ID: 1034548026

View in Genome Browser
Species Human (GRCh38)
Location 7:151801683-151801705
Sequence AAACTCATTCTGTTCTAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034548020_1034548026 30 Left 1034548020 7:151801630-151801652 CCTAAACAAGGGAATTTGCTAGG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1034548026 7:151801683-151801705 AAACTCATTCTGTTCTAGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034548026 Original CRISPR AAACTCATTCTGTTCTAGAG GGG Intronic
900877838 1:5358413-5358435 GAACTCAGTCTGGTCTGGAGTGG + Intergenic
904135798 1:28311588-28311610 AAACTCATTCATGTTTAGAGAGG - Intergenic
905070896 1:35224393-35224415 AAAAACATGCTGTTCAAGAGAGG + Intergenic
906759197 1:48358257-48358279 AAATTAATACTGTACTAGAGTGG + Intronic
909115385 1:71527576-71527598 AAACTCATTCGGGAATAGAGAGG - Intronic
912231130 1:107794066-107794088 AATTTCATTCTGTTCCAGACGGG + Intronic
915235964 1:154482330-154482352 AAAATCATTGTGTTCCAGTGAGG + Exonic
915509731 1:156380001-156380023 AACCTCAATCTCTCCTAGAGAGG - Intronic
915764847 1:158352594-158352616 ATACTCTTTCTGTGCTGGAGAGG - Intergenic
917048935 1:170896026-170896048 GCACTCATTCTGTTTTAGAATGG + Intergenic
917057673 1:171001688-171001710 ATACACATTCTGTTCAACAGCGG - Intronic
917215747 1:172676372-172676394 AAACTCATTGAGTTTCAGAGAGG + Intergenic
917791293 1:178500763-178500785 AAACACTTTCTTTTCTAGAGTGG + Intergenic
921908685 1:220524660-220524682 TAATTCATTCTGTGGTAGAGTGG - Intergenic
923904414 1:238367115-238367137 AAACTCTTTCTCTTCTGGACTGG - Intergenic
1062934786 10:1377682-1377704 AATCTCAAGCTGTGCTAGAGAGG + Intronic
1063334198 10:5195268-5195290 AAACTCATTTATTTATAGAGTGG - Intergenic
1067464123 10:46482382-46482404 AAAATCATTCTGTTTTAGGCTGG - Intergenic
1067623072 10:47902269-47902291 AAAATCATTCTGTTTTAGGCTGG + Intergenic
1070319089 10:75341237-75341259 AATATCAAACTGTTCTAGAGGGG - Intergenic
1073363940 10:102921439-102921461 AATGTGATCCTGTTCTAGAGAGG - Intronic
1073450223 10:103604696-103604718 AAAATCTTTCTCTTCTAGTGGGG - Intronic
1073717995 10:106129773-106129795 TACCTCATTCAGTTCCAGAGCGG - Intergenic
1074134517 10:110615140-110615162 AAGCTCATTCCTTTCTTGAGTGG + Intergenic
1079564208 11:21861374-21861396 AAACTCATACTCTTCTGAAGAGG - Intergenic
1079747341 11:24150187-24150209 AAACTCGTGCTGTGCTGGAGGGG + Intergenic
1080443962 11:32320334-32320356 AAAATCCTTCATTTCTAGAGGGG + Intergenic
1084118495 11:67055615-67055637 AAACTCACTGTGGTCTAAAGAGG - Intergenic
1084247950 11:67873107-67873129 AAACTCTTTCAGCTCTAGGGAGG - Intergenic
1085860331 11:80225754-80225776 AGACATATTCTGTCCTAGAGAGG + Intergenic
1086845942 11:91749592-91749614 AAACTCTTTCTCTACTACAGTGG + Intergenic
1087082419 11:94184438-94184460 AAACTGATTTTATTTTAGAGAGG + Intergenic
1087266229 11:96064314-96064336 GAACTTATTATTTTCTAGAGCGG - Intronic
1087856324 11:103095984-103096006 GAACTCCTTGTGTTTTAGAGAGG + Intergenic
1089468939 11:118705477-118705499 AATCTCATTGTGTACTGGAGAGG + Intergenic
1095500203 12:42829403-42829425 AAACTCCTTTTTTCCTAGAGTGG - Intergenic
1101571257 12:105955783-105955805 CAACTCATACTGTTCTTAAGTGG - Intergenic
1104495165 12:129230289-129230311 AAACTCCTTCTGTGTTGGAGGGG + Intronic
