ID: 1034550494

View in Genome Browser
Species Human (GRCh38)
Location 7:151817516-151817538
Sequence GACAGCCTTGGGAAGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034550494_1034550504 9 Left 1034550494 7:151817516-151817538 CCCCCAGGCTTCCCAAGGCTGTC 0: 1
1: 0
2: 1
3: 38
4: 262
Right 1034550504 7:151817548-151817570 GACCCTTGGGCCCCGCATGCAGG 0: 1
1: 0
2: 0
3: 8
4: 76
1034550494_1034550502 -4 Left 1034550494 7:151817516-151817538 CCCCCAGGCTTCCCAAGGCTGTC 0: 1
1: 0
2: 1
3: 38
4: 262
Right 1034550502 7:151817535-151817557 TGTCAGGCCTCATGACCCTTGGG No data
1034550494_1034550501 -5 Left 1034550494 7:151817516-151817538 CCCCCAGGCTTCCCAAGGCTGTC 0: 1
1: 0
2: 1
3: 38
4: 262
Right 1034550501 7:151817534-151817556 CTGTCAGGCCTCATGACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034550494 Original CRISPR GACAGCCTTGGGAAGCCTGG GGG (reversed) Intronic
900305380 1:2004063-2004085 GACAGACTTGGGGGGCCTGGAGG + Intergenic
900368491 1:2321104-2321126 CAGAGCCCTGGGAAGCCTGTGGG - Intergenic
900376382 1:2356660-2356682 GACAGCGTTGGGAGGCCCTGGGG - Intronic
900782577 1:4627670-4627692 AGCAGCCCTGGGCAGCCTGGTGG - Intergenic
901037109 1:6343050-6343072 GCCCGCCCTGGGAAGCCTGAGGG - Intronic
901229586 1:7634356-7634378 GGCAGCTGTGGGAAGCCTGGAGG + Intronic
901872709 1:12147449-12147471 AAAAACCCTGGGAAGCCTGGAGG + Intergenic
902683168 1:18058165-18058187 GGCAGCCTTGGGAGGCAAGGAGG + Intergenic
902767042 1:18623855-18623877 TACTGCCTTGGGAGTCCTGGTGG - Intergenic
902820690 1:18941510-18941532 GACTGCCTTGCGAGGCCTTGTGG - Intronic
905037559 1:34928061-34928083 AACAGCCTTGGGAAGCAGGCAGG - Intronic
905911666 1:41659210-41659232 GACAGCCTTGCAAAGCTTTGGGG - Intronic
906155482 1:43611737-43611759 GACAGACTTGGGAAACGTGAAGG + Intronic
906273738 1:44501026-44501048 CACAGCCTTCTGCAGCCTGGAGG - Intronic
907324212 1:53626319-53626341 GACAGACTTGGCAAGACCGGAGG - Intronic
907937420 1:59055224-59055246 GTCAGCCATGTGAAGACTGGAGG + Intergenic
914259107 1:145983950-145983972 GACTGCTTTGGGAGTCCTGGGGG + Intergenic
915166626 1:153951589-153951611 GACTGCTCAGGGAAGCCTGGAGG + Exonic
917171123 1:172175997-172176019 GACACCCTTGGGAGGGTTGGAGG - Intronic
918927712 1:190809474-190809496 GACAGCCTTGGTTACCCTGGGGG + Intergenic
921414571 1:214871209-214871231 GACAACCTTGGAAATCATGGAGG + Intergenic
921607482 1:217172903-217172925 GAAAGCCTTGGACAGGCTGGTGG - Intergenic
921997683 1:221439252-221439274 GACAGCATGGGGAAGCTTTGGGG + Intergenic
922452764 1:225750289-225750311 GAAAGCCTCTGGAAGCATGGGGG + Intergenic
923108830 1:230875023-230875045 GGCATCCCTGGGAGGCCTGGGGG + Intergenic
1062795169 10:339518-339540 GCCAGGCTTGGTAAGCCTGCAGG + Intronic
1062975569 10:1680042-1680064 AACAGGCTGGGGAGGCCTGGGGG - Intronic
