ID: 1034552946

View in Genome Browser
Species Human (GRCh38)
Location 7:151832780-151832802
Sequence TATTACCTAGAGAAGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034552946_1034552963 29 Left 1034552946 7:151832780-151832802 CCCTCCCTCTTCTCTAGGTAATA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1034552963 7:151832832-151832854 CAGGCGAGCAGTTAGGACGGTGG No data
1034552946_1034552953 10 Left 1034552946 7:151832780-151832802 CCCTCCCTCTTCTCTAGGTAATA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1034552953 7:151832813-151832835 CTCCCAGAGACCCCTATCCCAGG No data
1034552946_1034552960 26 Left 1034552946 7:151832780-151832802 CCCTCCCTCTTCTCTAGGTAATA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1034552960 7:151832829-151832851 TCCCAGGCGAGCAGTTAGGACGG No data
1034552946_1034552959 22 Left 1034552946 7:151832780-151832802 CCCTCCCTCTTCTCTAGGTAATA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1034552959 7:151832825-151832847 CCTATCCCAGGCGAGCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034552946 Original CRISPR TATTACCTAGAGAAGAGGGA GGG (reversed) Intronic
900671830 1:3859118-3859140 AATTCCCAAGAGCAGAGGGAGGG + Intronic
900838660 1:5028478-5028500 TTTAACCAAGAGATGAGGGAAGG + Intergenic
902284722 1:15400021-15400043 TTTCACCTAGAGAAGCTGGAAGG - Intronic
905534485 1:38709542-38709564 TATGGCCTGGATAAGAGGGAGGG + Intergenic
907346101 1:53782001-53782023 TATTAGCTAGAGTAGAGGTGGGG - Intronic
907857659 1:58319578-58319600 TATTACCTTGAGAAAAAGTATGG + Intronic
908096250 1:60741994-60742016 TATTTGGGAGAGAAGAGGGAAGG - Intergenic
909401756 1:75240659-75240681 TATGACCCAGGGAAGAGTGATGG + Intronic
909617530 1:77628447-77628469 TATGCGCTAGAGAAGAGGGATGG + Intronic
910784917 1:90986072-90986094 TATTACTTATATAAGTGGGAGGG + Intronic
912372023 1:109181058-109181080 TATTACCTATAGCATAGTGAGGG + Intronic
912479060 1:109964174-109964196 CATTACCTATAGAGGAGGAAAGG + Intergenic
912863974 1:113240343-113240365 AATTACCTATAGAAAAGGGGTGG - Intergenic
913392591 1:118331083-118331105 CATTGCCAAGTGAAGAGGGAAGG - Intergenic
915000355 1:152583898-152583920 TAAAACCTAGAGAACAGGAATGG - Intronic
918331146 1:183461663-183461685 CATGACCTAGAGTTGAGGGAGGG + Intergenic
918940420 1:190988558-190988580 GGTTACTTGGAGAAGAGGGAAGG - Intergenic
920029927 1:203030661-203030683 TATAATCGAGAGAGGAGGGAGGG - Intronic
920198798 1:204246622-204246644 AACTAGCTAGAGAAGAGGCAGGG + Intronic
922627522 1:227064591-227064613 TATTACCTAGAGAAAGAGGCTGG + Intronic
923548995 1:234946419-234946441 GTTTACATAGAGAAGAGTGAAGG - Intergenic
1063828961 10:9930869-9930891 TATTACATAGAAAAGACTGAAGG + Intergenic
1064496008 10:15911261-15911283 CAGCACCTAGAGAAGAGGGTGGG + Intergenic
