ID: 1034548504

View in Genome Browser
Species Human (GRCh38)
Location 7:151805100-151805122
Sequence AGCACAGCTGCCCCAACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034548504_1034548506 18 Left 1034548504 7:151805100-151805122 CCTTGAGTTGGGGCAGCTGTGCT 0: 1
1: 0
2: 4
3: 24
4: 240
Right 1034548506 7:151805141-151805163 AACCACACCACCTGACTTCTGGG 0: 1
1: 0
2: 0
3: 28
4: 244
1034548504_1034548505 17 Left 1034548504 7:151805100-151805122 CCTTGAGTTGGGGCAGCTGTGCT 0: 1
1: 0
2: 4
3: 24
4: 240
Right 1034548505 7:151805140-151805162 AAACCACACCACCTGACTTCTGG No data
1034548504_1034548508 23 Left 1034548504 7:151805100-151805122 CCTTGAGTTGGGGCAGCTGTGCT 0: 1
1: 0
2: 4
3: 24
4: 240
Right 1034548508 7:151805146-151805168 CACCACCTGACTTCTGGGTTAGG 0: 1
1: 0
2: 2
3: 38
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034548504 Original CRISPR AGCACAGCTGCCCCAACTCA AGG (reversed) Intronic
902063714 1:13666445-13666467 ACCATGGCTGCCCCATCTCAGGG + Intergenic
902203453 1:14851039-14851061 GGCATAGCTGGTCCAACTCAGGG - Intronic
902695855 1:18140467-18140489 CCCACAGCTGCCCCCACTCTAGG - Intronic
903278999 1:22239432-22239454 AGAACATCTGCCCCACCTGAAGG - Intergenic
904264002 1:29307378-29307400 AACACTGCTGCCCCTGCTCAAGG - Intronic
905172973 1:36119870-36119892 GGCACTGCTGGCCCAGCTCATGG + Intronic
905173308 1:36121902-36121924 GGCACTGCTGGCCCAGCTCATGG - Intronic
906723039 1:48023193-48023215 AGGACAGCTTCCCCAGCTCCAGG - Intergenic
906953734 1:50355185-50355207 AGGACAACTCTCCCAACTCATGG - Intergenic
908223583 1:62033716-62033738 AGCACAGCCTCACTAACTCATGG + Intronic
909582569 1:77254218-77254240 ATCACAACTTCCCCAACTCCAGG + Intergenic
912208343 1:107532726-107532748 AGCACACCTGCCCACTCTCAGGG + Intergenic
913601337 1:120424294-120424316 AGCACAGATGAACCAATTCAAGG - Intergenic
913992897 1:143631358-143631380 AGCACAGATGAACCAATTCAAGG + Intergenic
914085708 1:144452301-144452323 AGCACAGATGAACCAATTCAAGG + Intronic
914191604 1:145416282-145416304 AGCACAGATGAACCAATTCAAGG + Intergenic
914589532 1:149094284-149094306 AGCACAGATGAACCAATTCAAGG + Intronic
915204584 1:154260699-154260721 AGCACAGTTGCTGCAAGTCAAGG - Intronic
915459713 1:156062525-156062547 AGTACAGGTTCCCCAGCTCAAGG - Intronic
915950749 1:160188503-160188525 AATACAGAGGCCCCAACTCACGG + Intergenic
916573525 1:166047756-166047778 AGCACAGCAGCAGCCACTCAAGG - Intergenic
917307363 1:173640294-173640316 AGCACACCAGCACCAACCCAGGG + Intronic
918356457 1:183709833-183709855 AGCCCAATTCCCCCAACTCAGGG - Intronic
920654277 1:207864105-207864127 AGCAGAACTGCCCCAACTGCTGG + Intergenic
921159833 1:212464994-212465016 AACACAGCTCCCCCAAGACAGGG + Intergenic
921424410 1:214985203-214985225 GGCAGAGCTGCCCCAAACCATGG + Intergenic
924328257 1:242917420-242917442 AGCCCAGATCACCCAACTCAGGG - Intergenic
