ID: 1034544283

View in Genome Browser
Species Human (GRCh38)
Location 7:151779660-151779682
Sequence GCTCCTAGTCAGAGGCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034544283_1034544286 -10 Left 1034544283 7:151779660-151779682 CCTGCTTGCCTCTGACTAGGAGC 0: 1
1: 0
2: 2
3: 9
4: 120
Right 1034544286 7:151779673-151779695 GACTAGGAGCCCTTGAAGGCAGG 0: 1
1: 1
2: 3
3: 20
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034544283 Original CRISPR GCTCCTAGTCAGAGGCAAGC AGG (reversed) Intronic
901656529 1:10772872-10772894 GCTTCAAGTCAGAGGCGAGGGGG - Intronic
902215306 1:14930926-14930948 GCCCGAAGCCAGAGGCAAGCTGG + Intronic
903886393 1:26543345-26543367 GCTCTCAGTCAGAGGCAGACAGG + Intronic
907899147 1:58721477-58721499 GCTCCTGGTCAGAGGCAGCCTGG + Intergenic
908107782 1:60863047-60863069 TCTGCTTGTCAGAGGCAAGTAGG + Intergenic
908424543 1:63993401-63993423 GTTTCAAGTCAGGGGCAAGCAGG - Intronic
912566837 1:110593389-110593411 GCTCCCAGTCAAGGGCAGGCAGG + Intergenic
912700075 1:111871426-111871448 GGTCCTAGAGAGAGGCAAGGAGG + Intronic
914922821 1:151859139-151859161 GCTAAGGGTCAGAGGCAAGCTGG + Intergenic
915121380 1:153631629-153631651 GCACTGAGTCAGAGGCAAGGGGG - Intronic
916115729 1:161483650-161483672 GCTACTGCTCAGAGGCATGCTGG + Intergenic
917646088 1:177029958-177029980 GGCCCTAGTCAGAGGGAAGTGGG - Intronic
918046200 1:180942402-180942424 TCTCCTAGGCAGAGTGAAGCAGG + Intronic
919178559 1:194052189-194052211 GCTCCTTATCAGAGGGACGCAGG + Intergenic
922752468 1:228077018-228077040 GCTTCCAGGCAGAGGCTAGCAGG - Intergenic
1067239290 10:44476649-44476671 GCTCCTCTGCAGAGGCAAGCTGG - Intergenic
1067416118 10:46104536-46104558 TCTTCTAGCCAGAGGCCAGCAGG + Intergenic
1068369718 10:56096417-56096439 GCTCCTAGTCAGATCAATGCAGG - Intergenic
1068630374 10:59291443-59291465 GCTCCTGAACAGAGGGAAGCTGG - Intronic
1068934788 10:62625100-62625122 GCTCCTCTTCATAGGCAACCAGG - Intronic
1075048064 10:119161726-119161748 GCTCTGAGCCAGAGGCAAGCCGG - Intronic
1077892630 11:6430518-6430540 GCTGTGTGTCAGAGGCAAGCTGG - Intergenic
1078172380 11:8938078-8938100 GGACCTGGTCAGTGGCAAGCGGG + Exonic
1085448076 11:76614647-76614669 GCTGTTAGTCAGAGCCATGCAGG + Intergenic
1089899579 11:121966716-121966738 GGTCCTAGTCAGAGGCATTCTGG - Intergenic
1095303914 12:40618866-40618888 GATCCCAGTCAGAGGCCAGAAGG + Intergenic
1096792289 12:54052829-54052851 GCTCCTAGCCAGAAGCAAGCAGG + Intronic
1107824947 13:44320273-44320295 CCTCCAAGTCATAGGCAAGGGGG + Intergenic
1109777429 13:67060188-67060210 GCTCCTATTGAGTGCCAAGCCGG - Intronic
1110443040 13:75546525-75546547 GCTTCTATTCAAAGACAAGCAGG - Intronic
1119657949 14:76430938-76430960 GCTGCTGGTCAGAGGGCAGCAGG - Intronic
1120282184 14:82453826-82453848 GCTTCTACTCAGTGGCTAGCTGG - Intergenic
1121217438 14:92259447-92259469 CCTCCCAGTCAGAGGGAGGCTGG - Intergenic
1121962085 14:98270215-98270237 ACTGCTAGTTAGAGGCAACCTGG + Intergenic
1127531064 15:59843905-59843927 CCACCCAGTCAGAGGGAAGCTGG - Intergenic
1128634375 15:69293786-69293808 GCACCGAGACAGAGGCAACCTGG + Intergenic
1129053809 15:72805734-72805756 ACTCTTAGACAGAGGCAAGAGGG - Intergenic
1129669396 15:77598727-77598749 GCTGCTGGTAAGAGGGAAGCCGG + Intergenic
1134446147 16:14332976-14332998 CCTCCTAGTCCTAGGCACGCTGG - Intergenic