1067185313 10:44022193-44022215 AATTAGCTTGAGAAGAGGGATGG + Intergenic
1068406022 10:56589762-56589784 TATTCCCTAATAAAGAGGGAAGG - Intergenic
1069295673 10:66841587-66841609 TATTTCCCAGAGTAGAGGGATGG + Intronic
1069395885 10:67987287-67987309 TTTTACCTCGAGAAAATGGAAGG - Intronic
1070462361 10:76682710-76682732 TAATACCTAGAGAAGTGGTAAGG + Intergenic
1071049835 10:81433297-81433319 TATTACTTAGAATAAAGGGAAGG - Intergenic
1071494181 10:86156409-86156431 TGTAACTAAGAGAAGAGGGATGG + Intronic
1071604770 10:86978088-86978110 TCTTAACTAGAAAAAAGGGAAGG + Intronic
1072135562 10:92542443-92542465 AATTACCTAGAGACTAGGCACGG - Intronic
1073083712 10:100875244-100875266 TCTCCCCTAGAGAGGAGGGAAGG + Intergenic
1073265802 10:102227776-102227798 TAAGATCTAGAGAAGAGGCAGGG - Intronic
1073791271 10:106942673-106942695 TTTTACCAAGAGAGGAGGCAAGG - Intronic
1074039409 10:109773327-109773349 TAATACCTAAAAAGGAGGGAGGG - Intergenic
1075540742 10:123311627-123311649 TTTTACTTAGAGGAGAGGAAGGG - Intergenic
1077702368 11:4454250-4454272 TATTAACTAGGCAGGAGGGAAGG - Intergenic
1077892019 11:6425690-6425712 TATTACCAATAAAAGGGGGAAGG - Intergenic
1079459129 11:20664448-20664470 TATTCTTTAGAGCAGAGGGAAGG + Intergenic
1079970499 11:27030428-27030450 CATTATCTAGAAAAGAAGGATGG + Intergenic
1080566308 11:33512714-33512736 TATTACCTAGAGCAGGGGCCGGG - Intergenic
1081068839 11:38583737-38583759 AATGAACTAGAGAAGAGAGAGGG + Intergenic
1083987875 11:66228732-66228754 TGTTACCCAGGGGAGAGGGAGGG + Intronic
1085192388 11:74639025-74639047 GATTAGCTGGATAAGAGGGACGG + Intronic
1085768464 11:79304579-79304601 TGATACCTAAACAAGAGGGAGGG - Intronic
1086249936 11:84800725-84800747 TATCAACTAGAGAAAAGAGAAGG - Intronic
1086337249 11:85811683-85811705 TAATACCTAGAGAAAGGTGAGGG + Intergenic
1087194960 11:95296184-95296206 TTGTGCCTAGAGAAGAGGCATGG + Intergenic
1087765341 11:102146173-102146195 TATTAATTAAAAAAGAGGGAGGG - Intronic
1087777894 11:102273480-102273502 TCTTAACTAGGGAGGAGGGAAGG + Intergenic
1088248240 11:107840011-107840033 TATTGCCTAGATTAGGGGGAAGG + Intronic
1088776856 11:113093621-113093643 TCCTACCTAGAGAAAAGAGATGG - Intronic
1088801212 11:113308821-113308843 TAGTGCCTAAGGAAGAGGGAGGG - Intergenic
1089631332 11:119786466-119786488 TAGTCCCTAGACCAGAGGGAAGG - Intergenic
1090402809 11:126459756-126459778 TATTACATGGAGGAGAGGGTGGG + Intronic
1092774497 12:11930679-11930701 TATTACCTTGAGAAGGGGTAAGG - Intergenic
1093208669 12:16281532-16281554 TATAACAGAGAGAAGAGGCAGGG - Intergenic
1093686749 12:22064887-22064909 TATGAGCTAGAGAAGAAGAATGG - Intronic
1094122284 12:26987047-26987069 TGTGACTTAGAGAAAAGGGAGGG - Intronic
1095976727 12:47945286-47945308 AGTGCCCTAGAGAAGAGGGAGGG - Intergenic
1096017145 12:48286917-48286939 AATAGCTTAGAGAAGAGGGAAGG - Intergenic