924585936 1:245361309-245361331 AGCACAGCTGCTACATCCCAGGG + Intronic
1063707094 10:8440993-8441015 AGCCCACCTGCCCAAACCCATGG + Intergenic
1066002206 10:31114974-31114996 ACGACAGCAGCCCCAACTCCAGG - Intergenic
1066351347 10:34640184-34640206 AGCACACCTGCCCCATCCCTGGG + Intronic
1069717643 10:70531213-70531235 TGCACCACTGCCCCACCTCAGGG - Intronic
1069805890 10:71124834-71124856 AGCACCTCAGCCCCAACCCAGGG - Intergenic
1070402107 10:76062113-76062135 AGCACAGCAGCAGCAACACATGG - Intronic
1071455790 10:85850523-85850545 ATCCCAGCTGCACCAGCTCAAGG + Intronic
1071672264 10:87619492-87619514 TTCACTGCTGCCCCAACTCCTGG - Intergenic
1072671238 10:97431176-97431198 AGCAGAACTGCCACAAATCAGGG + Intronic
1072969709 10:100006822-100006844 ACCACACCTGGCCTAACTCATGG - Intronic
1073294499 10:102430774-102430796 ACCAGATCTTCCCCAACTCAGGG - Intronic
1073897742 10:108182967-108182989 GACCCAGCTGCCCCACCTCAAGG + Intergenic
1076796623 10:132801518-132801540 TGCACAGCTACCCCAAGTCCAGG - Intergenic
1076823172 10:132952083-132952105 AGCACAGGTGCCCCAGGGCAGGG - Intergenic
1077330107 11:1980442-1980464 AGCACAGCTGCCCTGCCTCGGGG + Intronic
1078093074 11:8279583-8279605 AGCTCAGCTGCTCCAACTGTAGG + Intergenic
1079869702 11:25781566-25781588 AGCACAACTGCCCCCACCCCAGG + Intergenic
1080645452 11:34184654-34184676 AGCATGGCTGCCCCAGCACAAGG + Intronic
1080787842 11:35492240-35492262 AGCACAACTGCACCTTCTCAGGG + Intronic
1082895032 11:58181005-58181027 AGCAAAGCTGACCCTACTCAAGG + Exonic
1085365317 11:75936839-75936861 ATCACAGCTCCTCAAACTCAAGG + Intronic
1087874436 11:103339200-103339222 ATCACCCCTCCCCCAACTCAAGG - Intronic
1089730935 11:120518271-120518293 AGCACAGCTGCCGAGAGTCATGG - Intronic
1090237597 11:125160793-125160815 AGCACTCCTGCTCCAGCTCATGG - Intergenic
1090845706 11:130528216-130528238 TGCACAGCTGCCCCTCCACAGGG + Intergenic
1202813084 11_KI270721v1_random:35621-35643 AGCACAGCTGCCCTGCCTCGGGG + Intergenic
1091625112 12:2115620-2115642 AGCACAGCTGACACAGCTCGTGG - Intronic
1092593710 12:9976332-9976354 AGCAGAGCTGCCCAAAGACATGG + Intronic
1093497991 12:19779583-19779605 AGAGCAGCTGCCCCACCCCATGG - Intergenic
1095114385 12:38334449-38334471 ATCACAGTTACCCCAACTAAAGG - Intergenic
1095964629 12:47858573-47858595 CCCACAGCTGCCCCAGCACAGGG - Intronic
1096258296 12:50075801-50075823 AGCACAGCCACCCCAACTTGGGG + Intronic
1096800901 12:54109865-54109887 AGCCCAGCTTCCCCCACCCAGGG + Intergenic
1096890008 12:54760228-54760250 AGCATTCCTGCCTCAACTCATGG - Intergenic
1101958558 12:109231217-109231239 AGGACAGCAGCCCCATCGCAGGG - Intronic
1102587136 12:113931379-113931401 AGCACACCAGCCACAGCTCATGG - Intronic
1103878436 12:124147371-124147393 AACACAGCTGCCACAGCTCCAGG - Intronic
1103908133 12:124337778-124337800 GGCACAGCTGCCCCTGCACAGGG + Intronic
1103945973 12:124526622-124526644 AGACCAGCTGCCCCACCTCGTGG - Intronic
