ID: 1034540520

View in Genome Browser
Species Human (GRCh38)
Location 7:151755201-151755223
Sequence CTGTGGGTGTGACAGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 409}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034540520_1034540526 11 Left 1034540520 7:151755201-151755223 CCATCTGTCTGTCACACCCACAG 0: 1
1: 0
2: 5
3: 34
4: 409
Right 1034540526 7:151755235-151755257 TTCCTCATTCTTGAAGGAATCGG No data
1034540520_1034540530 20 Left 1034540520 7:151755201-151755223 CCATCTGTCTGTCACACCCACAG 0: 1
1: 0
2: 5
3: 34
4: 409
Right 1034540530 7:151755244-151755266 CTTGAAGGAATCGGGAATCTGGG 0: 1
1: 0
2: 1
3: 6
4: 83
1034540520_1034540525 5 Left 1034540520 7:151755201-151755223 CCATCTGTCTGTCACACCCACAG 0: 1
1: 0
2: 5
3: 34
4: 409
Right 1034540525 7:151755229-151755251 AGTGAGTTCCTCATTCTTGAAGG No data
1034540520_1034540531 23 Left 1034540520 7:151755201-151755223 CCATCTGTCTGTCACACCCACAG 0: 1
1: 0
2: 5
3: 34
4: 409
Right 1034540531 7:151755247-151755269 GAAGGAATCGGGAATCTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 135
1034540520_1034540532 28 Left 1034540520 7:151755201-151755223 CCATCTGTCTGTCACACCCACAG 0: 1
1: 0
2: 5
3: 34
4: 409
Right 1034540532 7:151755252-151755274 AATCGGGAATCTGGGAGGCACGG No data
1034540520_1034540527 12 Left 1034540520 7:151755201-151755223 CCATCTGTCTGTCACACCCACAG 0: 1
1: 0
2: 5
3: 34
4: 409
Right 1034540527 7:151755236-151755258 TCCTCATTCTTGAAGGAATCGGG 0: 1
1: 0
2: 1
3: 38
4: 176
1034540520_1034540529 19 Left 1034540520 7:151755201-151755223 CCATCTGTCTGTCACACCCACAG 0: 1
1: 0
2: 5
3: 34
4: 409
Right 1034540529 7:151755243-151755265 TCTTGAAGGAATCGGGAATCTGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034540520 Original CRISPR CTGTGGGTGTGACAGACAGA TGG (reversed) Intronic
900605614 1:3522363-3522385 CTGAGGGGGTGACAGCCAGAGGG + Intronic
901842836 1:11964621-11964643 CTGTGGGAGAGACAGAAAGCGGG - Intronic
902542245 1:17163580-17163602 GTGCGGGGGTGACAGACAGCAGG - Intergenic
903151020 1:21408812-21408834 GTGTGTGTGTGAAAGAGAGAGGG - Intergenic
903577099 1:24345721-24345743 CTAAGGCTGTGACTGACAGAGGG - Intronic
903620192 1:24692590-24692612 TTGTGTGTGTGATAGAGAGAAGG + Intergenic
903931007 1:26862610-26862632 CTGTGTGTGTCACAGAGACATGG + Intergenic
905585958 1:39118548-39118570 CTGTGGGAGAGAAAGATAGATGG + Intronic
906707860 1:47907915-47907937 CTGTGGGTGGAACAAAGAGAGGG + Intronic
906986982 1:50693807-50693829 ATGTGGGTGTGTGAGAGAGAGGG - Intronic
907674718 1:56507850-56507872 ATGTGTGTGTGAGAGAGAGAGGG + Intronic
908805216 1:67923369-67923391 ATGTGGGTGTGACAGACTTAGGG + Intergenic
910511453 1:88011042-88011064 GTGTGTGTGTGAGAGAGAGAGGG - Intergenic
910913397 1:92261818-92261840 CTGACGGAGTGATAGACAGAGGG + Intronic
911204719 1:95080616-95080638 CTGTGGGAGTGAGAAACAAAAGG + Intergenic
912390900 1:109302160-109302182 GTGTGTGTGTGAGAGAGAGAGGG + Intronic
912745130 1:112239697-112239719 CTGTGGGAGTGACATGCAGTGGG + Intergenic
912801684 1:112723390-112723412 CTGTGTGTGCAACAGGCAGAGGG - Intronic
912875742 1:113357602-113357624 GTGTGTGTGAGAGAGACAGAGGG - Intergenic
914695725 1:150077646-150077668 CTGTGGGTGAGAGAGAAAGATGG - Intronic
914802776 1:150973360-150973382 CGGTGGGTTTGAGAGACAGCTGG + Intronic
915457501 1:156050662-156050684 CTGTGGGAATGACAGGAAGAGGG - Intronic
915490296 1:156246840-156246862 CTGTGCGTGTGGGAGGCAGATGG + Intronic
916046005 1:161000349-161000371 CTGTGGAAGAGAAAGACAGAAGG + Intronic
917320954 1:173780985-173781007 CTGTGAGTGAGAGAGAGAGAGGG + Intronic
919896264 1:202011451-202011473 GTGGGGCTGTGACAGGCAGAGGG + Intronic
920207278 1:204301608-204301630 CTGTGGGGGAAACAGAGAGAAGG + Intronic
921812377 1:219529574-219529596 TTGTGGGTGTTTTAGACAGAAGG - Intergenic
921933042 1:220770837-220770859 ATGTGGGTGGAACACACAGACGG + Intronic
922782616 1:228264697-228264719 CTGTGCATGTGACAGACACCCGG - Intronic
923022353 1:230174848-230174870 TGGTGGGTGTACCAGACAGATGG - Intronic
923360156 1:233203262-233203284 CTGTGGGTGAGAAAGCCAAAAGG - Intronic
1063053708 10:2480463-2480485 CAGTGGATGTGACAGACATTTGG + Intergenic
1063725507 10:8633125-8633147 CTGAGGCTGTGACACAGAGAAGG + Intergenic
