ID: 1034543467

View in Genome Browser
Species Human (GRCh38)
Location 7:151775017-151775039
Sequence ATCCTCCTTAATGTCAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034543461_1034543467 18 Left 1034543461 7:151774976-151774998 CCTTGAGACAGAAGACTCAGAAA 0: 1
1: 0
2: 5
3: 41
4: 424
Right 1034543467 7:151775017-151775039 ATCCTCCTTAATGTCAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034543467 Original CRISPR ATCCTCCTTAATGTCAAGGC TGG Intronic
No off target data available for this crispr