1108760754 13:53560883-53560905 AGCACATCTGCCAAAACTTATGG - Intergenic
1108944332 13:56002631-56002653 GGCACAGCTGCCCAAAACCATGG - Intergenic
1110288765 13:73779751-73779773 AGCACAGATGCCACAGCTCAAGG - Intronic
1111568689 13:90049072-90049094 ACCACTCCTGCCCCAACTCCAGG - Intergenic
1114647260 14:24262793-24262815 AGCAGAAATCCCCCAACTCAAGG + Intronic
1115950955 14:38720724-38720746 AACACAGCAGCCCAAACTAAAGG + Intergenic
1116780922 14:49236640-49236662 GGCAGAGCTGCCCAAAGTCATGG + Intergenic
1119142699 14:72282174-72282196 CTCACGGCTGCCACAACTCAAGG - Intronic
1119185154 14:72635541-72635563 TACACAACTGCCCCAACACAAGG + Intronic
1121598865 14:95187608-95187630 ATCAGAGCAGCTCCAACTCAGGG + Exonic
1122023829 14:98860079-98860101 AGTACTGCTGCCCCATCTCATGG + Intergenic
1122340684 14:101026458-101026480 GGCACAGATGCCCCAAAGCAAGG - Intergenic
1122444882 14:101761375-101761397 AGCAGAGCTGAGCCGACTCAGGG - Intergenic
1122701771 14:103594405-103594427 AGCACTGCTGCCCCAAGGCAAGG - Intronic
1122717038 14:103702108-103702130 AGCACTGCTGCCCCAGCTGCAGG + Intronic
1122804364 14:104249170-104249192 GGCACAGCTGCCCCACCTCCAGG - Intergenic
1123043328 14:105499466-105499488 AGCACAGCTGCCCCCACCTCCGG + Intronic
1124466836 15:29947891-29947913 AGCACAGCTGTGCCAACCCTGGG + Intronic
1125681812 15:41535532-41535554 GGCACAACTTCCCCAACTGATGG + Exonic
1126233500 15:46354633-46354655 AACACAGCTGCCCCACCTCCTGG + Intergenic
1129895849 15:79105315-79105337 ACCACAGCAGCCCCAAGGCAAGG - Intergenic
1130026153 15:80272207-80272229 AGCACAGCTGACCAAAGCCAGGG - Intergenic
1130098451 15:80873666-80873688 TCCCCAGCTGCCACAACTCAAGG - Exonic
1131801268 15:96071738-96071760 ATCACAGCTCCCCAAACTCTGGG + Intergenic
1137254565 16:46764307-46764329 AGCACTGCAGCCTCAACTCCTGG - Intronic
1137825000 16:51485878-51485900 ATCACAGCTGCCTCAAGTGATGG - Intergenic
1141088213 16:81111752-81111774 CCCACCTCTGCCCCAACTCAAGG + Intergenic
1141701741 16:85645497-85645519 AGGGCAGCTGCCCCACCCCAAGG + Intronic
1142680345 17:1544029-1544051 GGCACTGCTGCCCCCACTCCAGG - Intronic
1144730146 17:17521333-17521355 AGGGCAGCTGCCCCATCTCTGGG - Intronic
1145011369 17:19370185-19370207 GCAACAGCTGCCCCATCTCATGG - Intronic
1145208173 17:20995591-20995613 TGCCCGGCTGCCCCAGCTCAGGG + Intergenic
1146725108 17:35149971-35149993 AGCCCCACTGCCCCAACTCCAGG - Intronic
1146945146 17:36868696-36868718 AGCACAGCTGCCTCATCACAAGG - Intergenic
1147161968 17:38573586-38573608 AGCTCAGTTGTCCCAAGTCAGGG - Intronic
1147558971 17:41497346-41497368 GGCACAGCTGTGCCAATTCATGG + Intergenic
1147688046 17:42299066-42299088 AGCACAGCAGTCCCTCCTCAGGG - Intronic
1148199663 17:45741421-45741443 AGCACAGATGCTCCAACTGTGGG - Intergenic
1149135602 17:53359848-53359870 AGCAGAGCTGCCCAAGATCATGG + Intergenic
1150775658 17:68079939-68079961 AGCACTGCTGCCCCTGCTCCAGG + Intergenic
