ID: 1034539276

View in Genome Browser
Species Human (GRCh38)
Location 7:151745816-151745838
Sequence CCCCCATGGAGGGCTCGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034539262_1034539276 15 Left 1034539262 7:151745778-151745800 CCCTGGATCTCCTTAAAATCTGG 0: 1
1: 0
2: 0
3: 9
4: 156
Right 1034539276 7:151745816-151745838 CCCCCATGGAGGGCTCGGTGGGG 0: 1
1: 0
2: 2
3: 13
4: 162
1034539264_1034539276 14 Left 1034539264 7:151745779-151745801 CCTGGATCTCCTTAAAATCTGGA 0: 1
1: 0
2: 1
3: 14
4: 180
Right 1034539276 7:151745816-151745838 CCCCCATGGAGGGCTCGGTGGGG 0: 1
1: 0
2: 2
3: 13
4: 162
1034539268_1034539276 5 Left 1034539268 7:151745788-151745810 CCTTAAAATCTGGAAGGGGCATC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1034539276 7:151745816-151745838 CCCCCATGGAGGGCTCGGTGGGG 0: 1
1: 0
2: 2
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034539276 Original CRISPR CCCCCATGGAGGGCTCGGTG GGG Intronic
900203532 1:1421578-1421600 GCCCCATGGAGAGCCCTGTGAGG - Intronic
900374754 1:2348418-2348440 CCCCCATGGAGGGCAGAGGGAGG - Intronic
900422399 1:2561214-2561236 GCCCCAGGGAGGGGGCGGTGGGG + Intronic
903285134 1:22272486-22272508 TTCTCATGGAGGGCTCAGTGTGG - Intergenic
905395011 1:37661283-37661305 CACCCATGGAGGGAGAGGTGAGG - Intergenic
905684776 1:39900909-39900931 CCCTCTTGGATGGCTCGGGGAGG + Intronic
906459655 1:46027631-46027653 CCCCCATGGAAGCCTGAGTGGGG + Intronic
906517346 1:46447609-46447631 CCACCATGGAGGGTTTGGTTGGG + Intergenic
906872874 1:49503407-49503429 GCCCCATTGAGGACTCTGTGTGG - Intronic
910370775 1:86513107-86513129 GCCATATGGAGGGCTCAGTGTGG - Intergenic
912661818 1:111538502-111538524 CCCCCATGAAGGGCCAGATGTGG - Intronic
917965951 1:180178650-180178672 CTCCCTTGGAGGGCCCTGTGTGG + Intronic
919418746 1:197344441-197344463 TCTCCATGGAGGGCTGTGTGTGG + Exonic
920710453 1:208289576-208289598 CCTCCATGCAGTGCTCGGTCTGG + Intergenic
922855698 1:228773437-228773459 CCCACATGGAGCCATCGGTGGGG - Intergenic
1063415569 10:5870242-5870264 CCTCCGTGAAGGGGTCGGTGAGG - Intronic
1063575923 10:7261971-7261993 CCCCCAGGGAGGGCACACTGAGG - Intronic
1067069835 10:43123608-43123630 GCCCCCCGGAGGGCTCTGTGAGG + Intronic
1069392439 10:67950564-67950586 CTCCCCTGTAGGGCTGGGTGTGG - Intronic
1069631261 10:69898266-69898288 CCCCCAAGCAGGGATGGGTGGGG + Intronic
1070626422 10:78054239-78054261 CCCAGGTGGAGGGCTCTGTGGGG + Intronic
1071562515 10:86655233-86655255 CCTCCCTGGAGGGCTCCATGGGG - Intronic
1073192660 10:101662798-101662820 CCCCCATGGGTGGCTTGGAGGGG + Intronic
1075661903 10:124203210-124203232 GCCCCATGGAGAGCACTGTGTGG + Intergenic
1077009523 11:373972-373994 CCCTCCTGGGGGGCTCGGTGAGG + Intronic