1063959221 10:11292975-11292997 CAGTGTGTAAGACAGACAGAGGG - Intronic
1064315658 10:14253678-14253700 GTGTGGCAGTGACAGGCAGAGGG + Intronic
1064475012 10:15678648-15678670 GTGTGGGAGTGAGAGGCAGAGGG + Intronic
1066220737 10:33335049-33335071 CTCTGGGAAAGACAGACAGACGG - Intronic
1067439636 10:46301367-46301389 CTGAGGCTGTGAGAGACAGCAGG - Intronic
1069065789 10:63940638-63940660 GTGTGGGTGTGACAAACCAAAGG + Intergenic
1071274233 10:84038245-84038267 ATGTGGGTGTGACTCACTGAGGG - Intergenic
1071511570 10:86265557-86265579 CTGTGGGTGTGCCAGCCACGTGG - Intronic
1072336771 10:94404023-94404045 GTGTGGTTGTGAAAGAGAGAAGG + Intronic
1074913654 10:117935636-117935658 CTGTGTGTGTAAGGGACAGAGGG - Intergenic
1075551361 10:123395147-123395169 CTGTGGGAGTAACAGAGACAGGG - Intergenic
1075587039 10:123665851-123665873 TTGGGGGTGGGAGAGACAGACGG + Intergenic
1075813324 10:125244830-125244852 CTGTGGGTGTGGGTGACAGTTGG + Intergenic
1076735272 10:132456170-132456192 CTGTGGGGGTGACAGTCATGGGG + Intergenic
1077047632 11:553420-553442 CTGTGGAGGGGGCAGACAGAGGG + Intronic
1077866066 11:6222898-6222920 CTGTAGGAGTGCCAGAGAGAAGG + Intronic
1078561418 11:12376682-12376704 GTGTGTGAGAGACAGACAGAAGG + Intergenic
1079153777 11:17925242-17925264 TGATGTGTGTGACAGACAGATGG - Intronic
1079153787 11:17925321-17925343 TGATGTGTGTGACAGACAGATGG - Intronic
1081403890 11:42673964-42673986 CTGTGGGGGTGAGAGAGAGAGGG + Intergenic
1081775339 11:45672230-45672252 GTGTGTGTGTAAGAGACAGAGGG + Intergenic
1082026280 11:47574889-47574911 CTGTGTGTGAGAGAGAGAGATGG - Intronic
1082959139 11:58902292-58902314 CTGGGGATGTGTCAGACATAAGG - Intronic
1083057956 11:59841319-59841341 CTGTGTCTGTGAATGACAGAGGG + Exonic
1083177064 11:60957038-60957060 TTGTGGGGGTGAGAGAGAGATGG - Intergenic
1083214735 11:61211272-61211294 TAGTGGGTGTGCCAGGCAGAAGG + Intronic
1083217619 11:61230101-61230123 TAGTGGGTGTGCCAGGCAGAAGG + Intronic
1083694535 11:64433867-64433889 CTATGTGTGGGACAGACCGAGGG + Intergenic
1084675265 11:70630327-70630349 CTGTGAGGGTGGCAGACAGAAGG + Intronic
1085187995 11:74592606-74592628 CTGTGGCTGTGATTGAGAGAGGG + Exonic
1085824155 11:79825571-79825593 CTGTGGGTCTTACAGAAAGAAGG - Intergenic
1088756648 11:112890564-112890586 CTGTGGATGTGGCAGAAAAACGG - Intergenic
1088771989 11:113044342-113044364 GTGTGTGTGTCACACACAGAAGG - Intronic
1089456192 11:118627361-118627383 CTGTGGCTGGCACAGGCAGAGGG - Exonic
1091118165 11:133034331-133034353 GTGTGTGTGTGACAGACAGAGGG + Intronic
1091192197 11:133705452-133705474 CTGTGGGGGCAACAGACAGGCGG - Intergenic
1091753281 12:3035911-3035933 CTGTGGCTGTGACTGGCCGAAGG - Intronic
1092007108 12:5078929-5078951 CTTTGGGTGACACAGAGAGAAGG - Intergenic
1092050161 12:5463545-5463567 CGGTAGGAGGGACAGACAGAAGG + Intronic
1092257541 12:6935822-6935844 CAGTGGGTGTCACAGAAGGATGG - Exonic
1092283495 12:7115107-7115129 CTGTGGGAAAGACAGACACACGG - Intergenic
1093328813 12:17810969-17810991 CTGTCCGTGTGAGAGACTGATGG + Intergenic
1093563112 12:20566557-20566579 TTGTGGGTGAGACAAACAGATGG + Intronic
1094081662 12:26543369-26543391 GTGTGTGTGTGACAGAGACAGGG + Intronic
1095154426 12:38834851-38834873 ATGTTGGTGTGACAGAAAGTTGG - Intronic
1096839885 12:54373741-54373763 CTGTGGGGAGGACAGACAGTGGG + Intronic
1097180574 12:57169373-57169395 CCGTGGGTCTGAAAGACAGATGG - Intronic
1098864058 12:75741958-75741980 GAGTGGATGTGAGAGACAGAGGG - Intergenic
1099839915 12:87952558-87952580 GTGTGTGTGTGAGAGAGAGAGGG - Intergenic
1100898832 12:99215454-99215476 CTGTGGGTTTTCCAGACACACGG - Intronic
1101709901 12:107255567-107255589 CTGAGGGTTAGAGAGACAGATGG - Intergenic
1102321849 12:111942804-111942826 ATGTGTGTGTGAGAGAGAGAAGG + Intronic
1102385791 12:112508518-112508540 AAGTCGGTGTGACAGACACATGG + Exonic
1102673645 12:114641130-114641152 CTGTGTGTGAGACACACAGTGGG + Intergenic
1103237696 12:119387021-119387043 GTGTGTGTGAGAGAGACAGAGGG - Intronic
1103240646 12:119410636-119410658 CTATAGGTGTTTCAGACAGAAGG - Intronic
1103240773 12:119411618-119411640 CTATAGGTGTTTCAGACAGAAGG + Intronic
1104277156 12:127340138-127340160 CTGTTGGAGTGACAGAGTGAGGG + Intergenic
1105980042 13:25510162-25510184 GTGTGTGTGTTACAGACAGACGG - Intronic