1066702685 10:38146725-38146747 GTCAGCCTTGTGGAGCCTGTGGG - Intergenic
1067111745 10:43406266-43406288 CAGAACCTTGGAAAGCCTGGAGG - Intronic
1067223603 10:44361461-44361483 GACAGCCCTGGACTGCCTGGAGG - Intergenic
1067382089 10:45783937-45783959 GACAGCCATAGGAAGGCTTGTGG + Intronic
1067848599 10:49741032-49741054 GGCAGGCTGGGGAGGCCTGGTGG - Intronic
1067889785 10:50124579-50124601 GACAGCCATAGGAAGGCTTGTGG + Intronic
1068606983 10:59016365-59016387 GACAGCCCAGGGAAGCCTCAGGG - Intergenic
1070693766 10:78546705-78546727 CACAGCCTTGGGGAGCTGGGTGG + Intergenic
1070919669 10:80176685-80176707 GGCAGCCTTGGTAACCCTGGAGG + Intronic
1073070895 10:100792634-100792656 GGACGCCTTGGGAAGCCAGGAGG + Intronic
1073441542 10:103555458-103555480 GACCGCCTGGGGAGGCCGGGCGG + Intronic
1076289601 10:129334898-129334920 GACAGGCTCAGGAAGGCTGGTGG - Intergenic
1077108867 11:853412-853434 GACGGCCTGGGGCAGCCTGGGGG + Intronic
1077151816 11:1076186-1076208 GACAGACTTGGCACCCCTGGAGG + Intergenic
1077217762 11:1402154-1402176 AGCAGCCTGGGGAAGGCTGGGGG + Intronic
1077472416 11:2770239-2770261 GACCGCCCTGTGAAGTCTGGAGG - Intronic
1080603560 11:33844581-33844603 GACACCCTTGGCAAGGCTGTTGG + Intergenic
1081627754 11:44665732-44665754 GACAGCCTTGGGAAGGCTACCGG + Intergenic
1081963112 11:47152814-47152836 GAAAGCCTTGGGCTCCCTGGTGG + Intronic
1082961669 11:58923723-58923745 GACAGCCTTGAGGAGCCTCCTGG - Intronic
1083173990 11:60938127-60938149 GGCATCCAGGGGAAGCCTGGAGG - Intronic
1083673901 11:64314994-64315016 GACAGCGATGAGAAGCCTAGGGG - Exonic
1083882371 11:65554951-65554973 GAGAGCCCTGGAAAGGCTGGGGG - Intronic
1084386043 11:68843271-68843293 TGCAGCCTTGGGAAGGCCGGTGG - Intronic
1085282782 11:75341811-75341833 GACATGCTTGGGGAGCCAGGTGG + Intronic
1085454871 11:76660122-76660144 GGGGGCCTTGGGAGGCCTGGAGG - Exonic
1088691570 11:112333023-112333045 ATCAGCCCTGGGCAGCCTGGGGG - Intergenic
1089276044 11:117336644-117336666 GGCAGCCGTGGAAAGGCTGGAGG - Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1089808947 11:121115592-121115614 GGCAGCCCTGGGAGGCCTCGGGG + Intronic
1091112815 11:132986158-132986180 GAAAGCTATGGGAAGACTGGAGG - Intronic
1091407946 12:220702-220724 GAGACCCTTGGGAAGCTGGGTGG - Exonic
1091529450 12:1340152-1340174 GATAGCCTTGGGTACCCCGGAGG - Intronic
1093241485 12:16682203-16682225 GACAACCTAGGGATGCCTAGGGG + Intergenic
1096199733 12:49673085-49673107 GACAGCCATAGGAAACCTGGTGG - Intronic
1096489421 12:52005813-52005835 AACAGATTTGGGAAGACTGGGGG + Intergenic
1097247917 12:57616798-57616820 GAGAGTCATGGGGAGCCTGGGGG - Exonic
1099076658 12:78118111-78118133 GACAGCCATGGGGATGCTGGTGG + Exonic
1099732815 12:86526543-86526565 GGCAGCCTTGGGTTCCCTGGGGG - Intronic
1101134832 12:101732433-101732455 GACATCCTTAGGTATCCTGGGGG + Intronic
