ID: 1034541017

View in Genome Browser
Species Human (GRCh38)
Location 7:151758197-151758219
Sequence ACCCAGTAACTGCTACTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034541017_1034541024 24 Left 1034541017 7:151758197-151758219 CCTGTCAGTAGCAGTTACTGGGT 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1034541024 7:151758244-151758266 AGATGCCATTTCTTGCTCCGTGG 0: 1
1: 0
2: 0
3: 9
4: 105
1034541017_1034541025 25 Left 1034541017 7:151758197-151758219 CCTGTCAGTAGCAGTTACTGGGT 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1034541025 7:151758245-151758267 GATGCCATTTCTTGCTCCGTGGG No data
1034541017_1034541027 27 Left 1034541017 7:151758197-151758219 CCTGTCAGTAGCAGTTACTGGGT 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1034541027 7:151758247-151758269 TGCCATTTCTTGCTCCGTGGGGG No data
1034541017_1034541026 26 Left 1034541017 7:151758197-151758219 CCTGTCAGTAGCAGTTACTGGGT 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1034541026 7:151758246-151758268 ATGCCATTTCTTGCTCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034541017 Original CRISPR ACCCAGTAACTGCTACTGAC AGG (reversed) Intronic
906122934 1:43406742-43406764 AACCAGTAAGTGGTACTGCCAGG - Intronic
908173094 1:61527363-61527385 ACCCAGTAAATGATAGAGACAGG - Intergenic
908444568 1:64188873-64188895 ACCCAGCAAATGGTATTGACGGG - Intergenic
915214327 1:154329813-154329835 CACCAGCAACTGCTTCTGACTGG - Intronic
917800447 1:178564760-178564782 ACCTAGTTACTTCTACAGACAGG - Intergenic
919016759 1:192048432-192048454 ACCCTGTAACAGATACTGCCTGG - Intergenic
919664397 1:200278419-200278441 GCCCAGTAACTGCTGCTGGCTGG - Intergenic
919964630 1:202510296-202510318 CCCCAGTGATTGCTACTGACAGG - Intronic
921908574 1:220523277-220523299 TCCCAGTAAATGTTATTGACTGG - Intergenic
923512099 1:234661534-234661556 CCCCAGTAAGAGCTGCTGACTGG - Intergenic
1077291916 11:1800613-1800635 ACACAGTGACTGCTTCTGACAGG - Intergenic
1081525098 11:43922533-43922555 AGCCAGAAACTGCTGGTGACTGG + Intergenic
1084039427 11:66532754-66532776 ACACAGCAGCTGCTCCTGACAGG + Exonic
1084793452 11:71489517-71489539 CCCCAGTAACTGCCAAGGACTGG - Intronic
1086491602 11:87361860-87361882 ACCCAGCAAATGGTATTGACAGG - Intergenic
1100148566 12:91707859-91707881 ACCCAGTACCTGCCACAGAGGGG - Intergenic
1108258782 13:48636549-48636571 ACCCAGTCACTGCTATATACAGG - Intergenic
1114726370 14:24941881-24941903 GCCCTGTAACTGCTACTCACAGG - Intronic
1128746740 15:70120092-70120114 AGCCAGCAACTGCTCCTGAGAGG + Intergenic
1131692001 15:94837314-94837336 ACCCAGTTGCTGCTGCTGGCTGG + Intergenic
1132176152 15:99716803-99716825 CTCCAGTAACTGCTTCTCACAGG + Intronic
1137518759 16:49173679-49173701 TGCCAGTAACTGCTTGTGACTGG - Intergenic
1137543770 16:49383508-49383530 ACCCAGTAACTGGTCATGAAGGG - Intronic
1138249949 16:55494220-55494242 ATTCTGTAACTGCTACTTACTGG + Intronic
1143238669 17:5425211-5425233 ACCTAGTATCTGCTAGTCACAGG - Intronic
1152864351 17:82713316-82713338 ACGCAGTGACTGCTCCAGACGGG + Intergenic
1155347678 18:24874926-24874948 ACCCAGTGAGGGCTACTGGCAGG + Intergenic
1156644627 18:39146218-39146240 AGCCAGTAACTGCTACCCAAAGG + Intergenic
1158403810 18:57143677-57143699 AGTCAGCAACTGCCACTGACAGG - Intergenic
925140974 2:1549739-1549761 ACTGAGTAACTGTTACTGGCAGG - Intergenic
926176735 2:10599889-10599911 ACCCAGGGACTGCAACTGAAGGG - Intronic
926935769 2:18085535-18085557 CCCCAGCAACTGCCACTGCCAGG - Intronic
935537478 2:104310878-104310900 ACCCAGTATCTGCTGCTGTTGGG + Intergenic
939150938 2:138472133-138472155 AGCCACTAACTGGTACTTACTGG + Intergenic
940165590 2:150767046-150767068 ACCCTGTTACTGCTACTTGCTGG - Intergenic