1096124410 12:49109248-49109270 AAATTCCTAGAGAACAGGGAGGG - Intronic
1096418647 12:51436544-51436566 AGTTACCTAGAGAGGAGGGAGGG - Intronic
1098912195 12:76220828-76220850 TATTACAGAGGGAAGAGAGAAGG - Intergenic
1101646989 12:106640657-106640679 TAATACTTAGAGAAGGGTGAAGG - Intronic
1101680304 12:106956963-106956985 AAACACCTAGAGAAAAGGGAAGG + Intronic
1102451406 12:113044777-113044799 CAATTCCTAGAGAGGAGGGAGGG + Intergenic
1102674013 12:114644129-114644151 TTTTTCCTAGTAAAGAGGGAAGG - Intergenic
1102793747 12:115670773-115670795 TATTACTAAAGGAAGAGGGAGGG - Intergenic
1103070609 12:117938106-117938128 CATTAGCTAGAGACGAGGAAAGG - Intronic
1107174739 13:37387225-37387247 TATCACCTTGAGGACAGGGATGG - Intergenic
1107237020 13:38183693-38183715 TAATAACTAGAAAAGAGAGAGGG - Intergenic
1108832232 13:54494523-54494545 TATTACCTATAGAAGATAGATGG + Intergenic
1110976848 13:81848492-81848514 TGTTACACAGAGAAAAGGGATGG + Intergenic
1112346299 13:98592832-98592854 TCCTACCTAGAGAAGAGCAAGGG - Intergenic
1114290920 14:21287634-21287656 TATTTCGCAGAGAAAAGGGATGG + Intergenic
1114343755 14:21773171-21773193 AATTAACTAGAGAAGAAGTAGGG - Intergenic
1117461057 14:55945222-55945244 TCTTACCTGGAAAAGAGGAAAGG - Intergenic
1118013066 14:61629437-61629459 TCTTGCCTTGAGAAGAGAGACGG - Intronic
1118524989 14:66630070-66630092 TATTACATCCAGAGGAGGGATGG + Intronic
1118703455 14:68458479-68458501 TATTGCCTAGAAAAGAGCTAGGG - Intronic
1119266899 14:73268110-73268132 TAGTTCCTGGAGCAGAGGGAAGG - Intronic
1119745176 14:77038701-77038723 GAAGACCTAGAGAAGAAGGAAGG - Intergenic
1120181527 14:81347731-81347753 TATTTTATAGAGAAGGGGGAGGG - Intronic
1122478601 14:102030145-102030167 CATAACCTAGAAAGGAGGGATGG - Exonic
1122498696 14:102178911-102178933 TATTATATAGAGATGAGAGAGGG + Intronic
1126310593 15:47311996-47312018 TATTAGCTAGGGCAGAGGCAAGG + Intronic
1127329005 15:57920767-57920789 TCTGACCTAGATAAGAGGGAAGG - Intergenic
1127701527 15:61506043-61506065 TATTACCTAGAGGAGAAAGGTGG + Intergenic
1127706133 15:61548784-61548806 TATTAGCCAGAGATGAGGGAGGG - Intergenic
1128775958 15:70320785-70320807 TGTAAGCCAGAGAAGAGGGAAGG - Intergenic
1131341183 15:91602609-91602631 AATTCCATAGAGAAGTGGGATGG - Intergenic
1131999974 15:98168648-98168670 TAGTCCCTGGAGAAGAGGGCTGG + Intergenic
1135882560 16:26272680-26272702 GATTACCTAGGGAATAGGGCAGG + Intergenic
1137946352 16:52736441-52736463 TCTTACCAAAAGAAGAGGGAAGG + Intergenic
1138439841 16:57027469-57027491 TATTAGCTAGAGAAAAGGCTAGG + Intronic
1138939452 16:61772875-61772897 TATGACATAGAGAATAGGAAAGG - Intronic
1140987539 16:80172813-80172835 TATTATCTGGGAAAGAGGGACGG + Intergenic
1141238513 16:82242902-82242924 TATGAAGTAGAGAAGGGGGATGG + Intergenic