1078533734 11:12156712-12156734 TGCCCATGGTGGGCTCTGTGGGG + Intronic
1083252789 11:61478981-61479003 TTCCCATGGGGGGCTGGGTGAGG + Intronic
1083729332 11:64644399-64644421 CCCCCATGGAGGGAGAGGTTGGG - Intronic
1083945670 11:65921271-65921293 CCCCTGTGGAGGGCACGGTGGGG + Intronic
1084369391 11:68729551-68729573 CCCTCATGGATGGCTTTGTGGGG + Intronic
1084473378 11:69375807-69375829 CCCCCAGGGAGGAGTGGGTGTGG + Intergenic
1084497444 11:69513275-69513297 ACCCCATGGAGGGGAGGGTGTGG - Intergenic
1085317718 11:75555455-75555477 CTCCCATGGTGGCCTCTGTGGGG + Intergenic
1086180742 11:83948435-83948457 CTTCCATGGAGTGCTGGGTGGGG - Intronic
1086732107 11:90263347-90263369 CCCTCATGAATGGCTTGGTGTGG + Intergenic
1090073863 11:123566894-123566916 CCCCCATGGAGTGCTCAGCCTGG + Intronic
1091553426 12:1554063-1554085 CCCTCATGAAGGGCTCGGCCTGG + Intronic
1096236799 12:49933994-49934016 CCCTCATGAATGGCTTGGTGCGG - Intergenic
1097050624 12:56221264-56221286 CCTTCATGGAGGGCTGGGAGGGG + Intronic
1100032406 12:90209262-90209284 ACCCCATTGAGGACTCTGTGTGG - Intergenic
1102026059 12:109714784-109714806 CCCCCAAGGAGGGCTTCGTCAGG + Exonic
1102340607 12:112118676-112118698 CATCCATGCAGGGCTGGGTGCGG + Intergenic
1103534798 12:121626942-121626964 CCTGCATGGAGTGCTCGTTGAGG - Exonic
1103844929 12:123894684-123894706 ACCGCATGGAGGGCTTGGGGAGG - Exonic
1106181203 13:27371370-27371392 TCCCCATGGATGGCTTGGTCTGG - Intergenic
1113539193 13:111093407-111093429 CCCCCATGGAGGGAGAGGAGGGG + Intergenic
1115519543 14:34219656-34219678 CCCCCAGTGAAGGCTCAGTGAGG + Intronic
1116098876 14:40408270-40408292 GCCCCAGTGAGGGCTCTGTGTGG + Intergenic
1116770601 14:49123060-49123082 CCCTCATGAATGGCTTGGTGTGG - Intergenic
1122324603 14:100874892-100874914 TCCCTTTGGAGGGCTCTGTGTGG - Intergenic
1122784586 14:104157879-104157901 CCCCCACCCCGGGCTCGGTGGGG + Exonic
1122967752 14:105139174-105139196 CCCCCAGAGAGGGCGCTGTGTGG - Intergenic
1123018756 14:105387768-105387790 CTGCCATGGCTGGCTCGGTGGGG + Intronic
1202853967 14_GL000225v1_random:38154-38176 CCACCATGGAGGGCCTGGCGGGG + Intergenic
1123858340 15:24436382-24436404 CCCACATGGAGGGAGCGGAGGGG - Intergenic
1132748139 16:1445477-1445499 CCTCCGTGGGGGGCTGGGTGCGG - Exonic
1132951861 16:2567332-2567354 CCTCCATAGAGGGCTCTGTGGGG + Intronic
1132954739 16:2585636-2585658 ACCCCGTGGAGGGGTCGGCGTGG + Intronic
1132962489 16:2632838-2632860 CCTCCATAGAGGGCTCTGTGGGG - Intergenic
1133242861 16:4425967-4425989 CGCCCAGGGAGGGCGTGGTGGGG + Exonic
1133819935 16:9227120-9227142 CCACCATGGAGAGCTCCATGGGG - Intergenic
1134123209 16:11599108-11599130 CCCCCATAAAAGGCTTGGTGCGG - Intronic
1135958040 16:26972620-26972642 GTCCCATGGAGGTCTCGGTGGGG - Intergenic