1152277353 17:79365864-79365886 AGCACAGCGGCCACACCTCTGGG + Intronic
1152715657 17:81899337-81899359 AACACAGCTTCCCCAACGCCTGG + Exonic
1156372975 18:36488170-36488192 AGTTCACCTGCCCCAACCCATGG - Intronic
1156995855 18:43465889-43465911 ATCATAGCTGCTCCAACTCCAGG - Intergenic
1157373421 18:47139530-47139552 AGCACAGCTCACCAAATTCAGGG - Intronic
1158480666 18:57818770-57818792 AGCACTGCTGCCCCACCACCAGG + Intergenic
1160717313 19:582215-582237 AGCACAGATGCCCCTGCTCGGGG + Intronic
1160859231 19:1230686-1230708 AGCACCCCTCCCCCAACCCAAGG - Exonic
1161349555 19:3784389-3784411 AGCACACCCGCCCCAAGCCAGGG - Exonic
1164062666 19:21689232-21689254 AGCACAGCTGCCCTTATTCAAGG - Intergenic
1165073318 19:33267933-33267955 AGGACAGCAGCTCCCACTCAGGG - Intergenic
1165257306 19:34586664-34586686 GGCACAGCTGTCAAAACTCATGG - Intergenic
1166911821 19:46164325-46164347 AGCACAGCTGCTCCACCAAAAGG - Intergenic
1167095686 19:47373840-47373862 TGCCCAGCTGCCCCAACACCTGG - Intronic
1167579519 19:50333319-50333341 AGCACCGCTCCCCCAACCCAGGG + Intronic
1167771927 19:51526054-51526076 AGCACAGCTGCCTCAACCCAGGG + Intronic
925067887 2:943219-943241 AGCACAGATTCCCAAACGCATGG - Intergenic
925312827 2:2898863-2898885 TGCACAGCTGCCTCTACTTAGGG + Intergenic
925361423 2:3283152-3283174 AGGCCAGCTGCCCCAACCCTTGG + Intronic
926133809 2:10322670-10322692 AGAACAGCTGCCCCATCTCCAGG - Intronic
926453901 2:13040578-13040600 AGCACACCTGCTCCAACTAGGGG + Intergenic
929059983 2:37914096-37914118 AGCACAGCTGATCTAATTCATGG + Intergenic
930066582 2:47332457-47332479 AGGCCTGCTGCCCCAACCCATGG + Intergenic
932759590 2:74430587-74430609 AGCACAGCTACCCCAGCTGCTGG - Intronic
932816077 2:74863240-74863262 AACAGAGCTGCTCCAACTGAAGG - Intronic
934768094 2:96891865-96891887 AGCTCAGCAGCCCCAACGCTGGG + Intronic
934845727 2:97660407-97660429 GGAACTGCTGCCCCATCTCAGGG + Intronic
935068197 2:99670134-99670156 AGCACAGCGGCCCCACTTCAAGG - Intronic
935128258 2:100242627-100242649 TGGACAGCTGCCTCATCTCATGG - Intergenic
935174726 2:100639955-100639977 AGCACAGCAGCCCCAGCCCATGG + Intergenic
936374272 2:111927313-111927335 AGCACATATGCCTCAACTGAAGG - Intronic
936837947 2:116730890-116730912 AGCAGCGCTGCCCTAACTCTAGG + Intergenic
938128424 2:128690867-128690889 AGAACAGAAGCCCCACCTCAGGG + Intergenic
938971822 2:136439715-136439737 AGCAGAGATGCCCTTACTCAAGG - Intergenic
939541894 2:143504575-143504597 AGCACAAATGTCCCAAGTCATGG + Intronic
939580119 2:143937406-143937428 GGCGCAGCTGCCCCGACGCAAGG + Intergenic
939784591 2:146494152-146494174 AGCACAGCTGCCCAAGGCCATGG - Intergenic
941233813 2:162944433-162944455 ATCACATCTTCCCCAACTCCAGG + Intergenic
941683087 2:168420189-168420211 ATCTCACCTGCCCGAACTCATGG - Intergenic
941855941 2:170231076-170231098 AACACAGCTGACCCTGCTCAAGG + Intronic
942186361 2:173428331-173428353 AGAACAGCTCCCCCAAATAAAGG - Intergenic