1106463991 13:29996576-29996598 AATCTCCTTCTGTTCTTGAAGGG - Intergenic
1107088877 13:36454348-36454370 AAAGTCATTCAGTGCTACAGTGG + Intergenic
1108529002 13:51311540-51311562 AAACCCAATCTGTCCTAGCGGGG + Intergenic
1108959978 13:56214724-56214746 AAAGACATTCTGTTCTAGGAGGG - Intergenic
1110162731 13:72398711-72398733 CCACTCCTTCTGTTCTAGTGAGG - Intergenic
1110239337 13:73249477-73249499 AAACTCATTCCTTGCTGGAGTGG - Intergenic
1110465574 13:75797082-75797104 AAACTCAACCTGTAGTAGAGAGG + Intronic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1112992615 13:105532519-105532541 ATACTCACTCTGCTCTAGTGTGG - Intergenic
1118763335 14:68893981-68894003 AAACTCAGGCTGTTCTCCAGGGG - Intronic
1119452427 14:74723358-74723380 AAACTAGATCTGTTCTAGATTGG + Intronic
1120404619 14:84079478-84079500 GAAGTCATACTGTTCTAGGGTGG - Intergenic
1121393768 14:93599670-93599692 AATCTCATTCTGTTAAAAAGAGG + Intronic
1124558959 15:30754126-30754148 AAACTCAGTTTGTTCTAGGAGGG + Intronic
1124672300 15:31651621-31651643 AAACTCAGTTTGTTCTAGGAGGG - Intronic
1125329335 15:38566572-38566594 GAGCTCATTCTGTAGTAGAGGGG - Intergenic
1126563163 15:50067057-50067079 AAACTCAGTTTGTTAGAGAGTGG - Intronic
1130612105 15:85370884-85370906 AAAATCATTCTGTTACAGAGAGG + Intergenic
1131435644 15:92419434-92419456 ACACCCAGTGTGTTCTAGAGAGG - Intronic
1133357649 16:5148335-5148357 AAGCTCAGTCAGCTCTAGAGAGG - Intergenic
1133518396 16:6532187-6532209 AAACTCTTTATCTTCCAGAGTGG + Intronic
1138310952 16:56023487-56023509 AACCTGAATCTGTTCTAGATAGG + Intergenic
1138824247 16:60299602-60299624 AAACTCTTTATATTCTGGAGAGG - Intergenic
1140894268 16:79311271-79311293 AAACTCAAGCTGGTTTAGAGGGG - Intergenic
1140925571 16:79580063-79580085 AATGTCACTCTGTTCAAGAGAGG - Intergenic
1145302640 17:21652090-21652112 AACCACATACTGTTCTGGAGGGG - Intergenic
1145347662 17:22051098-22051120 AACCACATACTGTTCTGGAGGGG + Intergenic
1145415927 17:22714230-22714252 AACCACATACTGTTCTGGAGGGG - Intergenic
1147301686 17:39534035-39534057 AATCTGATTCTGTTCATGAGTGG + Exonic
1147788194 17:42995635-42995657 ATAGTCATTCTGGTCTGGAGTGG - Intergenic
1149500821 17:57150976-57150998 AAAGTCTGGCTGTTCTAGAGAGG - Intergenic
1151228273 17:72662923-72662945 TTACTCATTCTGTTGTAGAGGGG - Intronic
1153346346 18:4030471-4030493 AGATTCATTCTTTTCCAGAGAGG + Intronic
1156905808 18:42350570-42350592 AAAATAATTATGTTCTGGAGTGG + Intergenic
1158214796 18:55088882-55088904 AAAATCATTCTGTTCACAAGTGG - Intergenic
1158222252 18:55161720-55161742 AAACTCCTTATCTTCTAGATGGG - Intergenic
1159035299 18:63271675-63271697 AAAATCTTTCTGTTGTAAAGAGG - Intronic
1160542126 18:79629519-79629541 TAACTCACTTTGTTCTGGAGAGG - Intergenic
1162802774 19:13120109-13120131 AAACTCAGTCTGTCCCAAAGGGG - Intronic
1167061752 19:47153013-47153035 AAACTCATGCTCTCCTAGATTGG - Exonic
928790729 2:34949418-34949440 AGACTCCTGCTGTTCTACAGAGG + Intergenic
929900824 2:46001954-46001976 AACCACATTCTTTTCTAGGGAGG + Intronic
931893095 2:66697037-66697059 AAATACAGTCTGTTCAAGAGAGG - Intergenic
933276158 2:80286421-80286443 TAACTCATCCTGTTATAGATAGG + Intronic
933967526 2:87442276-87442298 AAACTCACTTGGGTCTAGAGGGG + Intergenic
