ID: 1034548973

View in Genome Browser
Species Human (GRCh38)
Location 7:151808397-151808419
Sequence CAGTTGGACTGTAGGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034548973 Original CRISPR CAGTTGGACTGTAGGCAAGA AGG Intronic
901014881 1:6223038-6223060 CAGTGGGACTCTAGCCAAGGCGG - Exonic
903148921 1:21391353-21391375 CATTTGGTCTCTGGGCAAGATGG - Intergenic
903241407 1:21985011-21985033 CACTTGGATTATAGGCATGAGGG - Intronic
903244866 1:22007883-22007905 CACTTGGATTATAGGCAGGAGGG - Intronic
904913557 1:33953454-33953476 CAGCTGGGCTGTAGGCATCATGG - Intronic
905461291 1:38124537-38124559 CAGGTGGACAGTAGGCATGCAGG - Intergenic
905801317 1:40844991-40845013 GAGTTGGTCTGCAGGCAAGACGG + Intergenic
906799219 1:48721489-48721511 CAGTGTGACTGTTGGCAATACGG + Intronic
908917987 1:69155078-69155100 AAGTTGGACTTTAGACAAGATGG - Intergenic
910523421 1:88149979-88150001 CAGTTGGAAGGTTGGCAACAAGG - Intergenic
916989940 1:170232162-170232184 CAGATCGCCTGCAGGCAAGAGGG - Intergenic
919539995 1:198834333-198834355 CAATTGGAATCTAGGCAGGAAGG + Intergenic
919857699 1:201717009-201717031 CAGTAGTCCTGTGGGCAAGATGG - Intronic
923367104 1:233273497-233273519 CAGTTGGATAGAAGGAAAGAAGG - Intronic
924504707 1:244670836-244670858 CATTTGGACTGTAGTGAAGGCGG - Intronic
924746542 1:246839823-246839845 CAGTTGTACTGTAGAGAACAGGG + Exonic
1063455495 10:6179612-6179634 CAGGAGGACTGCAGGCAAGAGGG + Intronic
1064275837 10:13904156-13904178 CAACTGGACTGTAGGCAAAAGGG - Intronic
1064583411 10:16816433-16816455 CAGTGAAACTGAAGGCAAGAGGG + Intronic
1068351438 10:55850837-55850859 CATTTTGACTGTAGAAAAGAAGG - Intergenic
1069339506 10:67393483-67393505 CATTTGGACTGTAAGCGATATGG - Intronic
1071856107 10:89626055-89626077 CAGCTTGACTGTAGGCATGAAGG - Intronic
1073603709 10:104871947-104871969 CATCTGTACTGTAGGCAAGGAGG + Intronic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1077258000 11:1597751-1597773 CAGTTGGACTGGCAGCAACAGGG + Exonic
1077462982 11:2720182-2720204 CAAATGGACTGTGGGCATGATGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078922646 11:15844929-15844951 CAGTTTCACTGTAGCTAAGAAGG + Intergenic
1079453372 11:20616867-20616889 CTGTAGGACTGTAGGAATGATGG - Intronic
1087639372 11:100739888-100739910 CAGCTGGACTGTGGGTCAGATGG - Intronic
1088482689 11:110310356-110310378 CAGTTGTACTGTAGACCTGATGG + Intergenic
1091229383 11:133977833-133977855 GAGTTTGTCTGTAGGCAAGGGGG - Intergenic
1092928562 12:13294223-13294245 CAGTTGGCCTGTAGGAGAGTTGG - Intergenic
1094270690 12:28611197-28611219 CACTTGGACTGGAAGCAACAGGG - Intergenic
1097700187 12:62811957-62811979 CAGTTTCACTGTTGGCAAAATGG - Intronic
1098476614 12:70911278-70911300 CAGTTGGTCAGTAGAGAAGAAGG + Intronic
1100497290 12:95137841-95137863 CAGTTAGAGTCCAGGCAAGATGG - Intronic