1136546052 16:30955457-30955479 CACTCAGGGAGGGCTGGGTGTGG - Intronic
1138598325 16:58041206-58041228 GCCCCGAGGAGGGCTCGGTGTGG - Intronic
1139956565 16:70696071-70696093 CCTCAGTGGAGGGCTAGGTGTGG - Intronic
1140035348 16:71367527-71367549 CCACAATCGAGGGCTGGGTGTGG + Intronic
1141827401 16:86490436-86490458 TCCTCATGGAGGGCTAGGTTGGG + Intergenic
1142766145 17:2065338-2065360 CCACCATGGAGGCCCAGGTGGGG - Intronic
1146652187 17:34613722-34613744 TACCCATGGAGGGCTGGGGGAGG - Intronic
1146904910 17:36612118-36612140 CCACCATGGAGGAGTCTGTGGGG - Intergenic
1148324869 17:46777353-46777375 GCCCCTTGGAGAGCTGGGTGAGG - Intronic
1150389831 17:64783841-64783863 CCCCCAGGGAGGGGTGGGGGTGG + Intergenic
1151450871 17:74197551-74197573 CCCCCATGGAGGAGATGGTGCGG + Intergenic
1151757359 17:76082455-76082477 CTCCTCTGGAGGGCTCTGTGGGG - Exonic
1152293773 17:79455047-79455069 ACCCCATGGAGGGGTTGCTGTGG - Intronic
1152404369 17:80088000-80088022 CCCCCATGCAGGCCTCTGAGAGG + Exonic
1152535968 17:80950557-80950579 CCCCCACGGAGTGCGGGGTGTGG - Intronic
1157310911 18:46552577-46552599 CCCCAAGGGAGAGCTCTGTGTGG - Intronic
1158964295 18:62609967-62609989 CCCCCATGGAGGGCTCCTTGAGG + Intergenic
1160533920 18:79581106-79581128 CCACCGTGGAGGGCTTGGCGTGG + Intergenic
1160904860 19:1447237-1447259 CCCCCATCGGGAGCTGGGTGGGG - Intronic
1162352563 19:10159497-10159519 CCACCGTGGAGGGCTGGGCGCGG - Intronic
1163152848 19:15425125-15425147 CCCCCATGGCTGGGTCTGTGTGG - Intronic
1164676486 19:30104887-30104909 CCACCATGTAGAGCTCTGTGGGG - Intergenic
1165107917 19:33485169-33485191 GACCCATGGAGTTCTCGGTGAGG - Intronic
1165593484 19:36991026-36991048 TCAACATGGAGGGGTCGGTGTGG - Intronic
1166251271 19:41572671-41572693 ACCCCAGGCAGGGCTCAGTGGGG - Intronic
1166412416 19:42564875-42564897 CCCCTGTGGTGGCCTCGGTGTGG - Intergenic
1166750918 19:45163642-45163664 CCCCCATCGAAGGATCAGTGAGG + Intronic
1167593371 19:50415948-50415970 CCCCCATGGCAGCCTGGGTGTGG + Intronic
927848472 2:26484403-26484425 CCCCCAGGGAGCCCCCGGTGAGG - Intronic
927870353 2:26619234-26619256 CCCCCGGGGAGGGCCCTGTGGGG - Intronic
927895742 2:26780640-26780662 CTCCCATGCAGGTCTCTGTGGGG + Exonic
931551797 2:63454335-63454357 CCCCCAAACAGGGCTCAGTGTGG - Intronic
931744204 2:65277865-65277887 CACCCATTGATGGCTCTGTGTGG + Intergenic
932112176 2:69011818-69011840 GCCCCAAGGAGGGGTCCGTGTGG - Intergenic
932120531 2:69095608-69095630 CCACCATGGAGGGGTTGGGGAGG + Intronic
934067106 2:88350574-88350596 CCCACTTGGAGGTCTGGGTGGGG + Intergenic
935057045 2:99576896-99576918 CCCCCAGGGAGGGCATGGAGTGG - Intronic
938949587 2:136244251-136244273 CCCCCAGGGAGGGCCGGGGGTGG + Intergenic