1106115918 13:26817402-26817424 CTGGGGGGGTGACATAGAGACGG + Intergenic
1106414362 13:29534059-29534081 CTTTGGGGGTGACAGGGAGATGG - Intronic
1108022934 13:46147022-46147044 CTGTGGCTGTGACAAACTGCCGG + Exonic
1108558713 13:51622000-51622022 GTGTGTGTGTGAGAGAGAGAAGG + Intronic
1108613250 13:52105263-52105285 GTGTGTGTGTGTCAGAGAGAAGG + Intronic
1109196441 13:59382401-59382423 CTGTGGGTGTAACAGTGAAAAGG - Intergenic
1109931245 13:69221617-69221639 ATGTGGGAGTGAGAGACAGCTGG + Intergenic
1111275586 13:85941621-85941643 GTGTGTGTGTGAGAGAGAGAAGG + Intergenic
1111729204 13:92052008-92052030 CTGAGGGTGAGAGACACAGAGGG + Intronic
1112211398 13:97381105-97381127 GTGTGTGTGTGTCAGAGAGAGGG - Intronic
1112490165 13:99855581-99855603 CAGTGTGTGTGGCAGAGAGAGGG + Intronic
1113031120 13:105994651-105994673 CTGAGGGTGTGACAGAGGGTGGG + Intergenic
1113109886 13:106811808-106811830 CTGAGGGAGTTACAGACATAAGG + Intergenic
1113118901 13:106905329-106905351 CCATGGTTGTGACAGTCAGATGG - Intergenic
1113447597 13:110381286-110381308 CGGTGGGTGTGACATAGAGCCGG - Intronic
1114260867 14:21035187-21035209 CTGTGGGTGTGACAGGAGTAAGG - Intronic
1117102933 14:52369102-52369124 ATGTGGATGTGAAAGACTGAGGG + Intergenic
1117253887 14:53959023-53959045 CTGTGAGTGTCACAGACTCATGG - Intergenic
1117845239 14:59904784-59904806 GTGTGTGTGTGAGAGAGAGAGGG - Intergenic
1118326985 14:64787960-64787982 CTGTGGGTGTTCGAGAAAGATGG - Intronic
1118476328 14:66120853-66120875 CTGTGGTTCTGACAGGCATAGGG + Intergenic
1118583892 14:67332654-67332676 CTGAGGTTGGGAGAGACAGAAGG + Intronic
1118811891 14:69281201-69281223 GTCTGGGTGTGACACACAGTAGG - Intronic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119601846 14:75981955-75981977 GTGTGTGTGTGAGAGAGAGAGGG - Intronic
1119734755 14:76974834-76974856 CTGGAGCTGTGACATACAGAGGG - Intergenic
1119894826 14:78211293-78211315 TTGTGGGTGGCACACACAGAAGG + Intergenic
1121949004 14:98152771-98152793 CTGTGTGAGTGACCGACAGCAGG + Intergenic
1121999317 14:98633573-98633595 CTGTGTCAGAGACAGACAGAAGG + Intergenic
1122037419 14:98958812-98958834 CTGTGGTGGTGACAGATCGATGG - Intergenic
1122359389 14:101150610-101150632 CTTGGAGTGTCACAGACAGAAGG - Intergenic
1124552025 15:30690345-30690367 CTGTGTGTGGGGCACACAGAAGG + Intronic
1124679218 15:31715327-31715349 CTGTGTGTGGGGCACACAGAAGG - Intronic
1125148746 15:36506086-36506108 CATTGGGTGTGAAATACAGAGGG - Intergenic
1125817649 15:42600482-42600504 ATGTGTGTGTGAGAGAGAGAGGG + Intronic
1127165463 15:56241709-56241731 GTGTGTGTGTGACAGAAAGCAGG - Intronic
1127281566 15:57497676-57497698 GTGTGGGTGGGCCAGGCAGAGGG + Intronic
1128940275 15:71782272-71782294 CTGAGGGTGTGACCGCAAGAGGG + Exonic
1129228732 15:74184749-74184771 CTGTGAGTGTGAGGGACATAGGG - Intronic
1129708580 15:77808606-77808628 GTGTCTGTGTGCCAGACAGAGGG - Intronic
1129762210 15:78136316-78136338 ATGTGTGTGTGAGAGAGAGAGGG - Intronic
1129768384 15:78184988-78185010 CTATGGGAGAGACAGACAGAGGG + Intronic
1130073007 15:80664900-80664922 GTGTGTGTGTGAGAGAGAGATGG - Intergenic
1130221888 15:82026448-82026470 GTGGGGCTGTGACAGGCAGAAGG - Intergenic
1130971793 15:88739516-88739538 CTGTGGGTCTAACAGGCAGTGGG + Intergenic
1132612863 16:825978-826000 CTGTGGGTTTGAGAGCGAGAGGG + Intergenic
1133788297 16:8989762-8989784 ATCTGGGTGTGGCAGCCAGAGGG - Intergenic
1133933646 16:10252102-10252124 CTGTGGAGGTGGCAGAGAGAAGG - Intergenic
1137997098 16:53229747-53229769 GTGTGTGTATGACAGAGAGAGGG - Intronic
1138190387 16:55009446-55009468 CTGGGGGTGTGGCAGTCACAGGG + Intergenic
1138298562 16:55907929-55907951 CAGTGAGTGGGACAGAAAGAGGG - Intronic
1138433372 16:56983489-56983511 CTGTTGGGGAGACAGACAGAGGG + Intronic
1138930906 16:61654762-61654784 CACTGGGTGAGAAAGACAGATGG + Intronic
1139371830 16:66473790-66473812 CTGTGAGTGTGTCTGACAGGTGG - Intronic
1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG + Intronic
1139688482 16:68622864-68622886 GTGTGTGTGTGAGAGAGAGATGG - Intergenic
1139967326 16:70753036-70753058 GTGTGTGTGTGTCAGACAGATGG + Intronic
1140872972 16:79123650-79123672 CTGTGGGTGAGAAAGAAATAGGG - Intronic