940828526 2:158440920-158440942 CCCAAGTAGCTGCTACTTACAGG - Intronic
946155840 2:217806140-217806162 ACCCGGCAACTGCACCTGACTGG + Intronic
946998189 2:225420478-225420500 ACAGGGTAAATGCTACTGACAGG + Intronic
949046377 2:241874373-241874395 ACCCAGACACTGCCACTGTCAGG - Intergenic
1170429578 20:16263992-16264014 ACCCAGCTACTGCTCCTGGCAGG - Intergenic
1170917033 20:20636913-20636935 ATCCAGCAGCTACTACTGACAGG - Intronic
1172462850 20:35133189-35133211 AGCCGGTAACTGATACTGATGGG - Intronic
1177898317 21:26882117-26882139 ACCCAGGATCTGCCATTGACAGG - Intergenic
1182208850 22:28656301-28656323 ATCCAGTAACTGCTACAGGAAGG + Intronic
966856680 3:184198821-184198843 TCCCAGGAACTTCTACTCACCGG - Intronic
967322114 3:188205003-188205025 AACCAGTACCTGCTACTTATTGG + Intronic
967540252 3:190658679-190658701 GCCCATTCACTGTTACTGACCGG - Intergenic
970947901 4:21716592-21716614 ACCCAGTAACTCCTCATTACAGG - Intronic
972505988 4:39720619-39720641 AACCGGTAACTGATACTTACAGG + Intronic
976655993 4:87489351-87489373 ACCCAGTAACTGCAAGGGATCGG - Intronic
977144413 4:93419124-93419146 ACACCATAACTGGTACTGACAGG - Intronic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
977858665 4:101927977-101927999 CCACATTAAATGCTACTGACAGG + Intronic
978250896 4:106630508-106630530 ACACAGTAAGTGATACTTACAGG - Intergenic
980864578 4:138540158-138540180 ACCCAATAAATGCTACTGACAGG + Intergenic
981866481 4:149426241-149426263 AACCAGGAACTCCCACTGACTGG - Intergenic
982058857 4:151582503-151582525 AACCAGAATCTGCCACTGACAGG - Intronic
994610435 5:102031189-102031211 AGCCAGTAACTTTTCCTGACTGG - Intergenic
995194391 5:109347483-109347505 ATCCAGTAACTGGTAATTACAGG + Intronic
998163124 5:139824767-139824789 TCCCAGTAACTGCAACCGCCAGG - Intronic
1003044827 6:2724217-2724239 ACCCAGCATCTGCTACAGATGGG + Intronic
1003389974 6:5705469-5705491 ACTCAGTAACTGCCAGTAACTGG + Intronic
1015324455 6:131908647-131908669 ACTCAGTAAACCCTACTGACAGG + Intergenic
1017335479 6:153253803-153253825 ACCCAGTTACTGCCTCTGAGAGG - Intergenic
1018349452 6:162941550-162941572 ACCCAGAAACTCCTCCTGCCAGG - Intronic
1020586640 7:10078504-10078526 ACCCAGTCATGGCTACAGACCGG + Intergenic
1029221207 7:98991876-98991898 ACCCAGGAACTGTGAGTGACAGG - Intronic
1030460665 7:109831217-109831239 ACCCAATAAATACTACTGACTGG + Intergenic
1034541017 7:151758197-151758219 ACCCAGTAACTGCTACTGACAGG - Intronic
1037799838 8:22026327-22026349 AACCATTCACTGCTAGTGACAGG + Intronic
1040988426 8:53322148-53322170 AGCCAGCAACTGCTTCTGAGCGG + Intergenic
1041644064 8:60233534-60233556 ACCCAGTAAATGCAACTGAAAGG + Intronic
1041790059 8:61685310-61685332 ACCCAGGAACTGCCCCTGAAGGG - Intronic
1048291687 8:133186101-133186123 ACCCAGCCACTGCTACTTTCAGG - Intergenic
1053609103 9:39692922-39692944 ATCCAGGATCTGCTACTCACTGG + Intergenic
1053866947 9:42449192-42449214 ATCCAGGATCTGCTACTCACTGG + Intergenic
1054089213 9:60778567-60778589 ATCCAGGATCTGCTACTCACTGG - Intergenic
1054244422 9:62649476-62649498 ATCCAGGATCTGCTACTCACTGG - Intergenic
1054558549 9:66684019-66684041 ATCCAGGATCTGCTACTCACTGG - Intergenic
1060580797 9:124744680-124744702 CCTCAGTAGCTGCTTCTGACAGG - Intronic
1187431290 X:19227720-19227742 AACTAAAAACTGCTACTGACTGG + Intergenic
1189529752 X:41867292-41867314 ACCCAGTAAATGCTACTGGATGG + Intronic
1189572971 X:42319450-42319472 CACCAGTATCTGCTTCTGACGGG + Intergenic
1192201678 X:69070230-69070252 ACCCAGCCATTCCTACTGACTGG - Intergenic
1195272941 X:103251028-103251050 ACCTAGTACCTGCTGCAGACTGG + Intergenic
1197821243 X:130542996-130543018 TCCCAGTAACTGATCCTGGCTGG - Intergenic