1105833206 13:24184054-24184076 GACAGTCTTGAGAAGTGTGGAGG + Intronic
1106514338 13:30440125-30440147 GACAGTCCTGGAAAGCCAGGAGG - Intergenic
1107719087 13:43229365-43229387 GTCAGCCATGGAAAGCCCGGGGG + Intronic
1109252302 13:60033485-60033507 GTCGGCCTTAGGAAGCTTGGTGG + Intronic
1109559255 13:64025374-64025396 GTCAGCCTTGGGTAGTGTGGTGG - Intergenic
1109667092 13:65553513-65553535 GGCAGCCTTGGGTGTCCTGGGGG - Intergenic
1113462523 13:110492063-110492085 GTCAGCCCTGGAAAGCCTGGGGG - Exonic
1113906287 13:113820801-113820823 GACAGCCGGGAGGAGCCTGGGGG - Exonic
1113940370 13:114015759-114015781 GACAGCCTGGGGAGGCAGGGAGG + Intronic
1114043768 14:18703551-18703573 GAGAGCATCGGAAAGCCTGGTGG - Intergenic
1114048055 14:18893993-18894015 GAGAGCATCGGAAAGCCTGGTGG - Intergenic
1114114464 14:19507650-19507672 GAGAGCATCGGAAAGCCTGGTGG + Intergenic
1114116160 14:19625413-19625435 GAGAGCATCGGAAAGCCTGGTGG + Intergenic
1116788002 14:49309273-49309295 GACAGACTGGGGGATCCTGGAGG - Intergenic
1118317011 14:64731654-64731676 GACAGCCTGGGGAAGCAGGGAGG - Intronic
1118478540 14:66141410-66141432 GGCAGCCTTGGGTGCCCTGGGGG + Intergenic
1119666913 14:76491440-76491462 GAGAGGCTTGAGAAGCCTGCAGG - Exonic
1119704822 14:76776966-76776988 GACAGCCCTGGGAGGCCAGCGGG + Intronic
1121406674 14:93723212-93723234 GGCACCCCTGGGAACCCTGGAGG - Intronic
1121469909 14:94144722-94144744 GGCAACCTCGGGGAGCCTGGGGG + Intergenic
1123801887 15:23830078-23830100 GACAGCCTTCTGCAGCCTGCAGG - Intergenic
1125197723 15:37067462-37067484 GACAGCTTTAGGAGGCCTGGAGG - Intronic
1127098261 15:55535284-55535306 AACAGCCTTGGGTGTCCTGGGGG + Intergenic
1127529542 15:59830119-59830141 GGCAGCCTTCAGAACCCTGGTGG - Intergenic
1129826418 15:78637823-78637845 GAGAGCCCAGGGCAGCCTGGGGG - Intronic
1131035119 15:89217077-89217099 GACGGCCCTGGGAAGACGGGAGG - Intronic
1132539750 16:503215-503237 GACAGTCTGGGGAGCCCTGGAGG - Intronic
1134357280 16:13494250-13494272 GACAGACTTCTGAAGCCTGCTGG - Intergenic
1134836362 16:17364491-17364513 CTCAGCCTTTGTAAGCCTGGAGG - Intronic
1137033673 16:35548604-35548626 GACGGCCTGGGGAAGGATGGTGG + Intergenic
1138416903 16:56876755-56876777 AACAGCCCAGGGAAGGCTGGGGG + Intronic
1138478740 16:57287555-57287577 GCTAGCCTTGGGAATTCTGGGGG + Intergenic
1140778374 16:78271744-78271766 GAGGGCGTTGGGAGGCCTGGCGG + Intronic
1141141065 16:81497156-81497178 GACAGCCTTGCATAGCCCGGGGG + Intronic
1141436859 16:84004575-84004597 GACAGCATAGGGGAGCATGGAGG - Intergenic
1141514440 16:84534479-84534501 GACAGCCTTTTGTAGCCTGTTGG - Intronic
1141620521 16:85234778-85234800 GGCAGCCTTGGGAATGCTGGCGG + Intergenic
1142171431 16:88624691-88624713 GAGACCCTCGGGAAGCCAGGAGG + Exonic
1142212693 16:88816019-88816041 GACACGCGTGTGAAGCCTGGGGG - Intronic