942650096 2:178157588-178157610 AGCCCTGTTGCCCCAATTCAAGG + Intergenic
943511841 2:188836054-188836076 ACCACAGCTGCCCCACTTCCAGG + Intergenic
946717692 2:222570413-222570435 GACACTGCTGCCCCAATTCAAGG + Intergenic
948053328 2:234994205-234994227 AGCACAGATCCCCCCTCTCAGGG - Intronic
1170918840 20:20656168-20656190 AGCAGAGCTCCCTCAGCTCACGG - Intronic
1171033184 20:21694862-21694884 TACACAGCTGCCCAACCTCATGG + Intergenic
1171852674 20:30319661-30319683 AGCCCAGCTTCCCCCACCCAGGG + Intergenic
1172096221 20:32461876-32461898 AATACAGCTGCACCAACTCTGGG - Intronic
1172582966 20:36063297-36063319 AGCAAACCTGCCCCATCTCCGGG - Intergenic
1173782333 20:45766421-45766443 AGCAAACCTGCCCCACCTGATGG - Intronic
1175924503 20:62465291-62465313 AGCACAGGGGCCCCAGCTCTGGG + Intronic
1175974309 20:62702687-62702709 AGCACAGCCTCCCCATTTCATGG + Intergenic
1176086375 20:63297303-63297325 AGCCCAGGGGCCCCAGCTCAGGG + Intronic
1176086434 20:63297456-63297478 AGCCCAGGGGCCCCAGCTCAGGG + Intronic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1180633131 22:17243729-17243751 CACACAGCTTCCCCTACTCAGGG + Intergenic
1181086746 22:20443381-20443403 AGGAAAACTGCCCCATCTCAGGG - Intronic
1181689456 22:24550406-24550428 AGCCCATTTGCCCCACCTCAGGG - Intronic
1182085781 22:27560293-27560315 AACCCAGCTGCCCCACCTCCCGG + Intergenic
1184058868 22:42070053-42070075 AGCACAGAGGCCCTAACTGATGG - Intronic
1184066278 22:42123618-42123640 AGCACAGCCGCCCCACTCCAGGG - Intergenic
1184068746 22:42135770-42135792 AGCACAGCCGCCCCACTCCAGGG - Intergenic
1184300922 22:43560522-43560544 AGCATGGCTGCCCCTACCCAAGG - Intronic
951348045 3:21570359-21570381 AGTACAGCAGCCGCAGCTCAAGG + Intronic
952820239 3:37480296-37480318 AGCAGAGCTGCCCTGCCTCATGG + Intronic
953874817 3:46660707-46660729 GGCACCGCTGCCCCAGCTCCAGG + Intergenic
954002086 3:47565822-47565844 AGGGCAGCTGCCCCAACACTGGG - Intronic
954306099 3:49726270-49726292 AGCACAGCTGCCGAAACTTGAGG + Exonic
959840287 3:110967207-110967229 AGCACACCAGCACCAACCCAGGG - Intergenic
961442160 3:126959586-126959608 AGCAGTGCTGCCCCACCCCAAGG - Intronic
963433678 3:145241575-145241597 GGCAGAGCTGCCCAAATTCATGG - Intergenic
964385641 3:156144967-156144989 AGCAAAGCTGCCTCAGCTAAAGG + Intronic
968607634 4:1543010-1543032 ATCACAGCAGCCCCAACCCAGGG + Intergenic
968663473 4:1808701-1808723 GGGACAGCTGCCCAGACTCAGGG - Exonic
968956907 4:3724148-3724170 GGCACAGCTGCACCAACTGTGGG - Intergenic
969067804 4:4502605-4502627 AACACAGTTTCCTCAACTCAAGG - Intronic
969441226 4:7217901-7217923 AGCACAGCTGTCCCCTCTCCTGG - Intronic
970066848 4:12104950-12104972 AGCACAGCTGGCCCAGGCCAGGG - Intergenic
970376929 4:15468162-15468184 AACACTGCTGCCCCAAATCCTGG + Intergenic
972828269 4:42786498-42786520 AGCACATCTGCCCCACCTCCTGG - Intergenic
974020365 4:56687613-56687635 AGGACAGCTGCTCCCATTCAGGG + Intergenic