935222947 2:101030583-101030605 AAACTCACAGTGTTCCAGAGTGG - Intronic
936326269 2:111508220-111508242 AAACTCACTTGGGTCTAGAGGGG - Intergenic
939439436 2:142225185-142225207 ATACTAATTCTGTTTTAGAGTGG - Intergenic
939559354 2:143714600-143714622 AAAAGCATTCTGTTTTAGAAGGG - Intronic
940792896 2:158046921-158046943 AAAATCATTCTATTCTATAATGG - Intronic
943152783 2:184135343-184135365 TAACTCATTCTGAGCTAGGGAGG + Intergenic
943221962 2:185121090-185121112 ATACTCATTCTGCCCTTGAGAGG + Intergenic
944730531 2:202512388-202512410 CAACTCATTCTGTTTTAGACAGG + Intronic
947186622 2:227461042-227461064 GAAATCATTCTGATTTAGAGTGG - Intergenic
1169936117 20:10885106-10885128 GACCTCATTCTGTTCTTCAGAGG - Intergenic
1170521572 20:17191148-17191170 TAACTCATTCTGCTTTAAAGAGG - Intergenic
1171121662 20:22573700-22573722 AAAGTCTCTCTTTTCTAGAGAGG + Intergenic
1171181103 20:23091348-23091370 AAAGTCATTGTGTTGTACAGAGG + Intergenic
1171519237 20:25763621-25763643 AACCACATACTGTTCTGGAGGGG - Intronic
1171557690 20:26092870-26092892 AACCACATACTGTTCTGGAGGGG + Intergenic
1175154399 20:56960057-56960079 CAACTCATTCTGTTCTTCGGAGG - Intergenic
1176653378 21:9569902-9569924 AACCACATACTGTTCTGGAGGGG - Intergenic
1176877985 21:14153305-14153327 AAATCCGTTCTGTTCTAGAAGGG - Intronic
949703536 3:6787479-6787501 CAACTCATTCTGACCTAAAGAGG + Intronic
950055648 3:10022225-10022247 AAACTAATTCTGTCCTATGGAGG + Intergenic
952137533 3:30440020-30440042 AAAGTCATTCTGTTGTAGAAAGG - Intergenic
952913168 3:38208532-38208554 ATACTCATTTTTTCCTAGAGTGG + Intronic
953631229 3:44619662-44619684 GAATACATTCTGCTCTAGAGAGG - Intronic
955430267 3:58836553-58836575 AATCTCATTCTGTTCTTCATGGG + Intronic
955575341 3:60356279-60356301 GAACTCAATCTGTTCTACAATGG - Intronic
957720761 3:83995460-83995482 AAAATCATTTTATTCTAGATAGG + Intergenic
961388341 3:126537096-126537118 TAACTAATTCTGCTCTAAAGGGG + Intronic
964305437 3:155334508-155334530 AAACTCATTTTGTTTTTGATGGG - Intergenic
967089686 3:186125040-186125062 AAACACATTCTGTCCTCAAGGGG + Intronic
970485432 4:16520372-16520394 AAACTCACTCTGCTCTGAAGAGG + Intronic
970879801 4:20915586-20915608 AAATTCAGTATGTCCTAGAGTGG - Intronic
970971438 4:21988888-21988910 AAACTCCTTGAGTTTTAGAGAGG - Intergenic
971428463 4:26538988-26539010 TAGTTCATTCTGTTTTAGAGAGG + Intergenic
973636542 4:52866381-52866403 AAACTCAACCTGTTTTTGAGGGG - Exonic
975186449 4:71409579-71409601 AAAAGCATTCTGTTTTAGAAGGG + Intronic
976412113 4:84726610-84726632 AAACTCAGTCTGTTAGTGAGTGG + Intronic
976531507 4:86158910-86158932 AAACTCCTTATATGCTAGAGTGG - Intronic
978056201 4:104270399-104270421 AAAATCATTGTGCTATAGAGAGG - Intergenic
983325326 4:166247971-166247993 AAACTCTGTCTCTTCCAGAGTGG - Intergenic
983743280 4:171162345-171162367 ATACTCATTCTTTACTAGTGAGG - Intergenic
984094732 4:175420570-175420592 TAAATCATTCTGTTATAAAGAGG + Intergenic
986489830 5:8277957-8277979 AAATTCATTCTGTGCAATAGTGG + Intergenic
987093970 5:14532249-14532271 GAGCTCATTCTGTTCTTTAGTGG - Intergenic
987790084 5:22553896-22553918 AAACTCATTCTGATATAATGTGG + Intronic
988628661 5:32905311-32905333 AAACACATTATCTTCTTGAGAGG - Intergenic
989566429 5:42905767-42905789 AAACTCAATCTGTGATAGGGTGG - Intergenic