1142224514 16:88871098-88871120 CACAGCCATGTGCAGCCTGGTGG - Intergenic
1142848809 17:2694625-2694647 GACAGCGTTGGGGAGCTGGGTGG - Intronic
1143814357 17:9499798-9499820 CTCACCCTTGGGAAGCCTGCTGG - Intronic
1144583477 17:16473650-16473672 GACAGGCTGGGCAAGTCTGGTGG - Intronic
1145825796 17:27876489-27876511 GACAGACGTGGGTTGCCTGGAGG - Intronic
1145888585 17:28399172-28399194 GCCAGCCTTGGGAAGGAGGGAGG - Exonic
1146612840 17:34322959-34322981 GACACCCAGGAGAAGCCTGGGGG - Intergenic
1147155217 17:38541370-38541392 GAGGGGCTTGGGAAGGCTGGGGG + Intronic
1147440916 17:40446781-40446803 GAGAGACGAGGGAAGCCTGGAGG + Intronic
1148085201 17:44989708-44989730 GACATCACTGGAAAGCCTGGGGG - Intergenic
1148136339 17:45294336-45294358 GACCTCCTGGAGAAGCCTGGGGG + Intronic
1151601584 17:75109465-75109487 GCCAGCCGTGGGGACCCTGGAGG + Intergenic
1151679712 17:75616867-75616889 GAAAGCTTTGGGAGGCCTCGTGG - Intergenic
1152568586 17:81111376-81111398 GACAGCCTTGTGGGGACTGGAGG + Intronic
1153648171 18:7214056-7214078 AAGAGCCTGGGGAAGCCTGGAGG - Intergenic
1155187311 18:23398492-23398514 GACAGCCAGGGCAAGCCTCGTGG + Intronic
1155453403 18:25986398-25986420 GACAGCATTTAGAAGCCAGGAGG - Intergenic
1156455697 18:37292466-37292488 TTCAGCCTTGGGAAGACTGTGGG + Intronic
1159479724 18:68973420-68973442 GACAGCTTTGGGAATGCTGTGGG - Intronic
1161482097 19:4516439-4516461 GACAGCCTGGGGATCCCAGGCGG - Intronic
1162392053 19:10395738-10395760 GACAGGCTTGGGGGGCCGGGCGG - Intronic
1163469341 19:17487490-17487512 GGCAGCCTTGGGCAGCCCGGTGG - Exonic
1163583351 19:18151280-18151302 GCCAGCCTTGAGAAGGCTGGAGG + Exonic
1164526752 19:29018676-29018698 GACAGCCTTGGGAAGGCACAGGG + Intergenic
1165529512 19:36386371-36386393 GGATGCCTTGGGTAGCCTGGGGG + Intronic
1166361005 19:42253083-42253105 GACAGACTATGCAAGCCTGGGGG + Intronic
1167322552 19:48805848-48805870 GACAGCCAGGGGAGGCATGGTGG - Intronic
1167533151 19:50031563-50031585 GACTGCCTAGGGAAGGGTGGGGG - Intronic
1168310322 19:55456693-55456715 GACTTCCTTGGGAAGCCTTCTGG + Intronic
1202663845 1_KI270708v1_random:98368-98390 TACAGGGTTGGGAGGCCTGGAGG + Intergenic
925416420 2:3673028-3673050 TCCAGCCATGGGTAGCCTGGGGG + Intronic
926249797 2:11148081-11148103 GAGAGCCATAGCAAGCCTGGAGG + Intergenic
927111895 2:19869447-19869469 GCCAGCCTGGAGGAGCCTGGGGG - Intergenic
927778922 2:25923881-25923903 TACAGCCTTGGGACTCTTGGAGG + Intergenic
927845913 2:26472910-26472932 GACAGCCTGGGGGGGCCTGAGGG - Intronic
929681189 2:43995472-43995494 GACTGCTTTGGGAAGTCGGGTGG - Intronic
929892258 2:45928097-45928119 TACAGCCTAGGAAAGCTTGGAGG - Intronic
931575081 2:63710274-63710296 GCCAACCTTGGGCACCCTGGTGG - Intronic
932131476 2:69191437-69191459 GACAGTGCTGGGAAGGCTGGAGG - Intronic