1141186078 16:81788558-81788580 CTGTGGCTGAAACAGACAGTGGG - Intronic
1141643102 16:85352903-85352925 CTGTGTGTGTCAGAAACAGAGGG - Intergenic
1142021429 16:87785319-87785341 CTGAGGGTGTCGCAGCCAGAAGG - Intergenic
1142497530 17:314301-314323 CTGTGGGGTTGAGAGACAGGAGG + Intronic
1143284760 17:5780912-5780934 CTGTGGGTTTGAGAGTCTGAAGG + Intronic
1143393897 17:6576746-6576768 CAGTGGGTCTGAAAGGCAGAAGG - Intergenic
1143837968 17:9707980-9708002 CTGTGTCTGTGATAGACATAAGG + Intronic
1144330040 17:14214726-14214748 CTGTGGGTGGGAGAGCCTGAGGG - Intergenic
1144679155 17:17181388-17181410 CTGTGGGTGTGCCTGAGAAAGGG - Intronic
1144765602 17:17730887-17730909 CTGTGGGTGTCCCAGCCACAGGG + Intronic
1144794455 17:17881615-17881637 CTGTGGGCTTGACAGGCAGATGG - Intronic
1145026451 17:19471321-19471343 CTTTGAGTGTGGCAGACAGCGGG + Intergenic
1146263675 17:31437555-31437577 GTGTGGGGATGACACACAGATGG + Intronic
1147895940 17:43751448-43751470 CTGAGAGTAAGACAGACAGAGGG - Intergenic
1148328143 17:46795869-46795891 GTGTGTGTGTGAGAGAGAGAGGG - Intronic
1148350527 17:46938809-46938831 GTGTGTGTGTGAAAGAGAGAGGG + Intronic
1148492763 17:48033766-48033788 CTGTGGGTGTGCAAGGCTGATGG + Intronic
1148554345 17:48569342-48569364 ATGTGAGTGTGGGAGACAGACGG - Intronic
1148644437 17:49211043-49211065 CTGAGGCTCTGAGAGACAGAAGG - Intronic
1149336522 17:55641670-55641692 CTGTGGGAGGGAAAGAAAGAAGG - Intergenic
1150964996 17:69958225-69958247 CTGTGGGTGAGAAAGAAACATGG + Intergenic
1151164173 17:72189971-72189993 CTGTGGATGTGAGAGTCAGAGGG - Intergenic
1151834012 17:76571787-76571809 CTGTGGGTGCCACAGCCACAGGG - Intronic
1152130145 17:78471693-78471715 GTGTGGCTGTGAAAGCCAGACGG - Intronic
1152255574 17:79237498-79237520 CTGTGGGTGAGACAGGCAGATGG - Intronic
1153544970 18:6195988-6196010 GTGTGGGTGAGACAGGGAGAGGG - Intronic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1155388128 18:25303300-25303322 GTGTGTGTGTGAGAGAGAGACGG + Intronic
1156105850 18:33659525-33659547 CTGAGGAGGTGACAGAGAGACGG - Intronic
1158430962 18:57387048-57387070 ATTTGGGGGTGACAGGCAGAGGG + Intergenic
1159324395 18:66895542-66895564 CTGTGTGTGTGTGAGAGAGAGGG + Intergenic
1159440874 18:68478444-68478466 CTGTGGCTGTTACTGACAGGTGG - Intergenic
1159652246 18:70990846-70990868 CAGTGTTTGTGAAAGACAGATGG + Intergenic
1159726717 18:71969827-71969849 CAGTGGATGTGACATACAGATGG - Intergenic
1160717952 19:584910-584932 CTGAGGGTGCGGCAGAAAGATGG - Intergenic
1160724606 19:612418-612440 GTGTGTGTGTGAGAGAGAGATGG + Intronic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160825373 19:1077834-1077856 CTGTGGGTGTGGGAGCCAGGAGG - Intronic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161387922 19:4006851-4006873 CTGTGGGAGGCCCAGACAGAAGG + Intergenic
1161765080 19:6202961-6202983 CTGTGGGGAGGACAGACTGAGGG + Intergenic
1162953935 19:14088252-14088274 ATGTGTGTGAGACAGACACAAGG + Exonic
1163545985 19:17941842-17941864 CTGAAGGTGTGAGAGTCAGATGG + Intronic
1163847481 19:19645791-19645813 CTGTGGGGATGAGGGACAGATGG + Intronic
1164524069 19:29000630-29000652 CTGAGAGGGTGACACACAGAAGG + Intergenic
1164818226 19:31223392-31223414 GTGTGTGTGTGACAGAGAGAGGG + Intergenic
1164999094 19:32745990-32746012 GTGTGTGTGTGAGAGAGAGAAGG + Intronic
1165299968 19:34962595-34962617 CTGTGGGTCTGACAGACAGCAGG + Intronic
1165746775 19:38234139-38234161 GTGTGTGTGTGAGAGAGAGAAGG - Intergenic
1165857676 19:38889746-38889768 CTGTAGGAGAGACAGCCAGAGGG + Intronic
1165954916 19:39496485-39496507 CTGAGGGAGGCACAGACAGAGGG + Intergenic
1166562319 19:43741260-43741282 CTGAGGGTGAGAGAGAAAGAGGG + Intronic
1166669993 19:44703995-44704017 CTGTGGGGGCAAGAGACAGAGGG - Intronic
1166888577 19:45975724-45975746 CTCTGTGTGTGTCACACAGAGGG - Intergenic
1167062893 19:47161711-47161733 CTGTTGGAGGGACAGCCAGAGGG - Intronic
1168278994 19:55294000-55294022 CTGTGGCTGAGACAGCCAGGTGG - Exonic
1168714385 19:58518506-58518528 GTGTGGGTGTGGCACAGAGAGGG + Intronic
925435938 2:3837641-3837663 ATGTAGGTGTGACAGAAAGGGGG - Intronic
926371876 2:12186789-12186811 CTGTGGCTGTCACAGAAATAGGG + Intergenic
926809797 2:16746111-16746133 TTGTGGCAGTGACTGACAGAGGG + Intergenic
927311320 2:21635024-21635046 ATGTGTGTGTGAGAGAGAGAGGG - Intergenic