1142471026 17:163350-163372 CCTTCCCTAGAGAAGGGGGAAGG + Intronic
1142516007 17:429550-429572 AAGGACGTAGAGAAGAGGGAAGG + Intergenic
1146581017 17:34039175-34039197 TCTGACTTAGAGAAGAAGGAGGG - Intronic
1146617475 17:34368391-34368413 TATTAGCTGGAAAAGAGAGAAGG + Intergenic
1148536392 17:48442587-48442609 ACTTACCTAGAGAAGTTGGAAGG - Intergenic
1149663346 17:58348354-58348376 TGTTACTGAGAGAAGAGGGGAGG - Intronic
1149781387 17:59399242-59399264 TATTTCCTTGAGGAGGGGGAAGG - Exonic
1149986649 17:61352758-61352780 TACTGCCTAGAGGAGAGGGGTGG - Intronic
1150116339 17:62553711-62553733 TCTGACTTAGAGAAGAAGGAGGG + Exonic
1151049516 17:70961290-70961312 TATTAGTAACAGAAGAGGGAAGG + Intergenic
1152352662 17:79792038-79792060 GAGTACTGAGAGAAGAGGGACGG + Intergenic
1152614127 17:81330138-81330160 TCTTACCTGGAGCAGAGGGGCGG + Exonic
1153111007 18:1587593-1587615 TTTTGCCCAGAGAAGAGGAATGG + Intergenic
1155994184 18:32312598-32312620 TATAAAATAGAGAAGAGAGATGG + Intronic
1156897024 18:42257358-42257380 CTTTATCCAGAGAAGAGGGAGGG - Intergenic
1157244282 18:46039821-46039843 CATAACCTAGAGCAGAGAGAGGG + Intronic
1161300922 19:3542951-3542973 TCTTGCCTGGAGAAGAGGGAGGG - Intronic
1163229200 19:15988500-15988522 TATTTCCTGGAGAAAAGGAAGGG + Intergenic
1164294913 19:23901365-23901387 TTATACCCAGACAAGAGGGAAGG - Intergenic
1165368120 19:35382501-35382523 TATAAACTAGGGAAAAGGGAAGG - Intergenic
1166524828 19:43504398-43504420 TGACACCTAGAGATGAGGGAGGG - Intronic
1166760019 19:45218362-45218384 TATTCCTAAGTGAAGAGGGAGGG - Intronic
926063343 2:9818775-9818797 AATTACCTACAGAGGTGGGAGGG + Intergenic
932706457 2:74029291-74029313 TATTCCCTTGAGAACAGGGATGG - Intronic
932783146 2:74576063-74576085 TAGTACTTAGAGAAATGGGAGGG + Intronic
934606650 2:95700328-95700350 TATTATTTAGAGGAGAGAGAGGG - Intergenic
935438513 2:103063488-103063510 TATAACCTACAGAAGAGAAATGG + Intergenic
937025329 2:118692883-118692905 TGTTAGGTGGAGAAGAGGGAAGG - Intergenic
937388567 2:121461587-121461609 TCTTACCTAGAAAACAGGTAAGG + Intronic
939320175 2:140609836-140609858 TATTACCTAGAGTTGCTGGATGG - Intronic
939918349 2:148076834-148076856 GAGAACTTAGAGAAGAGGGATGG - Intronic
940377044 2:152968776-152968798 TTTTACCTTCAGAAGAGGAAGGG + Intergenic
942607776 2:177710216-177710238 TCTTACCGAGATAGGAGGGAAGG + Intronic
944412368 2:199457468-199457490 TAGGACCTGGGGAAGAGGGAAGG - Exonic
944473903 2:200084794-200084816 TCTTACCTAGAAAAGATAGAAGG - Intergenic
945185878 2:207139128-207139150 TGTTTTCTAGAGAAGATGGATGG - Intronic
945416424 2:209578661-209578683 TATTTCCTGGGGAAAAGGGAAGG - Intronic
946973242 2:225119144-225119166 GATTACCTAATTAAGAGGGAAGG + Intergenic
948305944 2:236946846-236946868 TATTACTAGGAGAAGTGGGAAGG + Intergenic
1169255188 20:4091651-4091673 AATTCCCTAGAGAAGAGAGAAGG - Intergenic
