ID: 1034548792

View in Genome Browser
Species Human (GRCh38)
Location 7:151807261-151807283
Sequence TCAGCCACCAGCAGACCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034548789_1034548792 -8 Left 1034548789 7:151807246-151807268 CCAAAAAGTGGCCAGTCAGCCAC 0: 1
1: 0
2: 2
3: 5
4: 105
Right 1034548792 7:151807261-151807283 TCAGCCACCAGCAGACCCATGGG No data
1034548787_1034548792 7 Left 1034548787 7:151807231-151807253 CCTCAATAAAGCTGACCAAAAAG 0: 1
1: 0
2: 12
3: 108
4: 607
Right 1034548792 7:151807261-151807283 TCAGCCACCAGCAGACCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034548792 Original CRISPR TCAGCCACCAGCAGACCCAT GGG Intronic
No off target data available for this crispr