenic
1029306794 7:99625521-99625543 CAGTGTGGCAGTGATGCAAGTGG + Intronic
1029647652 7:101868494-101868516 CAGTGTGTAAGATGAGCAAAGGG - Intronic
1030693688 7:112560709-112560731 AAGTGTAGCAGTGGAGCAAGTGG + Intergenic
1031330779 7:120461028-120461050 CAGGGTGACAGTGGAACAAAAGG - Intronic
1034533230 7:151710405-151710427 CAGTGTGGCAGCGGAGCAAAGGG - Intronic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037604472 8:20425757-20425779 CAGGGTGGCTGGGGAGCCAAAGG + Intergenic
1037695289 8:21218095-21218117 CAGAGAGGCAGGGGAACAAAGGG - Intergenic
1039385721 8:37134033-37134055 CAGTGGGGCAGCAGAGCAAGTGG - Intergenic
1039521060 8:38172228-38172250 CAGTGTGGCAGAGTGGGAAAAGG + Intronic
1039840139 8:41287106-41287128 CTGTGTGGCACCGGAGAAACTGG - Intronic
1043538128 8:81228511-81228533 CTGTGTGGCAGAAGAGCCAAAGG + Intergenic
1044069843 8:87744526-87744548 CAGGGAGGCAGCAGTGCAAATGG - Intergenic
1044457022 8:92400971-92400993 CAGTGTGGAAGGGGACCCAAGGG + Intergenic
1045066365 8:98449900-98449922 CAGTGTGGCGGAGAAACAAAAGG - Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1050885252 9:10756513-10756535 CAGTGAGGCTGTGGAGAAAAGGG + Intergenic
1051247994 9:15131088-15131110 CATTGTGTGAGCTGAGCAAAAGG + Intergenic
1051459217 9:17294223-17294245 CAGTGTGGAAGGGGACCCAAGGG + Intronic
1051812890 9:21070345-21070367 GAGTCTGGCAAAGGAGCAAATGG + Intergenic
1053092044 9:35287467-35287489 CAGTGAGGCTGTGGAGCAACTGG - Intronic
1053168976 9:35864928-35864950 CTATGTGGCAGGGGAGCAAGAGG - Intergenic
1054821565 9:69526577-69526599 CAGTGAGGCTGTGGAGAAAAGGG + Intronic
1057396624 9:94686602-94686624 CACTGTGGCTGCTGAGCAAGTGG + Intergenic
1058069906 9:100591387-100591409 CAGTGTGGCTGAGGAACAAAGGG + Intergenic
1058464791 9:105216497-105216519 GAGTGAGGCAGAGGAGCAAATGG - Intergenic
1059510436 9:114839951-114839973 CACTGTGGCAGGGGAGCCATGGG - Intergenic
1062682436 9:137789001-137789023 GAGGGAAGCAGCGGAGCAAAAGG - Intronic
1186576318 X:10769867-10769889 CATTGTGGCATCAGGGCAAACGG + Intronic
1188374468 X:29410625-29410647 CAGTGTTTCAGAGCAGCAAATGG - Intronic
1189858926 X:45252330-45252352 CCATGTGGCAGAGGAGGAAAGGG - Intergenic
1190505029 X:51119111-51119133 CAGGGTGGCAGCCGGGCAGAGGG + Intergenic
1193114847 X:77766384-77766406 CGGGGTGGCAGCGGGGCAGAGGG + Intronic
1193198666 X:78662636-78662658 CAGTGTGACAGCTGATCAAGCGG - Intergenic
1193665180 X:84307810-84307832 CAGTGTGCCAGCGGAGACACAGG + Intergenic
1196642628 X:118080618-118080640 CAGTGAGGCTGCAGAGAAAAGGG + Intronic
1197378863 X:125713894-125713916 CAGTGTGGGAAGGGAGCAAGTGG - Intergenic
1200658920 Y:5938344-5938366 CAGTGGGGCAGCCGGGCAGAGGG - Intergenic
1201202004 Y:11548866-11548888 CAGTGTGGCATGGAATCAAATGG + Intergenic
1201202641 Y:11554451-11554473 CAGTGTGGCATGGAATCAAATGG + Intergenic
1201203294 Y:11560082-11560104 CAGTGTGGCATGGAATCAAATGG + Intergenic
1201203951 Y:11565689-11565711 CAGTGTGGCATGGAATCAAATGG + Intergenic
1201204598 Y:11571286-11571308 CAGTGTGGCATGGAATCAAATGG + Intergenic
1201205250 Y:11576898-11576920 CAGTGTGGCATGGAATCAAATGG + Intergenic
1201205899 Y:11582504-11582526 CAGTGTGGCATGGAATCAAATGG + Intergenic
1201206547 Y:11588111-11588133 CAGTGTGGCATGGAATCAAATGG + Intergenic