ID: 1034549829

View in Genome Browser
Species Human (GRCh38)
Location 7:151813399-151813421
Sequence CTGGTGATTAGGAGTGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034549829_1034549837 26 Left 1034549829 7:151813399-151813421 CCCAGGTCACTCCTAATCACCAG 0: 1
1: 0
2: 1
3: 7
4: 127
Right 1034549837 7:151813448-151813470 TGAAGCAGACAGACAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034549829 Original CRISPR CTGGTGATTAGGAGTGACCT GGG (reversed) Intronic
903235365 1:21947007-21947029 CTTGTGTTCAGGAGTGGCCTTGG - Intergenic
903256320 1:22103715-22103737 AGGGTGACTAGGAGTGACTTTGG + Intergenic
905090194 1:35424605-35424627 CTTGTAGTTAGGAGTGACCATGG + Intergenic
908036470 1:60059625-60059647 CTGGTGAGTTGGAGTTACATGGG - Intronic
912006662 1:104911486-104911508 CTGGTGACCAAGAGTGACCAAGG + Intergenic
918055827 1:181021574-181021596 GTGGTGATCAGTACTGACCTGGG + Intronic
922152845 1:223020213-223020235 CTGATGATGAGGAGTGAGGTGGG + Intergenic
1063365238 10:5486611-5486633 CTGGAGATTAGGAAGGGCCTGGG + Intergenic
1065232707 10:23614878-23614900 CTGGTGATTGGGAGACACATGGG - Intergenic
1068639880 10:59391514-59391536 ATGGTGATTAGGAGAGAGCCTGG + Intergenic
1074299744 10:112223000-112223022 CTGCTGACCAGGAGTGGCCTGGG - Intergenic
1075549848 10:123384050-123384072 CTGGAGCAGAGGAGTGACCTTGG + Intergenic
1077284847 11:1761064-1761086 AGGGTGATTGGGAGTGGCCTCGG - Intronic
1078178428 11:8988566-8988588 CTTGTGATTTGGACTAACCTAGG + Intronic
1078725842 11:13930191-13930213 CTTGTGATTTGGAGTGAACAGGG + Intergenic
1079376700 11:19899356-19899378 CTGGTGATTAGATGTAACCATGG + Intronic
1080243116 11:30150153-30150175 CTGGAGATGACTAGTGACCTTGG + Intergenic
1081308310 11:41540500-41540522 CATGTGATTAGGACTGAACTGGG + Intergenic
1081366841 11:42245329-42245351 CTGATGATTTTAAGTGACCTGGG - Intergenic
1083173075 11:60934378-60934400 CTGGTGATTAGGAGCCGCCGGGG + Intronic
1085707620 11:78800795-78800817 ATAGTGTTTAGGAGAGACCTTGG + Intronic
1093497950 12:19779347-19779369 CTGGTGATGAGCAGGGGCCTTGG + Intergenic
1093960194 12:25264256-25264278 CTATTGATTAGGAGTAGCCTGGG - Intergenic
1094856683 12:34405988-34406010 CAGGGGACTAGGAGTGTCCTTGG + Intergenic
1095233605 12:39771245-39771267 CTGGAGTGTGGGAGTGACCTTGG + Intronic
1096805537 12:54138876-54138898 CTTGTGTCTAGGAGGGACCTGGG - Intergenic
1097009007 12:55939303-55939325 ATGGTGAGTAGGAGAGACTTTGG + Exonic
1097153985 12:56999508-56999530 CTGGTTCTTAGGGGTCACCTGGG + Exonic
1101970128 12:109307212-109307234 CTGGTGAGTTGCAGTGACCCCGG + Intronic
1104664159 12:130635570-130635592 CTGCTGATGTGCAGTGACCTGGG - Intronic
1107996426 13:45865470-45865492 CTGGTGCTGGGGAGTGACTTCGG + Intergenic
1112721773 13:102253880-102253902 CTTGTGATTAGAAGTAAACTGGG + Intronic
1114922139 14:27344906-27344928 TTGGTAATTATGAGTGACTTAGG + Intergenic
1117735246 14:58762395-58762417 ATGCTGCTTTGGAGTGACCTTGG + Intergenic
1117786708 14:59293329-59293351 CTGGAGAATAGTAATGACCTCGG + Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1125663721 15:41414420-41414442 CTGGTGATTCGGGGTCACCTTGG + Intronic
1136687535 16:32003973-32003995 CAGGTGATTAGAAGAGACATGGG - Intergenic
1136788145 16:32947524-32947546 CAGGTGATTAGAAGAGACATGGG - Intergenic
1140765969 16:78157394-78157416 CTGGTGATAAGGGGTGACATTGG + Intronic
1144079735 17:11752981-11753003 CAGGTGATTAGAAATGATCTAGG - Intronic