975693453 4:76988327-76988349 AACAAAGCCTCCCCAACTCATGG - Intronic
976872573 4:89813047-89813069 ACCACAACTGCCTCAACTCTTGG - Intronic
981337316 4:143581759-143581781 AGCACAGCTGCACCACCTCCTGG + Intronic
983324030 4:166229770-166229792 ACCACAGCTGCCCTGTCTCAGGG + Intergenic
991227865 5:64293200-64293222 AGCACACCTACCCCAAGCCAAGG - Intronic
992485454 5:77190134-77190156 AGGTCAGCTGACTCAACTCATGG - Intergenic
996789337 5:127275965-127275987 AGCAGAGCTTCCCCAACTGATGG + Intergenic
1001339784 5:170832550-170832572 AAGACAGCTGCCGCAACTCCTGG - Intergenic
1001999366 5:176189044-176189066 GGAACAGCTGCCTCAGCTCATGG + Intergenic
1002072726 5:176689927-176689949 AGGACAACGTCCCCAACTCAAGG + Intergenic
1003445941 6:6184437-6184459 AGCAGAGCAGCCAGAACTCAGGG + Intronic
1004232694 6:13847351-13847373 AGCACAGAGGCCATAACTCACGG + Intergenic
1004459584 6:15823201-15823223 AGGACAGCCTCCCCATCTCAAGG + Intergenic
1006436551 6:34028773-34028795 ACCACAGCTGGCCCTTCTCAGGG + Intronic
1007190012 6:40006048-40006070 ATCACAGCTTTCCCAACTCTTGG + Intergenic
1011568358 6:88704917-88704939 GGTAGAGCTCCCCCAACTCATGG + Intronic
1014752340 6:125269512-125269534 CGCCCAGGTGCTCCAACTCAAGG + Intronic
1015657920 6:135540673-135540695 AGTACAGCAGCACCACCTCAGGG - Intergenic
1018350776 6:162956641-162956663 AGCAATGCTGCCCCAAGCCAAGG - Intronic
1019190735 6:170249239-170249261 AGCACTGCTGCCCCACCCCCGGG - Intergenic
1020426280 7:8069504-8069526 AGCACAGCTGCCCCACCCCCTGG - Intronic
1022649187 7:32259257-32259279 AGCACGGAGACCCCAACTCAAGG + Intronic
1024482120 7:49874730-49874752 AGCAAAGGTGCCCCAACTCAAGG - Intronic
1025061631 7:55813504-55813526 ATCACACCTCCCCCAACTCCAGG + Intronic
1025766801 7:64463730-64463752 AGCACATCTTCCGCTACTCAGGG + Intergenic
1029971052 7:104789777-104789799 ACCACAGCTTCCTGAACTCAGGG - Intronic
1030365880 7:108645621-108645643 GGCACAGCTGGCCCAAAGCATGG + Intergenic
1032090094 7:128907264-128907286 AGCACACCTGCCCCATTGCAGGG - Exonic
1034548504 7:151805100-151805122 AGCACAGCTGCCCCAACTCAAGG - Intronic
1034718722 7:153267619-153267641 TGCACACCTGCCCCAAGGCAGGG + Intergenic
1036445700 8:8820260-8820282 AGCACAGCAGTCCCAACCCTGGG - Intronic
1036698106 8:10992431-10992453 AGCACATCTGCCCCTCCACACGG - Intronic
1037583640 8:20261732-20261754 GGCATAGCTGCTTCAACTCATGG - Intronic
1038386946 8:27157127-27157149 AGCACAGGTGCCCCGGCCCACGG + Intergenic
1038825319 8:30992858-30992880 AGCACAGTCACCCCAAGTCAGGG - Intergenic
1040482502 8:47839375-47839397 ATCACAGCTTGCCCCACTCATGG + Intronic
1041548075 8:59069068-59069090 AGCACTGCTGTCCCAACTCCTGG - Intronic
1041615970 8:59907200-59907222 GCCACACCTCCCCCAACTCAAGG + Intergenic
1043912128 8:85875394-85875416 AGCACAGCTGTCCCCTCCCAAGG + Intergenic
1045174454 8:99706807-99706829 AGCACTGTAGCCCCAACCCAAGG + Intronic
