ID: 1034536067

View in Genome Browser
Species Human (GRCh38)
Location 7:151726648-151726670
Sequence GATGCAGCCGTGCCTGCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034536067 Original CRISPR GATGCAGCCGTGCCTGCGTG CGG (reversed) Intronic
900924966 1:5699240-5699262 GAGGCAGCTCTGCCTGCCTGGGG - Intergenic
900994001 1:6110514-6110536 GGCGTAGCCGTGCCTGGGTGGGG + Exonic
901492190 1:9602279-9602301 GAAGCAGCCATGACTGCGGGGGG + Intronic
902979384 1:20112342-20112364 GGGGCAGCTGTGCCTGTGTGGGG - Exonic
903618425 1:24679744-24679766 GGTGCAGCTGTGGCTGGGTGCGG - Intergenic
905202557 1:36323833-36323855 GCTGGAGCTCTGCCTGCGTGCGG + Exonic
912801800 1:112724044-112724066 GATGGAGCCCTGCCTGCCGGGGG + Exonic
912818368 1:112848197-112848219 GATGCAGGCCTGGCTGGGTGCGG - Intergenic
917178222 1:172262390-172262412 TATGCAGCAGTGCCTTCATGTGG + Intronic
918359477 1:183741122-183741144 GAGGCAGCAGTGCATGCATGAGG + Intronic
921048144 1:211491705-211491727 GGTGCAGCTGTGCCAGGGTGCGG + Intronic
922945223 1:229508296-229508318 GTTGCAGCCTGGCCTGCGCGCGG + Exonic
923037282 1:230293177-230293199 GATGCACCCGTGTCCGTGTGTGG + Intergenic
924477343 1:244393795-244393817 TATGCAGCAGTGCCTGCAAGTGG - Intergenic
1063866015 10:10366574-10366596 GATGCATCCGTCCCTGTATGTGG - Intergenic
1064729483 10:18315552-18315574 GATGCAGTGGTGCCTGCCTGTGG + Intronic
1065476371 10:26142293-26142315 CATGCAGCCATGCTTGCATGTGG - Intronic
1067830041 10:49606325-49606347 GCTGCACCAGTGCCTGGGTGAGG - Intergenic
1067995877 10:51272728-51272750 GATGCAGCCCAGCCTCTGTGCGG + Intronic
1069759411 10:70798332-70798354 GATTCAGCCGTTCCAGCCTGTGG - Intergenic
1070670300 10:78372945-78372967 GATGCTGCAGTGCCTGTGAGGGG + Intergenic
1072330654 10:94347159-94347181 AATGCTGCTGTGCCTGCGGGAGG - Intronic
1073449245 10:103600049-103600071 CATGCTGCCCTGCCTGGGTGGGG + Exonic
1076635521 10:131879958-131879980 GAAGGAGGTGTGCCTGCGTGTGG + Intergenic
1077287490 11:1774093-1774115 GATGCAGACCTGCCTTCATGGGG + Intergenic
1080685647 11:34512982-34513004 GCTGAAGCCGGGCCTGCGTGTGG - Intronic
1081686940 11:45049433-45049455 GATGTAGCTGTGGCTGGGTGGGG + Intergenic
1082959464 11:58905284-58905306 GCTGCACCCGCGTCTGCGTGAGG - Intergenic
1091520013 12:1229359-1229381 GTTGCAGCGGTGCATGCCTGTGG + Intronic
1098302349 12:69067151-69067173 GGTGCAGCCCTGCCAGCATGTGG + Intergenic
1102418455 12:112784930-112784952 GATACAGCTGTGGCTGGGTGTGG + Intronic
1103321141 12:120093496-120093518 GAGGCAGCAGTGCCTGGGGGTGG - Exonic
1104606399 12:130192764-130192786 CATGCAGCTGGGCCTGGGTGGGG + Intergenic
1105279426 13:18954549-18954571 GAAGCAGACATGCCTGGGTGGGG - Intergenic
1105964613 13:25372676-25372698 GATGCAGCCTTCCCTGCCGGCGG + Intronic
1106416058 13:29546879-29546901 AATGCAGCAGTGCATGTGTGTGG - Intronic
1106815899 13:33406841-33406863 GATGCACCCGTGCCTGGCTGAGG - Intergenic
1118837588 14:69487611-69487633 CAAGCAGCCCTGCCTGCCTGGGG + Intronic
1121642418 14:95494657-95494679 GATGCTGCCCTGACTGCTTGTGG - Intergenic
1122707053 14:103628426-103628448 GATGCGCCGGTGGCTGCGTGGGG + Intronic
1122844130 14:104481509-104481531 GATGCAGCACTGGCTGCGGGGGG - Intronic