992992215 5:82295431-82295453 AAACTGATTCTTTTCTTGATGGG + Intronic
995533326 5:113112090-113112112 AAAGTCATTCTGGTAAAGAGGGG - Intronic
997750475 5:136339889-136339911 AAATTTATTCTGTTATAAAGAGG - Intronic
998088142 5:139343421-139343443 AAACTCATTCTGACCAAAAGAGG - Intronic
998650871 5:144119771-144119793 AAAGTCATTCTCTCCTGGAGGGG - Intergenic
1001766530 5:174252222-174252244 AAATTCACTCTGATCTAGAGAGG - Intergenic
1006804383 6:36778731-36778753 CATCTCCTTCTGCTCTAGAGAGG - Intronic
1007229133 6:40336217-40336239 AAACTCATTTTGTCATAGACAGG - Intergenic
1007909182 6:45496183-45496205 AAACTCATTATCCTCTAGATGGG + Intronic
1008371234 6:50733509-50733531 GAAATAATTCTCTTCTAGAGTGG + Intronic
1008650676 6:53558426-53558448 AAAATCATTCTGTTTTAGGCTGG - Intronic
1010616393 6:78017685-78017707 AAGGTCATTGTGTTCAAGAGGGG + Intergenic
1010754445 6:79651108-79651130 AAACACATTGTGTTGCAGAGTGG + Intronic
1013480227 6:110546646-110546668 AAACTCAGTATGTTCAAAAGTGG + Intergenic
1014899825 6:126949084-126949106 AAACCCTATCTGTTCTAGAGTGG - Intergenic
1015205684 6:130635937-130635959 AAACTCATTATTTACTAGATAGG - Intergenic
1015507243 6:134001361-134001383 AAACTAATTTTGTTGTACAGAGG - Intronic
1017467094 6:154704581-154704603 GAACCCATTATGTTCTAGGGAGG - Intergenic
1020340689 7:7106845-7106867 AAAATCATTCTGTTTTGGACTGG - Intergenic
1021141359 7:17029461-17029483 AAACGTATTCTGATCTAGAAAGG - Intergenic
1022741400 7:33124815-33124837 AAGGTCATTCTGTTTTAGACTGG - Intergenic
1025279721 7:57618564-57618586 AACCACATACTGTTCTGGAGGGG - Intergenic
1025305011 7:57846937-57846959 AACCACATACTGTTCTGGAGGGG + Intergenic
1026535497 7:71235533-71235555 AAACTAATTCTGTACAACAGCGG - Intronic
1029287729 7:99477633-99477655 AAACTCAGTCTCTTCTAGGCTGG - Intronic
1030750134 7:113222362-113222384 AAAGTTATTCTATTCAAGAGAGG + Intergenic
1032066815 7:128777531-128777553 AAACTCTTTCTCTGCTACAGTGG - Intergenic
1034548026 7:151801683-151801705 AAACTCATTCTGTTCTAGAGGGG + Intronic
1043908949 8:85838029-85838051 AAACTCATTCTTTTCGAGAACGG + Intergenic
1046986504 8:120394222-120394244 AAACTTATTTTTTTTTAGAGAGG - Intronic
1050993279 9:12179711-12179733 AAACTCATTATGTTCTGAATTGG + Intergenic
1052027362 9:23588397-23588419 TCACTAATTCTGTTTTAGAGAGG - Intergenic
1057744850 9:97742733-97742755 AAAGACATTCTGTTCTGGGGAGG - Intergenic
1058351560 9:104030646-104030668 AAACACATTGTGTTTTACAGTGG - Intergenic
1058397157 9:104567872-104567894 AAACTCAGTCTGGTCTACTGGGG - Intergenic
1203631098 Un_KI270750v1:73349-73371 AACCACATACTGTTCTGGAGGGG - Intergenic
1187616271 X:20997145-20997167 AAAATCATTCTGTTTTGGACTGG - Intergenic
1191627324 X:63283212-63283234 AAGCTCAATGTGTTCTTGAGTGG - Intergenic
1193556501 X:82960577-82960599 AAAGGGATTCTGTTCCAGAGGGG - Intergenic
1193675129 X:84441608-84441630 AAACACATTTTTATCTAGAGAGG - Intronic
1193827623 X:86245463-86245485 AAACACCTTCTGCTCTAAAGGGG - Intronic
1194322215 X:92462452-92462474 ATACTCAATCTGTTCTTGAGAGG - Intronic
1194986889 X:100500403-100500425 AACCTCATTCTCCTCTGGAGTGG - Intergenic
1199636612 X:149819160-149819182 AAACTCATTTTTTTCTAAAATGG - Intergenic
1200630374 Y:5575929-5575951 ATACTCAATCTGTTCTTGAGAGG - Intronic