941791441 2:169556531-169556553 CCAGCCTGGAGGGCTGGGTGCGG + Intronic
943936112 2:193918993-193919015 GTCCCATTGAGGGCTCTGTGTGG - Intergenic
945027132 2:205630125-205630147 CCCCCATGGAGAACTGGGGGAGG - Intergenic
949035040 2:241812346-241812368 CCCCCAAGGAGGGCCCTGTCAGG + Intronic
1171498040 20:25571102-25571124 CCCCGATGGCTGGCTGGGTGAGG + Intronic
1172092782 20:32445870-32445892 CCCCCAAGGAGGGATGGGGGGGG - Exonic
1176179333 20:63742073-63742095 CCCCCAGGGAGGGGCGGGTGTGG + Intronic
1176350864 21:5795399-5795421 CCCTGATGGAGGGGTGGGTGAGG - Intergenic
1176357678 21:5915983-5916005 CCCTGATGGAGGGGTGGGTGAGG - Intergenic
1176545185 21:8193469-8193491 CCCTGATGGAGGGGTGGGTGAGG - Intergenic
1176564136 21:8376514-8376536 CCCTGATGGAGGGGTGGGTGAGG - Intergenic
1178769363 21:35488508-35488530 CCCACATGGAGGCCTCGCTTGGG - Intronic
1181023250 22:20114167-20114189 ACCTCCTGGAGGGCTAGGTGTGG - Intronic
1181335321 22:22124546-22124568 GCCCCAGGGAGGGTTGGGTGTGG + Intergenic
1181345704 22:22219297-22219319 CTCTCATGGAGGGCTCAGTAGGG + Intergenic
1181500645 22:23313810-23313832 CCCCCATTGAGGACCCTGTGAGG - Intronic
1182071415 22:27466379-27466401 CCTCCATGGAGGACTCTTTGGGG + Intergenic
1184161240 22:42698539-42698561 CCTGGATGGAGGGCTCAGTGCGG - Intronic
1184549939 22:45199182-45199204 CCCCCAGGGAGGCCTCTGAGGGG - Intronic
1184970736 22:48018103-48018125 TCCTCATGGAGGACTCAGTGTGG + Intergenic
1203250055 22_KI270733v1_random:109707-109729 CCCTGATGGAGGGGTGGGTGAGG - Intergenic
953761910 3:45695058-45695080 CAACCAGGGAGGGCTCAGTGAGG + Intronic
954145609 3:48632909-48632931 CCATCATGGAGGGCAGGGTGAGG - Intronic
964720500 3:159764301-159764323 CCCCCAAGGAGGCCTGGGGGCGG - Intronic
965005482 3:163017578-163017600 CCCCCATGGAGGCCTTTGAGAGG + Intergenic
966853938 3:184181260-184181282 GTCCCTTGGAGGGCTCAGTGGGG + Intronic
968025914 3:195442612-195442634 CCCCTCGGGAGGGCTCGGTGGGG + Intronic
969440270 4:7212849-7212871 AGCCCATGGAGGGCAGGGTGAGG + Intronic
972696497 4:41451565-41451587 CCCCCATGGAGTGCTGGTTCAGG + Intronic
975038118 4:69710024-69710046 CCCCCAAGTAGGGCTCTGTGTGG + Intergenic
977555813 4:98486512-98486534 CCTCCATGGATGGCATGGTGGGG + Intronic
980958813 4:139454375-139454397 CCCCTATCGTGGCCTCGGTGCGG - Exonic
986404955 5:7416355-7416377 GCCCCTTGGAGGGCTGGGCGCGG + Intronic
987299328 5:16582982-16583004 CCCACATGGAGCTCTAGGTGCGG + Intronic
998779588 5:145641653-145641675 CCCCCCTGGGGGGCTTGGGGAGG - Intronic
1003561571 6:7185021-7185043 CCCCCATGGGGGCATGGGTGTGG - Intronic
1006899553 6:37491088-37491110 CCCCCAGTGAGGCCTCCGTGGGG - Intronic
1006922511 6:37636103-37636125 CTCCCATGGATGGCTAGGTGGGG + Exonic
1007093058 6:39196461-39196483 CCTCCATGGAGGGCTGGGTGAGG - Intronic