1169584786 20:7069110-7069132 TATTCCCAAGAGAAAAGGCAGGG - Intergenic
1170778167 20:19398092-19398114 GATTACCAATAGAAGAGAGAAGG - Intronic
1171415717 20:24979299-24979321 TATTTCACAGAGAAGATGGAAGG + Intronic
1175638099 20:60602446-60602468 TATTACCTGCAGCAGAGGGTGGG + Intergenic
1178263730 21:31123620-31123642 TCCTACCTATTGAAGAGGGATGG - Intronic
1178554108 21:33571754-33571776 TGTTCCCTGGAAAAGAGGGACGG + Intronic
1179811271 21:43871913-43871935 CACTACCTAGAAAAGAAGGATGG - Intronic
1182049266 22:27300506-27300528 TATTTATTAGAGAGGAGGGAAGG - Intergenic
1182453377 22:30434275-30434297 TCTTACCTAGAGGTGAGGGATGG - Intergenic
1182835463 22:33337986-33338008 GACTACCTAGAGCAGAGGCAGGG - Intronic
1182858090 22:33535613-33535635 TATAAACTGGAGAAGAGGTAGGG + Intronic
950883079 3:16338764-16338786 TATTACCTAGAAAAGAGAAAAGG + Intronic
951188609 3:19743176-19743198 TAAAATCCAGAGAAGAGGGAGGG + Intergenic
951839999 3:27024072-27024094 TAATACCTAGAGCAGTGAGAAGG + Intergenic
956575482 3:70747887-70747909 TATAAAATTGAGAAGAGGGAAGG + Intergenic
957027365 3:75197957-75197979 TAGTACCTACAAAAGAGGTATGG + Intergenic
962024728 3:131536002-131536024 TAATACATAGAGAAGGGGTAGGG + Intronic
962729083 3:138262941-138262963 TAATGCCTACAGAAGAGTGAGGG + Intronic
962888469 3:139650177-139650199 TATTATATGGAGAAGAGAGAGGG - Intronic
964109664 3:153075338-153075360 AATGAGCTAGGGAAGAGGGAAGG - Intergenic
964271447 3:154960574-154960596 TATTGCATAGAGAAGGAGGAAGG + Intergenic
965788258 3:172359447-172359469 TTGTACCTAGAGTAAAGGGAAGG + Intronic
965789788 3:172375088-172375110 TATTTCCTTAAGAAGAGGAAAGG + Intronic
967506619 3:190259871-190259893 TATTTCGTAGAGATGAGGGGGGG + Intergenic
968291284 3:197541740-197541762 AATCACCTAGAGAACAGTGAGGG - Intronic
968397919 4:260755-260777 GATTACCTAGAGAAACAGGAGGG + Intergenic
969063304 4:4456727-4456749 TATTCCTGAGAGAAGAGCGAGGG - Intronic
970520374 4:16877811-16877833 TTGTACCTAAAGAAGAGGAAAGG + Intronic
972092076 4:35299838-35299860 GATTCCCTAGGGAAGAGTGATGG + Intergenic
975653203 4:76614956-76614978 TTTTTTCTGGAGAAGAGGGAAGG - Intronic
977638302 4:99326214-99326236 TCTCACCCTGAGAAGAGGGAAGG - Intergenic
978824692 4:113007537-113007559 TATTACTTACAGAAGAGAAAGGG + Intronic
979996188 4:127434217-127434239 AAATACCCAGAGAAAAGGGAAGG + Intergenic
982230530 4:153204670-153204692 TTTTCCCTGCAGAAGAGGGAAGG + Intronic
983143938 4:164189002-164189024 TATGGCCTGGATAAGAGGGAGGG + Intronic
986293157 5:6416486-6416508 TTTCACCTAGAGAAGGTGGAGGG - Intergenic
986335818 5:6754637-6754659 TGTTACATAGAGAGCAGGGATGG - Intronic
986694699 5:10341110-10341132 TATTGCCAGGAGAAGAAGGAAGG + Intergenic
988382758 5:30519146-30519168 AATTAAAGAGAGAAGAGGGAGGG + Intergenic