1100830597 12:98513673-98513695 CAGATAGAATGTAGACAAGAGGG + Intergenic
1101452769 12:104795544-104795566 CACATTGACGGTAGGCAAGAAGG + Intergenic
1102961422 12:117095961-117095983 CTGTGGGACTGCAGGCAAGCTGG + Intronic
1103568662 12:121830051-121830073 CAGTTGGGCTGCAGGCAAGGTGG - Exonic
1104338027 12:127918851-127918873 CAGTTGGGGTGTGGCCAAGAAGG + Intergenic
1105809425 13:23981120-23981142 CAGTTCTACTGTTGGAAAGATGG + Intronic
1106240707 13:27910638-27910660 CAGCTGCACTATAGGAAAGATGG + Intergenic
1116254972 14:42541935-42541957 TAGTTGGACTGGATTCAAGAAGG - Intergenic
1119484820 14:74980518-74980540 CAGTGGGAATGTGGGAAAGAAGG + Intergenic
1127977646 15:64009967-64009989 CAGTTGGGCTGTGGGTAAGAGGG + Intronic
1129766868 15:78175153-78175175 CTGTTGGACAGAAGGAAAGAAGG - Intronic
1130712294 15:86294995-86295017 AAGTTGCACTGAAAGCAAGAGGG - Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1136234057 16:28903751-28903773 CAGCTGGGCTGAGGGCAAGAAGG - Intronic
1139248939 16:65476108-65476130 CAGTTGGACAGCATGCCAGATGG - Intergenic
1139559271 16:67731281-67731303 CAGATGGACAGTTGGCAGGATGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144783436 17:17819193-17819215 CAGTGGGACTGTTGCCAAGATGG + Exonic
1147041362 17:37721853-37721875 CAGTTGGGTTGTAGACAACAAGG - Intronic
1150720107 17:67607205-67607227 CAGTTTGACTTTGTGCAAGATGG + Intronic
1153304447 18:3619352-3619374 CAGGTGGCCTGCAGGCAGGATGG + Intronic
1155072321 18:22327382-22327404 CCACTGGACTGTAGGTAAGATGG - Intergenic
1158376473 18:56875465-56875487 CAGTGGGAAGGTATGCAAGATGG - Intronic
1162751276 19:12830718-12830740 CAGCTGGAGTGTGGGCAGGACGG - Intronic
1163550888 19:17966072-17966094 CAGTTGGACTGAAGGAAGGAAGG - Intronic
1163688102 19:18723748-18723770 CAGATGGCCTGTGGGCAACAGGG + Intronic
1164006251 19:21152188-21152210 CTTTTGGTCTCTAGGCAAGATGG + Intronic
1167988452 19:53338069-53338091 CAGTTGTCCTGTGGCCAAGATGG - Intronic
927498377 2:23565490-23565512 CAGATGCTCCGTAGGCAAGAGGG + Intronic
931208202 2:60167852-60167874 TAGTTGGAAGGTAGGAAAGAGGG + Intergenic
935735735 2:106105487-106105509 CAGGTGGAAAGTAGACAAGACGG - Intronic
936271891 2:111055339-111055361 CAGTTAGAATGCAGGAAAGAGGG - Intronic
937459605 2:122074574-122074596 CCCCTGGACTGTAGGTAAGATGG - Intergenic
940006486 2:149013303-149013325 AAGTTGGAATGTAGGCATGATGG - Intronic
941118454 2:161499902-161499924 CAGTTGTACTGTAGAGAACAGGG + Intronic
945753380 2:213815919-213815941 TAGTTGGACTGTAGGCTAATTGG + Intronic
947350674 2:229241420-229241442 CTGTTGGACTGAGGGCAAAATGG - Intronic
947395417 2:229682033-229682055 CATTTGAAATGTAAGCAAGAGGG + Intronic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169585783 20:7083422-7083444 CAGTTTTATTGTGGGCAAGAAGG + Intergenic