1007401000 6:41602274-41602296 CCTCCACGGAGGGCTGGGAGGGG - Exonic
1007956608 6:45923620-45923642 CCCACATGGATTGCTGGGTGAGG + Intronic
1008471426 6:51889351-51889373 CCTCTATGCAGGGCTCAGTGGGG + Intronic
1012755781 6:103228266-103228288 GCCCCATGGAGGACTCTATGTGG - Intergenic
1017709346 6:157152765-157152787 CCCCCATTGATGGCTCTGTTAGG + Intronic
1018812231 6:167306608-167306630 GCCCCAGGCAGGGCTGGGTGTGG + Intronic
1018928611 6:168224321-168224343 CCCCCAGGGAGTGCTTGGAGTGG + Intergenic
1022045769 7:26621061-26621083 TCCCCGTGCAGGGCTCTGTGGGG + Intergenic
1026665442 7:72336777-72336799 CCCGCAGGGAGGGGGCGGTGCGG + Intronic
1030212547 7:107010717-107010739 GCCTCATGGTGGACTCGGTGTGG - Intergenic
1033560848 7:142528940-142528962 GCCCCCTGGAGGGCTGAGTGGGG + Intergenic
1034539276 7:151745816-151745838 CCCCCATGGAGGGCTCGGTGGGG + Intronic
1035741001 8:1928691-1928713 TGCCCATGGAGGGCGTGGTGGGG + Intronic
1036203123 8:6785634-6785656 CACACAGGGAGGGCTTGGTGTGG - Intergenic
1037840866 8:22244710-22244732 CCCGCAGACAGGGCTCGGTGTGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1039808498 8:41023978-41024000 CCCTCATGAATGGCTTGGTGGGG + Intergenic
1040549974 8:48430169-48430191 GCCCCAGGGAGGGGTCTGTGGGG + Intergenic
1045571278 8:103371433-103371455 CCCCCACGCCGGGCTCGGGGTGG + Intergenic
1049318794 8:141984589-141984611 GGCCTATGGAGGGTTCGGTGTGG - Intergenic
1049360790 8:142211736-142211758 CGCCCATCAAGGGCTCAGTGTGG + Intergenic
1049383166 8:142327547-142327569 GCCCGATGGAGGGCTCTGTGAGG - Intronic
1052187755 9:25619938-25619960 GCCCCATTGAGGACTCTGTGTGG + Intergenic
1052195797 9:25713470-25713492 ACCCCATGGAGGGCCGGGCGCGG + Intergenic
1053484632 9:38442559-38442581 CCCCCTTCCAGGGCTCTGTGTGG - Intergenic
1055872864 9:80905203-80905225 CCCACATGGAAGGCTAGATGGGG - Intergenic
1057115068 9:92513202-92513224 CCACCAGGGAGGGCTCTGAGTGG - Intronic
1060152832 9:121299743-121299765 CCCCCAGGGAGGGCGCGGGGCGG - Intronic
1061522644 9:131129359-131129381 CCACCATGGAGGGGACAGTGGGG - Exonic
1062037188 9:134387660-134387682 CGCTCATGGACGGCTCTGTGAGG - Intronic
1062426391 9:136508095-136508117 CCAGCATGGAGGGCTCTGTGTGG - Exonic
1062721841 9:138048625-138048647 TCCCCATGGAAGGCTCAGTGTGG - Intronic
1203466455 Un_GL000220v1:92974-92996 CCCTGATGGAGGGGTGGGTGAGG - Intergenic
1190311114 X:49117598-49117620 TTCCCATAGAGGCCTCGGTGAGG + Exonic
1198051626 X:132957440-132957462 CCGCCGTGGAGTACTCGGTGCGG - Intronic
1199585567 X:149412704-149412726 GCCCCATTGAGGACTCTGTGTGG - Intergenic
1199986895 X:152959220-152959242 CTACCCTGGAGGGCTCGGTAGGG - Intronic
1202581109 Y:26381532-26381554 TCCACATGGAAGGCTGGGTGAGG - Intergenic