988873729 5:35420162-35420184 TATTAGCCACAGAGGAGGGATGG + Intergenic
989127837 5:38074227-38074249 TATTACCTAGAGAAGGCCAAGGG + Intergenic
989162102 5:38401216-38401238 AATTTCCTAGAGCAGATGGAGGG + Intronic
989392375 5:40914745-40914767 TATTCTCTTGAGAATAGGGATGG - Intronic
989726261 5:44589931-44589953 TATTTCCTAAAGGAGAGAGAAGG - Intergenic
991232220 5:64347405-64347427 AACTATCTGGAGAAGAGGGAAGG + Intronic
991972179 5:72151783-72151805 TACTATCTAAAGAACAGGGAGGG - Intronic
992111832 5:73501663-73501685 TATTGGCTAAAGAAGAGGGATGG + Intronic
992136427 5:73750725-73750747 CATTACCTACAGGACAGGGAGGG + Intronic
992266868 5:75027970-75027992 TAGTACCTAAAGAGGAGCGAAGG - Exonic
993503105 5:88683859-88683881 TGTTACAGAGAGCAGAGGGAGGG - Intergenic
993625239 5:90216206-90216228 TATTAACTAGAGAAAAGTAAAGG + Intergenic
994722931 5:103401453-103401475 TATTCTCTGGAGAAGAGAGAAGG + Intergenic
995443927 5:112222064-112222086 TCTTACCTAGCCAAGAGAGAGGG - Intronic
998962942 5:147508465-147508487 CATTACCTAGACAAGGGTGAGGG + Intronic
1000254598 5:159525769-159525791 TATCACCTAGAGAAGGAGGAGGG - Intergenic
1000280597 5:159778467-159778489 TATTAACTGCAGAAGAGGGTGGG - Intergenic
1003902510 6:10668171-10668193 TATTACCCAGTGAGGAGGAATGG + Intergenic
1007561566 6:42813133-42813155 TAGTCCCCAAAGAAGAGGGAGGG + Intronic
1010786940 6:80014274-80014296 TATTAATTAGAGAAATGGGAAGG - Intronic
1011190837 6:84726666-84726688 TAATAGCTAGGGAAGAGTGATGG - Intronic
1011342317 6:86330447-86330469 TATTACATAGAGAAGAATGAAGG + Intergenic
1012795140 6:103749914-103749936 TATTTCCTAGACAAGAGTAAAGG + Intergenic
1013576347 6:111486735-111486757 CAATGGCTAGAGAAGAGGGAAGG + Intergenic
1015703352 6:136060150-136060172 GATTAGCTAAAGAAGAAGGAGGG - Intronic
1016299899 6:142619124-142619146 TATTACCTAGAGAGGACAGTCGG - Intergenic
1017046019 6:150347878-150347900 TATTCCCTAGAAAAGAGATAAGG + Intergenic
1017306683 6:152926438-152926460 TATTGACTACAAAAGAGGGAGGG + Intergenic
1017472982 6:154758701-154758723 TATTATCCAAAGAAGAGGGGTGG - Intronic
1017539024 6:155380772-155380794 TCTTTCTTAGAGAAGAGTGAGGG + Intergenic
1020066607 7:5193108-5193130 TTTTACCTAGAGAAGTGAAAGGG + Exonic
1020398559 7:7747154-7747176 TTTTACCTAAATAATAGGGAAGG + Intronic
1021988238 7:26117892-26117914 TCTTGCCTAGTGAAGAGTGAAGG - Intergenic
1022569371 7:31436627-31436649 AATGACTTAGATAAGAGGGAGGG - Intergenic
1026422244 7:70251576-70251598 TAGTTCCCAGAGAAGAGGAAGGG - Intronic
1026593879 7:71718151-71718173 TATAAACTAGGGAAAAGGGAGGG + Intergenic
1027402591 7:77823660-77823682 TATTACCTGGAGTAGAAGGCAGG + Intronic
1027714089 7:81647443-81647465 TATTTTCTGGAGAAGAAGGAAGG + Intergenic
1028233903 7:88337429-88337451 TATTACCTAGAGTTGAAGCAAGG + Intergenic
1028293993 7:89104744-89104766 AATTAACAAGAGAAGAGTGAAGG - Intronic