927735601 2:25518484-25518506 GTGTGTGTGTGAGAGACAGAGGG - Intronic
928106106 2:28471566-28471588 CTGTGAGGGTGACAGGAAGAGGG + Intronic
929295797 2:40244863-40244885 CTGTGGGTTTAACAAAGAGAAGG + Intronic
929818331 2:45254040-45254062 CTGGGGGTGTGATAGAGAGTGGG + Intergenic
930338867 2:50085282-50085304 ATCAGGGTGTGACACACAGAAGG - Intronic
930738481 2:54803825-54803847 CTGTGTGTGTGAAATACAGCTGG + Intronic
931093464 2:58913091-58913113 TTGTGTGTGTGAGAGAGAGACGG - Intergenic
931787755 2:65635904-65635926 GTGTGTGTGTGAGAGAGAGAGGG + Intergenic
932291232 2:70581736-70581758 CTGTGGATGTCACACAGAGATGG + Intergenic
932305516 2:70699429-70699451 CTGTGGCTGTAACAGAGAAATGG - Intronic
932347677 2:71006279-71006301 GTGTGTGTGTGAGAGAGAGAGGG - Intergenic
933803920 2:85984321-85984343 CTGTGAGTGTGCCAAACACAAGG + Intergenic
935384597 2:102487197-102487219 GTGTGTGTGTCACAGGCAGAGGG + Intronic
936010351 2:108921487-108921509 CTGTGGGTTTGACAAAGACAGGG + Intronic
936037253 2:109122862-109122884 GTGTGGGTGTGAAAGAAACAGGG - Intergenic
936110320 2:109659545-109659567 CTGTGGGTGGGACAGATGGTGGG + Intergenic
936966003 2:118128116-118128138 GTGTGGGAGGGACAGAGAGAAGG - Intergenic
937423359 2:121777036-121777058 GTGTGTGTGTGAGAGAGAGAGGG + Intergenic
937423363 2:121777090-121777112 ATGTGTGTGTGAGAGAGAGAGGG + Intergenic
937708372 2:124948787-124948809 GTGTGTGTGTGAAAGAGAGAGGG + Intergenic
938100278 2:128493468-128493490 CTGGGGGCGTGGCTGACAGAAGG + Intergenic
938160609 2:128981659-128981681 CATTAGGTGAGACAGACAGAAGG - Intergenic
938410476 2:131059615-131059637 CTCAGGATGTGACACACAGAGGG - Intronic
938508766 2:131917175-131917197 GTGTGTGTGTGAGAGAGAGAGGG + Intergenic
938800941 2:134762788-134762810 AGGTGGGCATGACAGACAGAAGG + Intergenic
938935300 2:136122284-136122306 CTGTAGGTGTTGGAGACAGAAGG - Intergenic
941253334 2:163195632-163195654 CTGTGTTTGTGACAGACAGCAGG + Intergenic
942048255 2:172113909-172113931 CTGTGTGTGTGACAGCCTGTGGG + Intergenic
943198566 2:184788963-184788985 CTGTGGGTTTGTCATAGAGATGG + Intronic
943282546 2:185955219-185955241 ATGTAGGTGTGACAGAAAGGGGG + Intergenic
944629038 2:201604159-201604181 GTGTGTGTGTGAAAGAGAGAGGG + Intronic
945045213 2:205775827-205775849 GTGTGTGTGTGAGAGAGAGAGGG + Intronic
946159415 2:217826958-217826980 ATGTGGGTGGGAAAGAAAGAAGG + Intronic
946464870 2:219902931-219902953 GTGTGTGTGTGACAGACAGAGGG + Intergenic
946545873 2:220742464-220742486 GTGTGTGTGTGCCAGACAGTAGG - Intergenic
947757088 2:232574320-232574342 CCCTGAGTGTGAGAGACAGAGGG - Intronic
948613172 2:239182274-239182296 CTGTGCAGGTGACAGCCAGAGGG - Intronic
1169310143 20:4530855-4530877 GTGTGTGTGTGAGAGAGAGAGGG - Intergenic
1169427068 20:5504664-5504686 CTGTGCGTTTGACAGGCAGTTGG - Intergenic
1169557495 20:6766875-6766897 CTGCGTGTGTGGCAGACTGAAGG - Intergenic
1171211927 20:23323902-23323924 GTGTGGATGTGAGTGACAGAGGG + Intergenic
1171727854 20:28642157-28642179 CTCTGGGTGTGCCATAGAGAAGG - Intergenic
1173247573 20:41347218-41347240 TTATGGATGTGAGAGACAGAGGG + Intronic
1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG + Intronic
1173474367 20:43348581-43348603 TTCTGGGTGTGACAGACGAAGGG + Intergenic
1174062080 20:47839898-47839920 CTGTGGATGGGCCAGAAAGAGGG + Intergenic
1174150517 20:48483116-48483138 CTGTGGATGGGCCAGAAAGAGGG + Intergenic
1174207898 20:48854349-48854371 GTGTGTGTGTGTCTGACAGAGGG + Intergenic
1174295028 20:49539720-49539742 CTCTGGGGGCGGCAGACAGAGGG + Exonic
1174471847 20:50767372-50767394 GTGTGTGTGTGAGAGACAGAGGG - Intergenic
1174600981 20:51724624-51724646 CTGTGGGGCTGACATTCAGAAGG - Intronic
1174777598 20:53359717-53359739 CTGTGGCTGGAACAGAAAGATGG + Intronic
1175980564 20:62736518-62736540 CTGTGGGTGGGGCAAAGAGAGGG + Intronic
1176784724 21:13241363-13241385 GTGTGTGTGTGAGAGAGAGATGG - Intergenic
1177942263 21:27425305-27425327 CTGTGTGTGTGGCAGAAAGGGGG + Intergenic
1178664507 21:34534645-34534667 CTTCTGGTGTGACAGACTGAAGG + Intronic
1179422245 21:41245862-41245884 ATTTGTGTGTAACAGACAGATGG + Intronic
1180132641 21:45836168-45836190 CTGTGGGGGATACAAACAGAAGG + Intronic