932414168 2:71563889-71563911 GCCAGCCCTGGGAGGTCTGGGGG + Intronic
934562612 2:95320922-95320944 GAGGGCCTAGGGAAGGCTGGGGG - Intronic
937216911 2:120318722-120318744 GACAGGCTTGACAGGCCTGGGGG + Intergenic
937862342 2:126720861-126720883 CACAGCCTGGGGAAGTCTGGAGG + Intergenic
938425428 2:131182513-131182535 GAGAGCATCGGAAAGCCTGGTGG - Intronic
939702678 2:145413252-145413274 TGCAGCCTTGGGAGGCATGGAGG - Intergenic
946415246 2:219536924-219536946 CACAGCCTTGGGGAGTCCGGGGG + Intronic
947540413 2:230973609-230973631 GACTGCCCTAGGTAGCCTGGGGG + Intergenic
947974645 2:234355233-234355255 GACAGCCTGGGGCCGGCTGGCGG + Intergenic
948177589 2:235956406-235956428 GAAAGCCTGGGGAAGCCGTGGGG - Intronic
948674920 2:239591628-239591650 GACGGCAGTGGGAAGCCTGTCGG + Intergenic
1171196857 20:23206582-23206604 GTCAGCCTTGGCAAGGCAGGAGG - Intergenic
1171356351 20:24548372-24548394 GAAGGCCTTGGAAAGCTTGGCGG - Intronic
1171878153 20:30597583-30597605 CACAGCCTGGAGCAGCCTGGGGG - Intergenic
1172372745 20:34407709-34407731 GCCAGCCATGGGAAGACTGGAGG - Intronic
1172801787 20:37581173-37581195 CCCAGCCTTGGGGAGACTGGGGG + Intergenic
1174066181 20:47867582-47867604 GACAGCCCTGGGAAGGGAGGGGG - Intergenic
1174870696 20:54178520-54178542 GAAATCGTTGGGAATCCTGGAGG + Intergenic
1175186467 20:57182349-57182371 GACAGCCTCTGGTGGCCTGGGGG - Intronic
1175215354 20:57389507-57389529 GACAGCCTTGGAAAAACTGAAGG + Intergenic
1175778727 20:61668959-61668981 GACAACCCTGGGAAGCCAGTGGG + Intronic
1175802371 20:61808134-61808156 CACAGCCTGGGGAAGGCTGCGGG + Intronic
1175931775 20:62496960-62496982 GACGGCCTCGGGGAGGCTGGCGG + Intergenic
1176388149 21:6149947-6149969 GACAGACTTGGGAAACCAGGAGG - Intergenic
1179183153 21:39062192-39062214 TAGAGCCTGGGGAAGCCTGCAGG + Intergenic
1179343289 21:40532729-40532751 GAGAGCCTGGGGTAACCTGGGGG + Intronic
1179735323 21:43388301-43388323 GACAGACTTGGGAAACCAGGAGG + Intergenic
1179994071 21:44965963-44965985 CACAGCCTTGGGAATCACGGGGG - Intronic
1180126263 21:45792289-45792311 GGCAGCCTTGGGATGCCAGGAGG + Intronic
1180466590 22:15616669-15616691 GAGAGCATCGGAAAGCCTGGTGG - Intergenic
1181965776 22:26655930-26655952 CAGAACTTTGGGAAGCCTGGGGG - Intergenic
1181993084 22:26852513-26852535 GACATTCTTGAGAAGCTTGGAGG + Intergenic
1182214421 22:28703889-28703911 GACAGCCTAAGGAACCCTGAGGG + Intronic
1183869395 22:40729706-40729728 GACAACCTTGGGAGGCATGGTGG + Intergenic
1184773081 22:46609387-46609409 GAGAGTCTTGGTAGGCCTGGCGG + Intronic
1185042691 22:48513555-48513577 TTCAGCCTTGGGAAGCCTCCGGG - Intronic
1185095350 22:48803368-48803390 ACCAGCCTTTGGATGCCTGGAGG - Intronic
1185340363 22:50288223-50288245 GGGAGCCCAGGGAAGCCTGGAGG + Intronic
949635457 3:5976922-5976944 CACAGGCCTGGGGAGCCTGGGGG + Intergenic