1122987812 14:105220656-105220678 GATGCTGCCTGGACTGCGTGGGG - Intronic
1130520148 15:84655730-84655752 GAAGCAGCAGTGCCTACGTCTGG - Intronic
1131204667 15:90433034-90433056 GATCTAGCCCTGCCTTCGTGTGG + Intronic
1134149023 16:11791184-11791206 GATGAAGCCTTGCCTCCGTACGG + Intronic
1136685404 16:31991247-31991269 GATACAGACGTGCCTGCGTGGGG + Intergenic
1136786018 16:32934777-32934799 GATACACACGTGCCTGCGTGGGG + Intergenic
1136883757 16:33919026-33919048 GATACACACGTGCCTGCGTGGGG - Intergenic
1139483089 16:67241413-67241435 GATGCGGCTGTGCCTGAATGGGG - Intronic
1139923403 16:70473172-70473194 GCTGCAGCCGTGCCTGGATCGGG + Exonic
1141983044 16:87561683-87561705 GAGCCAGCCGGGGCTGCGTGTGG + Intergenic
1142367957 16:89660199-89660221 GATGCAGTCCTGCCTGCGTGTGG - Intronic
1203088251 16_KI270728v1_random:1196435-1196457 GATACACACGTGCCTGCGTGGGG + Intergenic
1144335980 17:14269295-14269317 GATGCAGCCCTGCCTGTGGGTGG - Intergenic
1144715995 17:17436317-17436339 GATGCAGCCGGGGCTGCTTGTGG + Intergenic
1147146349 17:38486922-38486944 GATACACACGTGCCTGCGTGGGG + Intronic
1147376711 17:40026959-40026981 GATGCAGACCTGCATGCCTGAGG - Exonic
1148157366 17:45431809-45431831 AAAGCAGCCGTGTCTGGGTGGGG + Intronic
1148243208 17:46013301-46013323 TATGCAGCCATGGCTGTGTGGGG - Intronic
1151699151 17:75733532-75733554 CATTCAGCCCTGCCTGCGGGAGG + Exonic
1152040216 17:77898159-77898181 GAGGCAGCCGGGCCTGTGTCAGG - Intergenic
1160413506 18:78690288-78690310 GATGGAGCCTTCCCTGCCTGAGG - Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1162471920 19:10877242-10877264 GTTTCAGCGGTGCCTGCGTGTGG + Intronic
1163361805 19:16851549-16851571 CATGCAGCCATGCCTGCACGCGG + Intronic
1164682945 19:30148009-30148031 GATGCAGCTGTCCCTGGGTGTGG + Intergenic
1164683565 19:30151920-30151942 GATGCAGCTGTCCCTGAGTGTGG + Intergenic
1166699607 19:44874589-44874611 GATGCAGACCTGCCTGGCTGAGG + Intronic
1166941845 19:46371813-46371835 AAGGGAGCCGTGCCTGCCTGAGG - Intronic
1168666785 19:58210362-58210384 GATACAGATGTGCCTGCCTGTGG - Intronic
925364642 2:3303508-3303530 GATTCAGACGTGGCAGCGTGAGG - Intronic
925893745 2:8456314-8456336 GCTGCAGACAGGCCTGCGTGCGG - Intergenic
926692391 2:15746386-15746408 GATGCAGCCCTGCCTGAGGCAGG + Intergenic
927733231 2:25494557-25494579 GCTGCACCCCTGCCTTCGTGAGG - Intronic
935393674 2:102581925-102581947 TATGCTGCAGTGCCTGGGTGGGG + Intergenic
935417616 2:102835377-102835399 GAGGAGGCTGTGCCTGCGTGTGG - Intronic
937338862 2:121078178-121078200 GAGGCTGCCGTGCCTTTGTGGGG + Intergenic
940238016 2:151531454-151531476 GATGCAGTGGTGCATGCCTGTGG - Intronic
943700449 2:190983576-190983598 GATGCAGCAGTGAGAGCGTGGGG + Intronic
948826998 2:240577679-240577701 GGTGCAGCCGGCCCTGCGTCTGG - Exonic
948920205 2:241062807-241062829 GTCTCAGCCGTGCCTGCATGGGG + Exonic
948937761 2:241178779-241178801 GATGTGGCCGTGCCTGTGTCTGG + Intronic
1172927142 20:38548190-38548212 GATGGAACAGTGCCTGCCTGTGG + Intronic
1173530765 20:43767603-43767625 TATGCAGGTGTGCCTGCATGAGG + Intergenic
1175712067 20:61229265-61229287 GGTGCAGCCGCGCCTGCAGGGGG - Intergenic