1171308093 20:24123225-24123247 CTGCTGGAGTGTAGGCAAAAAGG + Intergenic
1172216158 20:33237332-33237354 CAAGTGAACTGTGGGCAAGATGG + Intronic
1172414394 20:34752474-34752496 CAGTTAGACTGTAGGCTCCAAGG - Intronic
1174418961 20:50386829-50386851 CAGTTGGACAGAGGGCAGGACGG - Intergenic
1180243602 21:46530111-46530133 CAGTACTACTGTAGGCAAGCTGG + Intronic
1183074657 22:35419307-35419329 CAGTTGGCCTGGGGGCTAGAGGG + Intronic
1183108254 22:35629966-35629988 CAGTTGGAATGTAGGCTTGGAGG + Intronic
952157275 3:30656835-30656857 CAATTGAAATGTAGGCAAGGTGG + Intronic
953194299 3:40717798-40717820 CATTTGCACTGTAGCCAAGGTGG + Intergenic
953196618 3:40740110-40740132 CACTTGGACAGTGGGGAAGAAGG + Intergenic
953251183 3:41246920-41246942 CCGTTGGGCACTAGGCAAGAAGG - Exonic
953448582 3:42988137-42988159 CAGCTGGGCTGGAGGCCAGAAGG - Intronic
954507540 3:51091701-51091723 AAGATGGATTGTTGGCAAGATGG + Intronic
954748727 3:52802020-52802042 CTGTTGGAATGAAAGCAAGAAGG - Intronic
956566914 3:70649288-70649310 GATTTGAACTGTATGCAAGACGG - Intergenic
957201458 3:77141433-77141455 CAACTGGAATGTAGGCAACAAGG - Intronic
960386618 3:117028358-117028380 CATGTGGTCTCTAGGCAAGATGG - Intronic
961372497 3:126440138-126440160 CAGCTGGCCCGTAGGCAAGCTGG - Intronic
962388976 3:134956069-134956091 AAGTTGGACTGCAGGGAGGAAGG + Intronic
966339886 3:178914105-178914127 GAGTTGGAGTGTTGGCAAGGAGG - Intergenic
969141789 4:5080969-5080991 CAGTAGGATTGTAGTCAAGACGG - Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971005996 4:22374816-22374838 CACGTGGTCTCTAGGCAAGATGG - Intronic
972797720 4:42438667-42438689 CAGATGGACTGAATGCAAGGAGG + Intronic
973016284 4:45142821-45142843 CAGTTGGAAGGAAGGAAAGAAGG - Intergenic
973016298 4:45142884-45142906 CAGTTGGAAGGAAGGAAAGAAGG - Intergenic
973549466 4:52018684-52018706 GATTTGGACTATAGGCAATAAGG - Intergenic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
975795041 4:77998142-77998164 CATTTGCACTGGGGGCAAGAAGG - Intergenic
980680681 4:136155630-136155652 CAGGTGGACTGTAGGTAATTTGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986778368 5:11040585-11040607 GAGTAGAACTGTGGGCAAGAAGG + Intronic
992351506 5:75933684-75933706 CAGTTGGCCTGGAGCCAAGATGG - Intergenic
992869661 5:80993677-80993699 CTGTAGGCCTGAAGGCAAGAGGG + Intronic
994987206 5:106951823-106951845 CAGTTGGAGTTTAGGGAAGAAGG - Intergenic
995675077 5:114654328-114654350 CAGTTGGGCTGTTGGTAAGGAGG - Intergenic
997381870 5:133444229-133444251 CATGGGGACTGTGGGCAAGAAGG - Intronic
998818534 5:146037023-146037045 CAGTTGGACTGGATTTAAGAAGG - Intronic
998874588 5:146586444-146586466 CAGTTGCTCTGTAGGCTTGAAGG + Intronic
998907513 5:146922446-146922468 ATGTTGGACTGTAAGCTAGATGG + Intronic