950526001 3:13523645-13523667 GAGAGCCTTGGGATTCCTGGGGG - Intergenic
950639464 3:14339551-14339573 GGCAGCCTAGGGAAGCCAGGGGG + Intergenic
950772506 3:15323537-15323559 TACATCCCTGGGTAGCCTGGAGG - Intronic
950893615 3:16427767-16427789 GGCAGGCATGAGAAGCCTGGAGG - Intronic
950935599 3:16835780-16835802 AACAGCCGTGTGAGGCCTGGTGG - Intronic
954875868 3:53802885-53802907 GGCAGCCTTTGGAAACATGGTGG + Intronic
956526343 3:70166576-70166598 GACACTCTTGGGCAGCCTGAAGG - Intergenic
958768814 3:98402250-98402272 GACAGTCTTGGGTACACTGGGGG + Intergenic
961453667 3:127013957-127013979 GTGAGGCTTGGGAGGCCTGGAGG + Intronic
961677751 3:128577910-128577932 GAAAGCCTTGACAGGCCTGGAGG + Intergenic
961740786 3:129032056-129032078 GTCAGCATCAGGAAGCCTGGGGG - Intronic
962335634 3:134527745-134527767 GGCAGCCTTGGGTGGCCTGGGGG - Intronic
962415616 3:135178845-135178867 CACAGCCTTGGGAAGAGTAGGGG - Intronic
965747221 3:171938078-171938100 GCCTGCCCTGGGAAGCCTGGTGG + Intronic
966852316 3:184171657-184171679 GACATCCTTGGGAAGCCCTGAGG - Exonic
966853309 3:184177504-184177526 GAGAGGATTGGGCAGCCTGGAGG - Intronic
966933846 3:184692728-184692750 TAGAGCCTTGGGAAGGCTTGGGG + Intergenic
967124474 3:186411805-186411827 CTCAGGCCTGGGAAGCCTGGTGG - Intergenic
968547260 4:1205634-1205656 GGCAGCCTTGGGAAGGGTGGGGG + Intronic
968758039 4:2426937-2426959 CACAGCCCTGGGGCGCCTGGGGG - Intronic
969065862 4:4480390-4480412 GACAGGATTGGGAAGCAGGGAGG - Intronic
969306160 4:6327390-6327412 GTCAGCCTGGGGATGCTTGGCGG + Intronic
969698218 4:8747965-8747987 CAAAGCCTCGGGCAGCCTGGGGG + Intergenic
969890210 4:10253131-10253153 GACAGCCTTGGAAGCCTTGGTGG - Intergenic
970159688 4:13176197-13176219 GAAAGCATTGGGAAGCTCGGAGG + Intergenic
970445525 4:16120736-16120758 GACAGCTATGGGCAGCCTTGAGG - Intergenic
970546180 4:17132798-17132820 GACACCCTTGGGATCCCTGGCGG + Intergenic
974663015 4:64919701-64919723 GGCAGTCTTGGGCACCCTGGGGG + Intergenic
975174427 4:71271010-71271032 GACAGCCTAGGTAAGCATGGTGG + Intronic
976217809 4:82731316-82731338 GACAGCCTTGGGGAGCCCATCGG + Intronic
979692397 4:123573931-123573953 GACAGCCTTTTGAGGACTGGAGG - Intergenic
980088671 4:128418296-128418318 GGCAGGCTTGGGAAGCAGGGAGG + Intergenic
980405503 4:132350053-132350075 GGAAGCCTTGGGAAGCCTGAAGG + Intergenic
982737768 4:159023915-159023937 AACAGCCCTGGGAAACCTCGTGG - Intronic
985721737 5:1493148-1493170 GGCTGGCTGGGGAAGCCTGGAGG - Intronic
987237347 5:15956275-15956297 GACAACCATGGGCAGCTTGGTGG - Intergenic
988643585 5:33068913-33068935 GACAGCCTTGGGAAATGGGGTGG + Intergenic
991665268 5:68993390-68993412 GACAGGCTTGGAAAGCCAAGGGG - Intergenic
992794069 5:80239742-80239764 TACAGCCTTGAGAAGCCAGCAGG + Intronic
993567348 5:89491510-89491532 GACATCCTTGGGGATCTTGGGGG + Intergenic