1137531911 16:49283213-49283235 GATCCCAGTCAGAGGCCGGCTGG + Intergenic
1140032789 16:71351726-71351748 GCCCCCAGGCAGAGCCAAGCCGG + Intergenic
1148744191 17:49909374-49909396 GCTTCTAGGCAGAGGGGAGCGGG + Intergenic
1149014004 17:51887298-51887320 GCCTCTAGGCTGAGGCAAGCAGG + Intronic
1149492078 17:57092259-57092281 GCTCCAAGTTAGAGGGAAGGAGG - Intronic
1153387063 18:4510393-4510415 GGTCCTAGGCAGAGACCAGCTGG + Intergenic
1160064037 18:75558328-75558350 GCACCTGGTCAAAGGCAGGCTGG + Intergenic
1160601946 18:80020464-80020486 GCAACTGCTCAGAGGCAAGCTGG + Intronic
1164767671 19:30784237-30784259 TCTCCAAGTCAGTGGGAAGCAGG - Intergenic
1165714707 19:38036834-38036856 GCTCCAAGACAGGGGCAGGCCGG - Intronic
925309019 2:2868839-2868861 GCTACTAGTGAGAGGCAATGGGG - Intergenic
925722469 2:6842459-6842481 GCAACTGTTCAGAGGCAAGCTGG + Intronic
925742762 2:7020168-7020190 GCTGAGTGTCAGAGGCAAGCAGG + Intronic
927092878 2:19725911-19725933 GCTCCTAGTCAGTGGCCAGAGGG - Intergenic
927513166 2:23657126-23657148 GTGCCTTGTCAGAGACAAGCAGG - Intronic
932434755 2:71696498-71696520 GGTCCTAGAAAGAGCCAAGCAGG - Intergenic
932490376 2:72116250-72116272 GCTCCTTGGCAGTGGCAGGCTGG - Intergenic
933423477 2:82081814-82081836 GCTATTAGTCTGATGCAAGCAGG + Intergenic
933703649 2:85273943-85273965 GCTCCTGGTCAGAGGCCAGCAGG + Intronic
937318713 2:120948151-120948173 GCGGCCAGTGAGAGGCAAGCAGG - Intronic
938931773 2:136092871-136092893 GCTCATGGTCAGAGCCAGGCTGG - Intergenic
948124530 2:235555120-235555142 GCTCCTAGGCAGAGGCACAGGGG + Intronic
948310351 2:236981116-236981138 GCTCCAGGTCAGAGGAAAGAAGG - Intergenic
1168837006 20:884185-884207 GCTCTTAGCCTGAGGCTAGCAGG - Intronic
1172893503 20:38283618-38283640 CCTCTTAGACAGAGGCAAGCAGG + Intronic
1179453007 21:41478286-41478308 GCTCCCACTCAGAGGAAAGGTGG + Intronic
1179983942 21:44910858-44910880 GCTCCTTGTCCCAGGCCAGCTGG - Intronic
1181383016 22:22521870-22521892 GCGCTTAGGCAGAGGCAGGCAGG + Intergenic
1181496045 22:23288108-23288130 GCTCATAGTCAGAGGAGATCAGG - Exonic
1182103993 22:27675914-27675936 GCTCCTACTCAGAGACACGTGGG - Intergenic
1182948241 22:34345298-34345320 TCTCATATTCAGAGGAAAGCAGG + Intergenic
1185369623 22:50455028-50455050 GCTCATAGTCAGAGTCGAGCAGG + Exonic
949689218 3:6615381-6615403 GTGTCTACTCAGAGGCAAGCTGG - Intergenic
952143250 3:30502560-30502582 GTTCCTTGTCAGAAGCAAGGTGG + Intergenic
952450332 3:33426285-33426307 GCTCCTACTGAGAGGTAAACAGG + Intronic
954977051 3:54706111-54706133 GCTTCTAGTCAAAGGAATGCTGG - Intronic
955151301 3:56370010-56370032 GGTATTAGTCTGAGGCAAGCGGG - Intronic
955486144 3:59436725-59436747 TCTCCTAGTCAGAGTAAACCTGG + Intergenic
958841041 3:99205599-99205621 GCTCCCACTCAGAGGCATCCAGG - Intergenic
959086619 3:101857054-101857076 GATCCTTGTCAAAGGCAAGAGGG - Exonic
961691766 3:128675041-128675063 GAACCGAGTGAGAGGCAAGCTGG - Intronic
963686768 3:148444958-148444980 GGTCCTTGTCAGAGGGATGCAGG + Intergenic
964463506 3:156963843-156963865 GCTCCTAGGCAGTGGAAATCTGG - Intronic
965551190 3:169966787-169966809 GCTCCACGTCAGAGGGAACCGGG + Exonic
966027464 3:175301961-175301983 GCTGCTAGCCAGAGGCATGAGGG + Intronic
967775461 3:193381674-193381696 GCTTCTAGTCATAGGCAACAGGG - Intergenic