999081278 5:148846121-148846143 CTGTAGGACTCTGGGCAAGATGG - Intergenic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001865886 5:175105057-175105079 CAGTTGCCCTGGAGGCAATAAGG - Intergenic
1003195008 6:3906603-3906625 AAGTAGGACTGTGGGTAAGAAGG + Intergenic
1003779825 6:9411843-9411865 CAGTTGGTCTGTTTCCAAGATGG - Intergenic
1003848974 6:10202611-10202633 CAACTGGACTGTAGGTAAGGTGG + Intronic
1004765463 6:18721714-18721736 CATGTGGACTCTGGGCAAGATGG - Intergenic
1005000320 6:21233519-21233541 CAGTTGCACTGTGGGCAGGAAGG - Intergenic
1005956832 6:30670069-30670091 CAGCTGGAATGTTGTCAAGAAGG - Intronic
1006638661 6:35477406-35477428 CAGGTGGAAGGTAGGGAAGAGGG - Intronic
1013079416 6:106799456-106799478 CAGGGGGACTCCAGGCAAGACGG + Intergenic
1016426606 6:143942114-143942136 CAGTTGGAATGAAGGCGAGATGG + Exonic
1018463233 6:164018803-164018825 CTGCTGGAATTTAGGCAAGATGG - Intergenic
1022418636 7:30199467-30199489 CCGTAGGAGTGTAGGCCAGAAGG - Intergenic
1031000237 7:116406833-116406855 GAGTTGCACTGCAGCCAAGATGG + Intronic
1032066083 7:128772358-128772380 CAGTAGCTTTGTAGGCAAGAAGG + Intergenic
1033496930 7:141908646-141908668 CAGTTGGAATGTATGCATGCTGG + Intronic
1034548973 7:151808397-151808419 CAGTTGGACTGTAGGCAAGAAGG + Intronic
1035851023 8:2919362-2919384 CATTTTGACTGAAGGAAAGAAGG - Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1038938227 8:32275863-32275885 AATTTGTACTGTGGGCAAGAAGG - Intronic
1039400963 8:37268911-37268933 CAGGTGGGATGCAGGCAAGATGG + Intergenic
1042275105 8:66996516-66996538 CAGCTGTACGGTAGGCTAGAAGG - Intronic
1043128500 8:76430919-76430941 CAGTTGGATTGTTGCCAAGTTGG + Intergenic
1043565359 8:81541670-81541692 CAGGTTGACTGTCAGCAAGAGGG - Intergenic
1044280477 8:90349656-90349678 CAGTTTGACTGGTGGGAAGAGGG + Intergenic
1047303545 8:123635337-123635359 AAGGCAGACTGTAGGCAAGATGG + Intergenic
1048261487 8:132949152-132949174 CAGGTGGACTGTGGGCAGGATGG + Intronic
1048934195 8:139341804-139341826 CAGGTGGGCTGGAGGCTAGAGGG - Intergenic
1050284815 9:4090251-4090273 CTGTTGGGCTGTAGGCAGGAAGG - Intronic
1051844541 9:21436776-21436798 CAGTTGGTGTGTTTGCAAGATGG + Intronic
1057818269 9:98311679-98311701 CAGTGGGGCTGTGGGCAAGAGGG - Intronic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1191626520 X:63276525-63276547 CAGTTGGACTGCAGATAAGCAGG - Intergenic
1192789835 X:74370647-74370669 CAGTTGGACTCTGAGCAAAAGGG - Intergenic
1193328290 X:80207484-80207506 CAGCTGCACTGTGGGCCAGAAGG + Intergenic
1193511043 X:82400164-82400186 CAGATGGACTGGAAGCCAGAAGG + Intergenic
1195593896 X:106665862-106665884 CATTAGGACTGTGGGAAAGAAGG - Intronic
1196724597 X:118885038-118885060 GAGTTGGACTCCAGCCAAGAGGG + Intergenic
1197245610 X:124163569-124163591 CAGATGGTCTGTGAGCAAGATGG + Intronic
1197494331 X:127159141-127159163 AGGTTGTACTGTAGGAAAGAAGG - Intergenic