993807127 5:92424804-92424826 GACATCCTTGGGAACCCTTAAGG - Intergenic
997232477 5:132254730-132254752 GACACCCTTGGGAATGCTGTTGG - Intronic
999296644 5:150463696-150463718 CACAGCCCTGGGAACCCTGCAGG - Intergenic
1001416991 5:171552230-171552252 GAAAGACTTGTGGAGCCTGGTGG - Intergenic
1002068135 5:176662727-176662749 AACAGCCTTGGCAGGGCTGGGGG - Intergenic
1002102237 5:176863294-176863316 CACAGCCCAGGAAAGCCTGGAGG + Intronic
1003566863 6:7229689-7229711 TACAGCCCGGGGAAGCCTGCTGG - Exonic
1005995031 6:30925747-30925769 GGCAGGCTTGGGAAGCATGCTGG + Intronic
1006984902 6:38169668-38169690 GACAGCCTTGGGGAGGCTGAGGG + Exonic
1007112704 6:39322276-39322298 GAGAGGCTTGGGAAGGTTGGTGG - Intronic
1008490018 6:52076982-52077004 GAGAGCCTGAGAAAGCCTGGCGG + Intronic
1009373314 6:62936375-62936397 GACAACATTGGCAAGCCTAGTGG - Intergenic
1011646045 6:89458974-89458996 GACAACCTTGGGCAGTGTGGAGG + Intronic
1011935040 6:92766187-92766209 GAATGCCTTGGTAAACCTGGGGG - Intergenic
1012963524 6:105647794-105647816 GACAGCCTGGGTAAGGGTGGGGG - Intergenic
1015606008 6:134955310-134955332 CACAGAGTTAGGAAGCCTGGAGG - Intergenic
1016846011 6:148569355-148569377 TAGAGACTTGGGGAGCCTGGTGG + Intergenic
1017027885 6:150197559-150197581 GGCTGCCGTGGGAAGGCTGGTGG + Intronic
1017776366 6:157684139-157684161 GGGTGCCTTGAGAAGCCTGGGGG - Intergenic
1018929792 6:168233590-168233612 GACAGACCTGGGGACCCTGGGGG + Intergenic
1018945640 6:168345690-168345712 GGCAGCCGAGGGAAGCTTGGGGG + Intergenic
1018945712 6:168345849-168345871 GACAGCCGGGGGAAGCCGGGGGG + Intergenic
1018945733 6:168345891-168345913 GACAGCCGGGGGAAGCCGGGGGG + Intergenic
1018945757 6:168345944-168345966 GACAGCCGGGGGAAGCCGGGGGG + Intergenic
1018945778 6:168345986-168346008 GACAGCTGGGGGAAGCCGGGGGG + Intergenic
1019310296 7:357189-357211 GGCAGCCCTGGGAAGCCGGTGGG + Intergenic
1019541772 7:1554864-1554886 GACACCCTGGAGAAGGCTGGTGG - Intronic
1020116325 7:5478414-5478436 GGCCACCTTCGGAAGCCTGGTGG + Intronic
1022103438 7:27182545-27182567 GACAGGTTTGGGACCCCTGGTGG - Exonic
1022473839 7:30697833-30697855 GACAGGATGGGGGAGCCTGGTGG - Intronic
1023241371 7:38151299-38151321 GGCAGTCTTGGGTACCCTGGAGG + Intergenic
1023977223 7:45039462-45039484 GACAGACGTCGGATGCCTGGCGG - Intronic
1024971974 7:55079070-55079092 GACAGCCTTCAGGAGCCAGGAGG + Intronic
1025604402 7:63029066-63029088 CACAGCCTGGGGAAGCCCCGAGG + Intergenic
1028186470 7:87791666-87791688 GACAGAATTTGGAAGCCTGATGG + Intronic
1029931124 7:104372199-104372221 TCCAGCCTTGCGCAGCCTGGAGG + Intronic
1032475715 7:132210323-132210345 GACAGCTGTCGGCAGCCTGGGGG + Intronic
1033545974 7:142400474-142400496 GAGAGCCCTGGCTAGCCTGGGGG + Intergenic
1034550494 7:151817516-151817538 GACAGCCTTGGGAAGCCTGGGGG - Intronic