1180225002 21:46386989-46387011 CTGGGGCGGGGACAGACAGACGG - Intronic
1180392211 22:12294663-12294685 CTCTGGGTGTGCCATAGAGAAGG - Intergenic
1180407534 22:12570108-12570130 CTCTGGGTGTGCCATAGAGAAGG + Intergenic
1181755384 22:25020816-25020838 GAGTGTCTGTGACAGACAGATGG + Intronic
1182821530 22:33220952-33220974 CTGTGGGAGTGAGAAAGAGAGGG - Intronic
1183087550 22:35495725-35495747 CTGGGAGTGTGACAGCCAGAGGG - Intergenic
1183776339 22:39968600-39968622 TTGTGGATCTGACAGCCAGATGG - Intronic
1185233738 22:49699275-49699297 CCGTGGGGGTGGCAGACGGATGG + Intergenic
949776494 3:7638504-7638526 GAGTGGGTGTGACTGACAGTAGG - Intronic
950117225 3:10459160-10459182 CAGTGGATGTCACAGATAGAAGG - Intronic
950136633 3:10585618-10585640 ATGTTGGTGAGACAGAAAGAAGG - Intronic
950762192 3:15241253-15241275 CTGTGGGCGTGACAAAAAGATGG - Intronic
951231512 3:20185415-20185437 CAGGGGGTGTGGTAGACAGAAGG + Intronic
953025559 3:39142946-39142968 CTGTGGGTGAGCCAGCCAGTGGG + Exonic
954219357 3:49143583-49143605 CTGTGGGGGTCACAGGCAGCAGG + Intergenic
954433559 3:50484174-50484196 ATGTGGGTGTGAGAGAAAGCGGG - Intronic
954451688 3:50575073-50575095 CTGGGGGTGTGAGACTCAGAGGG + Intronic
955520767 3:59773329-59773351 CTGTGGGAGTCACAGAAAGGGGG + Intronic
956591506 3:70920223-70920245 CTGTGGGCCTCAAAGACAGATGG + Intergenic
956625068 3:71258900-71258922 CTGTGGGAGTCCCAGACAGCCGG + Intronic
957400716 3:79709430-79709452 ATATGGGTGTGAGAGACAAATGG + Intronic
958410873 3:93814316-93814338 ATGAGGGTGTAAGAGACAGAAGG + Intergenic
959427067 3:106204318-106204340 GTGTGTGTGTGAAAGAGAGATGG - Intergenic
960356855 3:116664216-116664238 GTGTGTGTGTGAGAGAGAGAGGG + Intronic
960805032 3:121575509-121575531 GAGTGGGTGAGACAGAGAGAGGG + Intronic
961243673 3:125433699-125433721 CTCTGGGTCACACAGACAGATGG - Intergenic
962369298 3:134807531-134807553 GTGTGTGTGTGAGAGAGAGAGGG + Intronic
962617968 3:137147514-137147536 GTGTGTGTGTGACAAAAAGAAGG + Intergenic
963852429 3:150221926-150221948 GCGTGTGTGTGAGAGACAGATGG + Intergenic
963852441 3:150222062-150222084 ATGTGTGTGTGACAGAGAGATGG + Intergenic
964030133 3:152128804-152128826 CTGGGGGTGGGAGAGAGAGAGGG - Intergenic
964065706 3:152576363-152576385 GTATGTGTGTGAGAGACAGAGGG - Intergenic
964271669 3:154963170-154963192 GTGTGTGTGTGAGAGAGAGAGGG - Intergenic
967898206 3:194417930-194417952 CAGCGTGGGTGACAGACAGACGG + Intronic
967978731 3:195051763-195051785 CTGTGGGTTTGTCACATAGATGG + Intergenic
968619339 4:1596877-1596899 CAGTGGGAGAGAGAGACAGAGGG + Intergenic
968638718 4:1698116-1698138 CTGTGGGAGGCAGAGACAGACGG + Intronic
970023830 4:11599264-11599286 CATTGTGAGTGACAGACAGAAGG + Intergenic
971374805 4:26048233-26048255 GTGGGGGTGTCACAGACAAAGGG + Intergenic
971423611 4:26495435-26495457 CTGTGTGTGTCTCAGAGAGAGGG - Intergenic
972574427 4:40338880-40338902 GTGTGTGTGTGAGAGAGAGAGGG - Intronic
974775850 4:66479380-66479402 CTGTTTGTGTGAAAGAAAGAAGG - Intergenic
975183878 4:71378627-71378649 ATGTGAGTGAGAGAGACAGAAGG + Intronic
976200857 4:82577406-82577428 AAGTCGGTGTGACAGACACATGG - Intergenic
976760038 4:88539073-88539095 CAGTGGGTGCAACACACAGAGGG + Intronic
977189652 4:93984073-93984095 GTGTGTGTTTGAGAGACAGAGGG + Intergenic
977633859 4:99272910-99272932 TTATGGGAGTGACAGACACAGGG - Intergenic
977642070 4:99368281-99368303 TTGTGGGGGTCACAGGCAGAAGG - Intergenic
978652124 4:111018531-111018553 TTGGGGGTGAGACTGACAGAGGG - Intergenic
978875723 4:113638280-113638302 GTGTGTGTGTCAGAGACAGAAGG + Intronic
980889374 4:138797702-138797724 GTGTGTGTGTGAGTGACAGAGGG + Intergenic
981048081 4:140284052-140284074 CTGTGTGTGTGAGAGAGAGCAGG + Intronic
982299041 4:153860045-153860067 CAGTGGGTGTGGCCCACAGAGGG - Intergenic
982962738 4:161860902-161860924 GTGTGTGTGTGAGAGAGAGAGGG - Intronic
983885037 4:172971143-172971165 CTATGGGGGTGACAGAAAGAGGG - Intronic
984623823 4:181982713-181982735 CTGTGGGTTTCACAGAAAGGAGG + Intergenic
984847163 4:184117693-184117715 CTGTGGAGGAGACAAACAGAGGG + Intronic
985053145 4:186012810-186012832 GTGTGTGTGTGACAGAGAAAGGG - Intergenic
985375241 4:189329663-189329685 CTGTGGGTGAGAAAAAGAGAAGG + Intergenic
985432697 4:189896709-189896731 CTCTGGGTGTGCCATAGAGAAGG + Intergenic