1147148515 17:38499642-38499664 CGGGTGATTAGAAGAGACATGGG - Intronic
1147221834 17:38938553-38938575 CTGGTGAGTAGGAATGTACTTGG - Exonic
1147740131 17:42666548-42666570 CAGGGGGTTAGGAGTGAACTTGG - Intronic
1149218994 17:54392969-54392991 CTGGTGATTAAGGCTGAACTTGG - Intergenic
1150568998 17:66369372-66369394 CTGGGGAGGAGGAGGGACCTGGG + Intronic
1151957266 17:77386628-77386650 CTGTTGATGAGGTGTGGCCTGGG + Intronic
1158482337 18:57832806-57832828 GTGGTGATAGGAAGTGACCTAGG - Intergenic
1160087712 18:75793959-75793981 CGGGTGATCAGGAGAGACATCGG - Intergenic
1160685125 19:431037-431059 CTGGTGAATAGGAGCTGCCTGGG - Intronic
1162013430 19:7831039-7831061 GTGGTGTTTAGGGGTGCCCTTGG - Intronic
1163586675 19:18168188-18168210 CTGGTGATGATGAGGGGCCTGGG + Intronic
1163901267 19:20102307-20102329 CAGGTGAGTAGGAGTGACTCAGG - Intronic
1163952525 19:20603210-20603232 CTGGTGAATTGGAATCACCTTGG + Intronic
1166759226 19:45214007-45214029 CTTGAGATTAGGAGGTACCTAGG - Intronic
1168169002 19:54574132-54574154 CTAGTGAGGAGGAGGGACCTGGG - Intronic
1168173686 19:54607926-54607948 CCGGTGAGGAGGAGGGACCTGGG - Intronic
928048145 2:27959562-27959584 CTGCTGTGTTGGAGTGACCTTGG + Intronic
928671547 2:33608235-33608257 CTACTGATTAGGAGTGTACTGGG + Intergenic
928937605 2:36695721-36695743 GTGTTGATTAGGAGTAACTTTGG - Intergenic
929698423 2:44140491-44140513 CTGTTGTTTAGGAGGGAACTTGG + Intergenic
931213748 2:60222498-60222520 CTGTTGACTAGGAGTGCCCATGG - Intergenic
932695303 2:73951323-73951345 CTGCTGACTGGTAGTGACCTTGG + Intronic
934847794 2:97673526-97673548 TCGGTGAACAGGAGTGACCTTGG + Intergenic
942200900 2:173570017-173570039 CTGGTGATTAGGACAGACTAGGG + Intergenic
947569199 2:231218028-231218050 CTGTTGAGTGAGAGTGACCTGGG - Intronic
1168926043 20:1579829-1579851 GTGGTGACTAGGGGTGAACTTGG + Intronic
1173137263 20:40449608-40449630 CTGGTGATTTGAAGTGAACAGGG - Intergenic
1175731258 20:61355374-61355396 TTGGTTCTTAGCAGTGACCTCGG + Intronic
1179236713 21:39553982-39554004 CTGTGGATATGGAGTGACCTGGG - Intergenic
1179826285 21:43968236-43968258 GTGGTGACTGGGAGTGAGCTGGG + Intronic
1179899578 21:44382396-44382418 CAGGTGGTGAGGAGTGGCCTGGG + Intronic
1180978613 22:19867591-19867613 CTGCTGGTAAGGAGTGATCTTGG + Intergenic
1182668160 22:31973793-31973815 CTGGAAATTAGAGGTGACCTGGG + Intergenic
950575330 3:13828785-13828807 CAGGTTATAAGCAGTGACCTGGG + Intronic
952214730 3:31266735-31266757 GTGTTGATTAGGAGGGGCCTGGG - Intergenic
953391105 3:42534264-42534286 CTGGTGATCAGGTATGAACTTGG + Intronic
954668631 3:52275420-52275442 CTGGTAGTTAGGAGGGAACTGGG - Intronic
954708166 3:52492075-52492097 CTGGTGAGCAGGAGTGTCTTGGG - Exonic
955118497 3:56031153-56031175 GTGGTCATTAGGGCTGACCTGGG - Intronic
958613946 3:96466429-96466451 CTGTGGATTAGCAGTGACCTGGG + Intergenic
959143767 3:102519216-102519238 CTGGCAAGTTGGAGTGACCTGGG - Intergenic
963168589 3:142229114-142229136 CTGTTGAGTAGGAGAGGCCTGGG + Intergenic
967188510 3:186965610-186965632 CTGGTGATTACCAGTGACTGAGG + Intronic
967522708 3:190453239-190453261 CTGCTGATTATTAGTGACCAAGG - Intergenic
968898238 4:3417609-3417631 CTGGTGGTTGGCGGTGACCTTGG + Intronic
971175524 4:24278898-24278920 CTGGTGAGTAAGAGTGACCTAGG - Intergenic
971862710 4:32128655-32128677 TAGGTGATCTGGAGTGACCTAGG - Intergenic