1034570330 7:151950617-151950639 CACAGCCTGGGGAAGTCTAGTGG - Intergenic
1035825842 8:2643492-2643514 GATAGCCTTAGGGAGGCTGGTGG - Intergenic
1036649783 8:10634894-10634916 GAGAGTCTTGGGGAGACTGGAGG - Intronic
1036780567 8:11644096-11644118 CACAGCCTGGGGAAGCCCCGAGG - Intergenic
1037529539 8:19759111-19759133 GACAGGCTTGGGGAGGGTGGAGG + Intergenic
1037673476 8:21035292-21035314 GACGGTGTTGGGAACCCTGGTGG + Intergenic
1037760551 8:21738794-21738816 GACAGCCAGGGCAAGCCTGTGGG + Intronic
1039647247 8:39301173-39301195 GATAGCATTGGCAAGCCTTGTGG - Intergenic
1041135447 8:54753316-54753338 GACAGCCTTGTGAAAGCTTGTGG + Intergenic
1042944947 8:74145199-74145221 GCCTGCCTTGGGAAGCCGGCAGG + Intergenic
1045239258 8:100384599-100384621 CAGAGCCTGGGGAAGCCTGGCGG - Intronic
1045333367 8:101176777-101176799 CACAGCCTTGAGAAGCATGGGGG + Intergenic
1046895075 8:119463482-119463504 GACAGCCTCTGGCACCCTGGTGG + Intergenic
1048370661 8:133773642-133773664 GACAGCCTTGGGAACCAAGAAGG + Intergenic
1048690861 8:136961587-136961609 GACAGCCTTGGCCAGTCTGCAGG - Intergenic
1049423131 8:142525575-142525597 CACAGCCTTGGCCAGCCTGATGG - Intronic
1051108479 9:13607956-13607978 GACAGCATTTGGAAGGCTGCTGG + Intergenic
1051852765 9:21528359-21528381 GGCAGCCTCGGGTACCCTGGGGG - Intergenic
1057236537 9:93366075-93366097 GGCAGCCATGGGGAGGCTGGAGG + Intergenic
1057666069 9:97046380-97046402 GACTGCCCTGGGGAGCCTCGGGG - Intergenic
1058456594 9:105143454-105143476 GGCAGCCTCGGGGAGCCTGAAGG - Intergenic
1059340465 9:113594861-113594883 GAGAGGCTTGGGAACCTTGGGGG - Intronic
1060149842 9:121281610-121281632 GGCTGCCCAGGGAAGCCTGGAGG + Intronic
1060280604 9:122213493-122213515 GAGGGCCTTGGGGAGCCTCGTGG - Intronic
1060719811 9:125969393-125969415 GAGAGCATCGGAAAGCCTGGTGG + Intergenic
1060743903 9:126117331-126117353 GGCAGCCTGGGGAAGCCTGTGGG + Intergenic
1061011226 9:127955779-127955801 CAAAGCCTTGTGGAGCCTGGAGG - Intronic
1061255494 9:129452726-129452748 CAAAGGATTGGGAAGCCTGGAGG + Intergenic
1061950674 9:133934207-133934229 GAGAGACTTGGGGAGCCGGGAGG + Intronic
1062167027 9:135112980-135113002 GGCAGCCTTGGGAACCTGGGTGG + Intronic
1062533921 9:137013385-137013407 GACAGCCTTGGTGGGCCAGGCGG - Intronic
1186230990 X:7453416-7453438 GCCTGCCTTGGGAAGCTTTGAGG + Intergenic
1186739338 X:12500604-12500626 GAAAGCCTTGGGAAGCCAGGGGG - Intronic
1186878545 X:13841257-13841279 GACAGCCTTGGGAAGGATGACGG - Intronic
1187473030 X:19586201-19586223 TACAGGCTTTGCAAGCCTGGGGG - Intronic
1190789580 X:53686440-53686462 GGCGGCCTTGGGGAGCCTGCGGG - Intronic
1194781361 X:98028797-98028819 GACAGTCTTGGGTCCCCTGGGGG - Intergenic
1195963671 X:110410665-110410687 CACAGCTTTGGGAAGCATGGAGG + Intronic
1202032372 Y:20591248-20591270 CACAGCCTCGGGAAGCCCTGAGG + Intronic