985585835 5:733535-733557 CTGTGGGTGACAGAGACAGATGG - Intronic
985599498 5:819309-819331 CTGTGGGTGAGAGAGACAGACGG - Intronic
985600256 5:824947-824969 CTGTGGGTGACAGAGACAGATGG - Intronic
985712673 5:1438604-1438626 CTTTCTGTGTGACAGACGGAAGG + Intronic
986221404 5:5771929-5771951 CTGTTGATGTGACAGAGTGAGGG - Intergenic
987765595 5:22225148-22225170 CTGGGAATGTCACAGACAGAGGG - Intronic
987847054 5:23300841-23300863 AAGTCGGTGTGACAGACACATGG - Intergenic
989168156 5:38450448-38450470 AGGTGTGTGAGACAGACAGAGGG + Intronic
989313164 5:40044703-40044725 GTGTGTGTGTGAGACACAGAAGG + Intergenic
991718892 5:69477714-69477736 CTGTGTTTGTGACACATAGACGG - Intergenic
993480385 5:88417296-88417318 CTGTGTGTCTGACACACAGTAGG + Intergenic
993792759 5:92226943-92226965 GTGTGTGTGTGAGAGAGAGAGGG + Intergenic
994699954 5:103120885-103120907 GTGTGGGGTTGACAGAGAGAGGG - Intronic
995312135 5:110726097-110726119 GTGTGTGTGTGAAAGAGAGAGGG - Intronic
996868222 5:128154545-128154567 CTGTAGTTGTGAGAGAAAGAGGG - Intronic
997101438 5:130973572-130973594 GTGTGTGTCTGAGAGACAGAGGG + Intergenic
997657610 5:135566990-135567012 CTGTTGGTCTGACTGCCAGACGG - Intergenic
998165272 5:139839020-139839042 CTGTGGATGTGACCGAGAGTTGG + Intronic
998394405 5:141809307-141809329 CTGTGTGTGAGAGAGAGAGAGGG + Intergenic
998435626 5:142106005-142106027 ATGTGGATATGAAAGACAGAAGG + Intergenic
998816280 5:146017442-146017464 CTGTGAGTGTGGGAGGCAGAGGG - Intronic
998932021 5:147191492-147191514 GTGTGGGTTTTACAGTCAGATGG + Intergenic
999451974 5:151685411-151685433 GTGTGTGTGTGAGAGAGAGAGGG - Intronic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002435604 5:179229069-179229091 CTGAGGGTCTGACGGAGAGAGGG - Intronic
1002772011 6:298051-298073 CTGCAGGACTGACAGACAGATGG + Intronic
1003586911 6:7399084-7399106 GTGTGGGTGTAAAAGAGAGAGGG + Intronic
1003844480 6:10158836-10158858 CTGTGGGTCTGACAGGCACTGGG - Intronic
1005959323 6:30684710-30684732 CTGGGGGTGGGGGAGACAGAGGG + Exonic
1006143166 6:31943202-31943224 CTGTGGGTGTGAGGATCAGATGG - Intronic
1006431625 6:34000703-34000725 CTGAGGGTGTGACAGTCAGGAGG + Intergenic
1006803575 6:36774682-36774704 CAGTGGGGATGCCAGACAGAGGG + Intronic
1007766091 6:44161060-44161082 CTGTGGGAAGCACAGACAGATGG - Intronic
1010284919 6:74065685-74065707 CTAAGGGTGTGACAGAGAAATGG - Intergenic
1011043567 6:83057605-83057627 CTGTGGGTGGAAAAGAAAGAAGG + Intronic
1011798515 6:90983358-90983380 CTGTGGGAGAGAAAGACAGCAGG - Intergenic
1012639778 6:101595226-101595248 AGGTGGGAGAGACAGACAGAAGG + Intronic
1013184834 6:107748764-107748786 CTGTGGCTGTGAGAAACACAGGG + Intronic
1013437787 6:110129479-110129501 ATGTGGTTGTGACAAAAAGAAGG + Intronic
1014264611 6:119262099-119262121 CTGTGGGTTTTATAGACAGCCGG - Intronic
1017205335 6:151799166-151799188 CTGAGGGTGGGATAGAAAGAAGG + Intronic
1018098715 6:160417255-160417277 CTGTTCTTGTGGCAGACAGAAGG - Intronic
1018230258 6:161668827-161668849 ATGTGGGTGAGATAGACAGCTGG - Intronic
1019151200 6:170007113-170007135 TTATGAGTGTGACAGGCAGATGG + Intergenic
1019723355 7:2586903-2586925 CTGTGGGAGTGTTAGGCAGAGGG + Intronic
1020233202 7:6335789-6335811 CTTTGGGAGGCACAGACAGAAGG + Intronic
1020597013 7:10219644-10219666 CAGTTGGTGTGATAAACAGATGG - Intergenic
1020623501 7:10547593-10547615 GTTTGGGTGTGAGAGAGAGAGGG - Intergenic
1022251279 7:28610899-28610921 GTGTGTGTGTGAGAGAGAGAGGG + Intronic
1022283762 7:28935615-28935637 CTGGGGGTGGGGCAGGCAGAGGG + Intergenic
1022285198 7:28950087-28950109 GTGTGTGTGTGAGAGAGAGAGGG + Intergenic
1023119160 7:36892198-36892220 CTGTGTGTGGCACACACAGAGGG + Intronic
1024148784 7:46545356-46545378 ATGTGTGTGTGAAAGAGAGAGGG - Intergenic
1024709634 7:52000939-52000961 CTGTGGTTGTAACAGACATCTGG + Intergenic
1025232372 7:57211268-57211290 CTGTGGATGGGCCAGAAAGAGGG - Intergenic
1026322546 7:69280190-69280212 CAGTGGGTGTGAGAGACAAGAGG - Intergenic
1026595705 7:71732713-71732735 GTGTGTGTGTAACAGAGAGAGGG + Intergenic
1027049610 7:75013685-75013707 ATGTCTGTGTGGCAGACAGAGGG + Intronic
1027695257 7:81402727-81402749 GTGTGTCAGTGACAGACAGATGG + Intergenic
1028238966 7:88396351-88396373 TGGTGGGTGTTACAGGCAGAGGG + Intergenic