969636766 4:8373974-8373996 GCTCCTGGGCAGAGTGAAGCAGG + Intronic
971580083 4:28326173-28326195 GATCCTTATCAGAGGAAAGCAGG - Intergenic
975402566 4:73954666-73954688 AGTCCTAGCCAGAGGCAATCAGG - Intergenic
975576924 4:75872455-75872477 GCTTCAACTTAGAGGCAAGCTGG + Intronic
981342201 4:143634553-143634575 GCTCCAAGCCAGAAGCAAGATGG + Intronic
984379131 4:178967935-178967957 GGTCCTTGTAAGAGGAAAGCAGG + Intergenic
984820363 4:183876396-183876418 CCTCCTGGTCAGAGCCAACCAGG - Intronic
985867450 5:2524906-2524928 GATCCTAGTGAGAGGAAACCAGG - Intergenic
986152783 5:5142552-5142574 GCTCCAGGTCAGAGGGAAACAGG - Intronic
989771803 5:45154488-45154510 GCTCCTAGTCAGTGACTAGCAGG - Intergenic
994554075 5:101275130-101275152 GCCTCTAGTCAGAGGGAATCAGG + Intergenic
995755766 5:115502420-115502442 TCTCCTACTCAGGGGCAAGTTGG - Intergenic
997695578 5:135858229-135858251 GCTCTTAGTAAGAGGCATGGAGG + Intronic
1000636148 5:163645784-163645806 GCCCCTTGTCAGAGGCAGACAGG + Intergenic
1001661517 5:173396845-173396867 GTTCCTTGTCATAGGCCAGCCGG + Intergenic
1001931537 5:175676522-175676544 GCTCCTGGGCAAAGGCAAGAAGG + Intronic
1003023912 6:2536553-2536575 TCTCCTCCTCAGAGGCCAGCAGG - Intergenic
1008306862 6:49913878-49913900 GATCCTAGTCAGAGTCAAAGCGG - Intergenic
1008394710 6:50993099-50993121 TTTCCTAGGCTGAGGCAAGCAGG - Intergenic
1011753802 6:90478971-90478993 GCTCCTTTCTAGAGGCAAGCAGG + Intergenic
1013122332 6:107151760-107151782 GGTGCTAGGCAGAGGAAAGCAGG + Intergenic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1015490368 6:133818044-133818066 GCTCCAAGACAGACACAAGCTGG - Intergenic
1016045131 6:139473262-139473284 GCTCCTAACCATAGGCAGGCTGG - Intergenic
1018730010 6:166641914-166641936 TCTAATAGTCAGAGGCATGCTGG - Intronic
1019839002 7:3420054-3420076 TCTCCTTGTCAGTGGCAAACTGG + Intronic
1024293527 7:47824756-47824778 GCTCCTAGGGAGAGGCCTGCAGG - Intronic
1027822127 7:83060290-83060312 GCACCAAGGCAGAGCCAAGCAGG - Intronic
1028394715 7:90355748-90355770 GATCCTAAGCAGAGGCAAGAAGG - Intronic
1029670235 7:102025119-102025141 GCTCCTAGTAAGAGACAGGCAGG - Intronic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1034544283 7:151779660-151779682 GCTCCTAGTCAGAGGCAAGCAGG - Intronic
1036125465 8:6057789-6057811 GCTCTTAGTCTGAGGGAGGCTGG - Intergenic
1039196267 8:35035079-35035101 GAACCTAATCAGAGGCAAGAGGG - Intergenic
1039331177 8:36538758-36538780 GCTCATAGGCAGATGCCAGCAGG - Intergenic
1040957928 8:52998642-52998664 GCTCCTAGTTTGAGGCTAGTTGG - Intergenic
1041200710 8:55450507-55450529 GCTCATAGTCAGAGTCCAGTAGG + Intronic
1041829077 8:62132467-62132489 GCACCTGGTCAGGGGCATGCTGG - Intergenic
1043777583 8:84289367-84289389 GGGCCTAGTCAGAAGGAAGCAGG + Intronic
1048986067 8:139735736-139735758 GCTCCTGGGCAGAGCCACGCTGG + Intronic
1049195296 8:141312485-141312507 GCTCTGAGCCAGAGGCCAGCTGG + Intergenic
1055816158 9:80209541-80209563 TCTACTAGGAAGAGGCAAGCTGG + Intergenic
1061805277 9:133134231-133134253 TCTCCTAGTCAGAGCCAAAGAGG - Intronic
1186896733 X:14011311-14011333 GTTCCTAGAAAGAGGCAAGTGGG - Intronic
1188567849 X:31546725-31546747 GCTTCTTGTCAGAGGCAATGTGG + Intronic
1198205001 X:134457561-134457583 ACTGCAAGCCAGAGGCAAGCTGG + Intergenic
1202070460 Y:20986630-20986652 GCAACCACTCAGAGGCAAGCTGG + Intergenic