1176040933 20:63065470-63065492 GATGCAGCACTTCCTGCGGGGGG - Intergenic
1176088140 20:63307307-63307329 TGTGCAGCCGTGCCGGTGTGGGG + Intronic
1176131416 20:63498309-63498331 GATGGCGCCGTCCCTGCCTGAGG - Intronic
1177989380 21:28019357-28019379 GTTGCAGCTGTGCCTGGGAGTGG + Intergenic
1181943354 22:26496229-26496251 GCTCCAGCCGTGCCTGCATAAGG + Exonic
1183291289 22:37003425-37003447 GATGCAGGCGTGACTGAGTCAGG - Intronic
1185299349 22:50071552-50071574 GCTGCAGTCGGGCCTCCGTGTGG + Intronic
1185322723 22:50209319-50209341 GCTGCAGCCAGGGCTGCGTGGGG + Intronic
1185327485 22:50234161-50234183 GATGCTGCCGTGGATGGGTGTGG - Intronic
963123236 3:141793760-141793782 TATGCAGCCATGCCTGGCTGGGG - Intronic
971270502 4:25139938-25139960 TATCCAGCCATGCCTGCTTGTGG - Intronic
974373919 4:61051760-61051782 GAAGCAGCTGTGCTTGGGTGAGG - Intergenic
975179924 4:71333222-71333244 GCTGCAGCCATGTCTGCGTTAGG + Intronic
978663528 4:111155062-111155084 GCTGCAGCTGTGCCTGGGAGGGG + Intergenic
987360297 5:17100159-17100181 GATACAGCCGTGACTGAGCGTGG - Intronic
987750982 5:22038424-22038446 GATGCAGCAGTGGCTGGGAGGGG - Intronic
995031893 5:107490544-107490566 GATGCAGGCCTGCCAGCGAGGGG + Intronic
999004667 5:147962485-147962507 GATGGAGCTGGGCCTGCGCGTGG + Intergenic
1002001152 5:176196911-176196933 GAGACAGCCCTGCCTGGGTGTGG + Intergenic
1002253183 5:177942061-177942083 GAGACAGCCCTGCCTGGGTGTGG - Intergenic
1002649366 5:180680345-180680367 GAGACAGCCCTGCCTGGGTGTGG - Intergenic
1003173644 6:3738957-3738979 GATGCAAACGTGCCTGTGAGCGG + Intronic
1005854521 6:29850604-29850626 GCTGCTGCAGTGCCTGTGTGTGG + Intergenic
1019406709 7:887772-887794 GAGGCAGCCGTGCCTTCACGGGG + Intronic
1019929911 7:4216418-4216440 GAGACAACTGTGCCTGCGTGGGG + Intronic
1020934641 7:14447125-14447147 GATGCATCCGTGCATACCTGGGG - Intronic
1024565234 7:50674980-50675002 TATGCAGCTGTGGCTGTGTGCGG - Intronic
1029283921 7:99453380-99453402 GGTGCAGCCGTGCCAACCTGGGG + Intronic
1034536067 7:151726648-151726670 GATGCAGCCGTGCCTGCGTGCGG - Intronic
1038780527 8:30565554-30565576 GAGGCAGCCGTGCCTGCAGGGGG + Intronic
1039992124 8:42497410-42497432 GATTCAGCAGGGCCTGGGTGGGG + Intronic
1046229597 8:111335649-111335671 GATGCAGACAAGCATGCGTGTGG + Intergenic
1047699103 8:127432558-127432580 AAGGCAGGCGTCCCTGCGTGTGG - Intergenic
1048878607 8:138855790-138855812 GAAGCAGCTCTGCCTGGGTGTGG - Intronic
1056460064 9:86800765-86800787 GCTGCAGCTATGCCTGGGTGAGG - Intergenic
1056950507 9:91037269-91037291 GATGCAGCCGTTGCAGCGGGAGG - Intergenic
1061609422 9:131736522-131736544 CATGCAGCAGTGCCTGGCTGGGG - Intronic
1061850391 9:133411513-133411535 GAGGCAGCCTTGCCTGCTTCTGG + Intronic
1062422661 9:136490856-136490878 GAGGCAGCCCTGCCTGCCGGGGG + Intergenic
1194965501 X:100284277-100284299 GATGCAGCAGGGCCTGGGGGAGG + Intergenic
1200181972 X:154156140-154156162 GAGGCAGCCATGTCTGCCTGGGG + Intronic
1200187621 X:154193254-154193276 GAGGCAGCCATGTCTGCCTGGGG + Intergenic
1200193270 X:154230394-154230416 GAGGCAGCCATGTCTGCCTGGGG + Intronic
1200199025 X:154268198-154268220 GAGGCAGCCATGTCTGCCTGGGG + Intronic