1045282090 8:100758108-100758130 AGCCCAGCTTCCCCTACTCATGG + Intergenic
1045904285 8:107324433-107324455 AGCACTGCTGCCTCAAGCCAAGG + Intronic
1048344676 8:133567766-133567788 AGTCCAGCTGCCCCAAGCCAGGG + Intronic
1049758309 8:144320564-144320586 GGCCCAGCCTCCCCAACTCAGGG - Intronic
1050337688 9:4605346-4605368 AGCACAGCTGCACCAAAACAAGG - Exonic
1050647060 9:7731646-7731668 AGCACAGCTGATCCAACTCAAGG + Intergenic
1052823685 9:33159703-33159725 AGCACAGCTCTCCCACCTCCAGG - Intronic
1053790465 9:41682945-41682967 AGCCCAGCTTCCCCCACCCAGGG + Intergenic
1054154690 9:61631860-61631882 AGCCCAGCTTCCCCCACCCAGGG - Intergenic
1054178810 9:61894644-61894666 AGCCCAGCTTCCCCCACCCAGGG + Intergenic
1054474466 9:65562936-65562958 AGCCCAGCTTCCCCCACCCAGGG - Intergenic
1054658727 9:67686187-67686209 AGCCCAGCTTCCCCCACCCAGGG - Intergenic
1055480982 9:76708959-76708981 TGCACAGCAGCACCAACTCCCGG - Exonic
1056919958 9:90778566-90778588 AGGACAGCTGACAGAACTCAGGG + Intergenic
1057168840 9:92948789-92948811 ACCACCCCTGCCCCAACACAAGG - Intronic
1057875734 9:98752854-98752876 AGAACAGCTGACCCAGCCCAAGG + Intronic
1058210406 9:102161206-102161228 AGCAGAGCTGCCCAAAACCATGG - Intergenic
1058225114 9:102350590-102350612 AGCAGAGTTGCACCACCTCAGGG - Intergenic
1058562170 9:106241748-106241770 AGCAGAGCTACCCTAACTTATGG + Intergenic
1060169794 9:121452303-121452325 GGCAAAGCTGCCCTGACTCAGGG - Intergenic
1060293284 9:122324264-122324286 AGGACAGCTCACACAACTCAGGG + Intergenic
1060377304 9:123128213-123128235 AGCACAGCTGCCCCTGCCTATGG - Exonic
1060503850 9:124183019-124183041 TGCACAGCTGCTCCTAATCAAGG + Intergenic
1061822764 9:133237794-133237816 AGCCCAGCTGGCCCATCACAGGG + Intergenic
1061857880 9:133452873-133452895 AGCACAGAAGCCCTAAGTCAGGG - Intronic
1062208288 9:135349154-135349176 GGCACAGGTGCCCCACCTCGGGG + Intergenic
1062481240 9:136753538-136753560 GGCACAGCTGCGCAAAGTCACGG + Intergenic
1186262109 X:7790860-7790882 ATCTCACCTTCCCCAACTCAGGG - Intergenic
1187531991 X:20105566-20105588 AGGACAGATGCCCTAACTCTGGG - Intronic
1192382902 X:70636286-70636308 TCCACATCTGCCCCAACTCCAGG + Intronic
1194157827 X:90415322-90415344 GGCAGAGCAGCCCCATCTCATGG + Intergenic
1194195068 X:90882703-90882725 AGAGCAGCTGCCCCAACCCATGG - Intergenic
1194607739 X:96002620-96002642 ACCACAGCTGCTTCAACTGATGG + Intergenic
1197560476 X:128014689-128014711 GGCACAGCTGCCCCAAATCATGG - Intergenic
1198108910 X:133485473-133485495 AGCCCAGCAGGCCCAAATCAAGG + Intergenic
1198177597 X:134172108-134172130 ATCACAGCTGCCCCAACGAAGGG + Intergenic
1199278140 X:145970312-145970334 AGCAGAGCTGCCCCAGACCATGG + Intergenic
1200360774 X:155604136-155604158 AGAACAGCTGCCCTACCTCGTGG + Intronic
1200744839 Y:6894725-6894747 AGCACAGCTGCCCTAGTTCAAGG + Intergenic
1201452311 Y:14129522-14129544 GGCAGAGCTGCCCCAAATCATGG + Intergenic