972678691 4:41285082-41285104 TTGGTGATTAGGGGTGACTTTGG + Intergenic
974449329 4:62031472-62031494 CTGCCTATTAGGATTGACCTGGG + Exonic
975577532 4:75877487-75877509 CCAGTGTTTAGGACTGACCTGGG - Intronic
976439533 4:85057343-85057365 CTGGTCATTTGGGGTGATCTAGG + Intergenic
976536361 4:86222409-86222431 CTGGGGAAGAGGAGTAACCTTGG - Intronic
977797050 4:101178930-101178952 CTGCTGACTAAGAGTGACCAGGG - Intronic
978457183 4:108907107-108907129 CTAGTGATTCGGACTGAACTGGG - Intronic
978642648 4:110889706-110889728 ATGGTGATCAGGAGAGATCTGGG + Intergenic
979081946 4:116356232-116356254 ATGTTGATAAGGAGTGACCTTGG + Intergenic
983519453 4:168691812-168691834 CTGATAATTAAGAGTGATCTGGG - Intronic
983644319 4:169974238-169974260 CTGCTGATGAGGTCTGACCTAGG - Intergenic
983890929 4:173029244-173029266 CTGGCAATTAGGACTGACCTGGG - Intronic
988471504 5:31543852-31543874 CTGGTGATGAGGAGCTAACTGGG - Intronic
992249999 5:74866654-74866676 CTGGTATTAAAGAGTGACCTTGG + Intronic
998468197 5:142362886-142362908 CTGGAGACTAGAGGTGACCTTGG - Intergenic
999006000 5:147979959-147979981 CTCCTGATTGGGTGTGACCTAGG + Intergenic
999303262 5:150503988-150504010 CTGGACACTGGGAGTGACCTCGG + Intronic
1000711439 5:164584868-164584890 CTTGTGATTCACAGTGACCTTGG + Intergenic
1000785752 5:165541311-165541333 CTCGTTACTAGCAGTGACCTAGG - Intergenic
1011218573 6:85031160-85031182 CTGGAGAATAGCAGTGACCATGG - Intergenic
1011972775 6:93248459-93248481 CTAGTGATTAGGAGAGAGTTTGG - Intronic
1015916210 6:138219612-138219634 CTGGTGACTGGCAGTGACATGGG + Intronic
1017941276 6:159055431-159055453 CTGGGGTCTAGGAGTGACCAAGG + Intergenic
1019740116 7:2668585-2668607 CTGGTGACCATGAGTCACCTGGG + Intergenic
1024367503 7:48537768-48537790 CAGGTGATCAGGAGTGACTCAGG + Intronic
1026035225 7:66825613-66825635 CTGTGGACTAGGAGTGACCATGG + Intergenic
1026984309 7:74545472-74545494 CTGTGGACTAGGAGTGACCATGG - Intronic
1028280542 7:88921322-88921344 CAGGTGAATAGGAGGGACCTGGG + Intronic
1030470450 7:109956686-109956708 CTGGAGAGTAGTCGTGACCTTGG - Intergenic
1033834008 7:145286531-145286553 CTGGAGATTAGGGATGATCTGGG - Intergenic
1034149750 7:148905613-148905635 CTGGTGCTCAGGAGCAACCTAGG - Intergenic
1034549829 7:151813399-151813421 CTGGTGATTAGGAGTGACCTGGG - Intronic
1039048175 8:33468902-33468924 CTGGTAATTGGGAGTCAACTGGG + Intronic
1040022651 8:42754664-42754686 CTGGTGTCTAGGTTTGACCTCGG - Intronic
1041296113 8:56359002-56359024 CTGGTGAAGAGCAGCGACCTAGG + Intergenic
1042694897 8:71546050-71546072 CAGGTGAGCAGGAGAGACCTAGG - Intronic
1043461820 8:80468029-80468051 AGGATGATTAGGAGTGAACTAGG - Intergenic
1043598398 8:81911559-81911581 CAGGTGACCAGGAGTGACTTAGG + Intergenic
1046651338 8:116839569-116839591 CTGGTGTGTAGGAATGACTTCGG - Intronic
1047226463 8:122959199-122959221 CTGATGATTAGGGATGACTTTGG + Intronic
1047335868 8:123935619-123935641 CTGGTGATCAGGAGACACATGGG + Intronic
1052772981 9:32706422-32706444 CTAGTGATAAGGAGTGGCATAGG - Intergenic
1053455826 9:38232583-38232605 CTGGGGATTTAGAGTGATCTTGG - Intergenic
1057838780 9:98468228-98468250 CTGGTGCTAATGAGTGAGCTGGG + Intronic
1062261193 9:135664003-135664025 CTGGTGACGAGGGGAGACCTGGG + Intronic
1189094861 X:38127363-38127385 ATGTTGATTAGAATTGACCTGGG + Exonic
1189674942 X:43452193-43452215 CAGGTGACTAGGAGTGACTCAGG - Intergenic
1190734871 X:53249722-53249744 CAGGTGTTTAGGAGTGAGGTGGG - Intronic