1028974084 7:96892678-96892700 TTGTGTGTGTGACAGAGAGAGGG + Intergenic
1029026321 7:97420728-97420750 GTGTGTGTGTGAGAGAGAGAGGG + Intergenic
1029383419 7:100227980-100228002 ATGTCTGTGTGGCAGACAGAGGG - Intronic
1030969315 7:116034645-116034667 GTGTGTGTGTAACAGATAGAAGG - Intronic
1031219443 7:118945927-118945949 CAGTGGGTGGGAGAGGCAGAAGG - Intergenic
1032524097 7:132566293-132566315 GTGTGTGTGTGAGAGAGAGAGGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034540520 7:151755201-151755223 CTGTGGGTGTGACAGACAGATGG - Intronic
1035019793 7:155794117-155794139 CTGCAAGTGTGCCAGACAGAGGG - Intergenic
1036175877 8:6538263-6538285 ATGTGTGTGTGTAAGACAGATGG - Intronic
1036787378 8:11697237-11697259 CTGTGCGTGTGTTTGACAGAAGG - Intronic
1037691379 8:21184086-21184108 CTGTGTGGGAGAGAGACAGATGG - Intergenic
1038791075 8:30668654-30668676 TTGTCTGTGTGACAGACACATGG + Intergenic
1038980560 8:32754753-32754775 GTGTGGGTGGGACAGAATGAAGG + Intronic
1039570510 8:38582610-38582632 CTGTGGTAGTGAATGACAGAGGG + Intergenic
1039886866 8:41659730-41659752 CTGTGCCTGTCACTGACAGAGGG + Intronic
1040067840 8:43162811-43162833 CTCTGGGAGTCAGAGACAGATGG - Intronic
1040518121 8:48150922-48150944 CTGGGTGAGTGACAGACAGGTGG + Intergenic
1041011736 8:53550153-53550175 GTGTGTGTGTGAGAGAGAGAGGG + Intergenic
1041106204 8:54446401-54446423 GTGTGGGTGTGGCTGACAGCAGG + Intergenic
1045429587 8:102101146-102101168 CAGGATGTGTGACAGACAGAAGG + Intronic
1045950042 8:107841114-107841136 CTGTGGCTGGGAGAGACAGAAGG - Intergenic
1046232928 8:111381281-111381303 GTGTGTGTGTGAGAGAGAGAGGG + Intergenic
1046758902 8:118000194-118000216 CTGTGTGTATAAAAGACAGATGG + Intronic
1047325073 8:123828250-123828272 CTGTGGGAGTGACAGACGAAGGG - Intergenic
1049251156 8:141589807-141589829 GTGTGTGTGTGCCAGAGAGAAGG + Intergenic
1052203696 9:25812598-25812620 CTGTGGGAGTGACAGCAAGAAGG - Intergenic
1052316953 9:27125100-27125122 CTCTGGGTGTGAGATACACAGGG - Intronic
1052464639 9:28814784-28814806 GTGTGTGTGTGAGAGAGAGAGGG - Intergenic
1052797448 9:32936487-32936509 CTGTGGGTGTGCGAGTCAGTTGG + Intergenic
1053380817 9:37648872-37648894 CTCTGGGTTTGGAAGACAGAAGG + Intronic
1053518520 9:38753296-38753318 CTTTCGGTGGGAAAGACAGAAGG - Intergenic
1053721880 9:40954930-40954952 CTCTGGGTGTGCCATAGAGAAGG + Intergenic
1054344085 9:63897059-63897081 CTCTGGGTGTGCCATAGAGAAGG - Intergenic
1058607551 9:106739510-106739532 AAGTGAGTGTTACAGACAGAGGG - Intergenic
1059581182 9:115550240-115550262 CTGTGGTTGTGAGAAAGAGATGG - Intergenic
1059636459 9:116175980-116176002 CTGTGGCTGGTACAGAAAGATGG + Intronic
1060551743 9:124488841-124488863 CTGTGTGTGTGACAGAAGCAAGG - Intronic
1060795946 9:126513438-126513460 CTGTGGTGATGACACACAGAAGG - Intergenic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1061005469 9:127926691-127926713 CTGAGGGTGTCCCAGACACAGGG + Intronic
1061147471 9:128808332-128808354 CTGTGGGTGAGACAGACGGCAGG - Exonic
1061485143 9:130916758-130916780 CGGTGGGTGGGGCAGAAAGAAGG - Intronic
1061848811 9:133402855-133402877 CTGTGGGTGAGCCAGAATGAGGG - Intronic
1061892671 9:133630983-133631005 CGTGTGGTGTGACAGACAGAGGG - Intergenic
1203453283 Un_GL000219v1:141074-141096 CTCTGGGTGTGCCATAGAGAAGG - Intergenic
1203421130 Un_KI270448v1:7187-7209 CTCTGGGTGTGCCATAGAGAAGG + Intergenic
1203421702 Un_KI270521v1:6702-6724 CTCTGGGTGTGCCATAGAGAAGG + Intergenic
1185483595 X:466164-466186 CTGTGTGTGTCAGAGACAGAGGG + Intergenic
1186621478 X:11245366-11245388 CTGAGGGAGTGACACCCAGAGGG - Intronic
1187296681 X:18009044-18009066 GTGTGTGTGTGAGAGAGAGAGGG + Intergenic
1187424962 X:19168992-19169014 ATGTGGGTTTGAGAGTCAGAGGG - Intergenic
1191853726 X:65605860-65605882 CTGTGAGAGTGACACACAGAAGG - Intronic
1192724091 X:73729256-73729278 ATGTGTGTGTGAGAGAGAGATGG - Intergenic
1195096292 X:101504443-101504465 GTGTGTGTGTGAGAGAGAGAAGG + Intronic
1195502894 X:105623534-105623556 ATGTGGGCATCACAGACAGAAGG - Intronic
1199273350 X:145912178-145912200 GTGTGTGTGTGAGAGAGAGAGGG + Intergenic
1200151546 X:153953771-153953793 CTGTGGGGGCGACAGGCAGGCGG + Intronic
1200841184 Y:7783281-7783303 TTGTGGGTGTCCCAGACAGGAGG + Intergenic