1030090147 7:105851118-105851140 TATTGCCTGGAGGAGAGGGCAGG - Intronic
1030251334 7:107448465-107448487 CATTAGCTAGAGAGGTGGGATGG - Intronic
1031404395 7:121367185-121367207 TTTTGCCTAGAGATGTGGGAAGG - Intronic
1032046072 7:128609535-128609557 TCTGACCTAGAGAAGAGGGAGGG + Intergenic
1032168146 7:129561978-129562000 TCTTCCCTGGGGAAGAGGGAGGG + Intergenic
1032688161 7:134256684-134256706 AATTAGCTAGAAAAGGGGGAAGG - Intronic
1033315968 7:140297814-140297836 TACTGCCTAGAGAAGATGAAAGG - Intronic
1034552946 7:151832780-151832802 TATTACCTAGAGAAGAGGGAGGG - Intronic
1036013274 8:4752160-4752182 TACTTCCTAGAGAAGTGGTAAGG - Intronic
1037595266 8:20349378-20349400 TATTCAGTATAGAAGAGGGAGGG + Intergenic
1037794854 8:21984622-21984644 TATTCCCAAGGGAAGAAGGAAGG - Intronic
1041140272 8:54810731-54810753 TTGTTCCTGGAGAAGAGGGAAGG + Intergenic
1041327664 8:56686258-56686280 TATAACCTAAAAAAAAGGGATGG + Intergenic
1043580071 8:81701961-81701983 TATTCCATAGAGAAGAAAGATGG - Exonic
1043821969 8:84877734-84877756 TAATGACTAGAGAAGAGAGATGG - Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1044634395 8:94308163-94308185 TATTGCCTAGATAGGAGAGAGGG + Intergenic
1045273418 8:100680805-100680827 TGTTACCAGGAAAAGAGGGATGG + Intergenic
1046136579 8:110035113-110035135 TGTTGCTTAGAGAAGAGGGTAGG + Intergenic
1046424191 8:114024949-114024971 TATAACTTAGGGAAGAAGGAGGG + Intergenic
1048608853 8:136000082-136000104 CATGACCTAGAGAAGAGAGAAGG - Intergenic
1049126891 8:140798108-140798130 TATGATCTAGAGAAGACAGATGG + Intronic
1051069904 9:13153097-13153119 GAGTTCCTAGAGAAGAGGAAAGG + Intronic
1055344380 9:75319294-75319316 TATTACCTATATAAGATGGGTGG - Intergenic
1056253949 9:84779041-84779063 TATTACCCAAGGGAGAGGGAAGG - Intronic
1057037103 9:91818924-91818946 CATGACCTGCAGAAGAGGGAGGG - Intronic
1058468310 9:105251009-105251031 AATTACCTAGAGAAAGGGTAAGG - Intronic
1060368485 9:123044547-123044569 TTTTACCAAGAGAAGACAGAAGG + Intronic
1060641030 9:125239290-125239312 TATGGCCTGGATAAGAGGGAGGG - Exonic
1062209354 9:135355456-135355478 TATTTCTTGGAGAGGAGGGAGGG + Intergenic
1186714730 X:12239529-12239551 CATTATCTAGAGAAGGGAGAGGG + Intronic
1186921806 X:14290538-14290560 CATTACATAGAGAAGAAGGTGGG + Intergenic
1188206386 X:27364186-27364208 TGGAACCTAGAGAAGAGGCAAGG - Intergenic
1188706619 X:33341330-33341352 TGTTACCAAGGGCAGAGGGAGGG - Intergenic
1188886185 X:35552667-35552689 TATTACCAAGAGGATAAGGAAGG + Intergenic
1189126321 X:38451161-38451183 TATTACTTAGAGGAGGGGGAAGG - Intronic
1190765158 X:53470082-53470104 TATAAACTAGGGAAAAGGGAAGG - Intergenic
1190799571 X:53775053-53775075 ATTGACCTAGAGAAGATGGAAGG + Intergenic
1191991291 X:67039404-67039426 TGTTACCTAGAGTTGGGGGAGGG + Intergenic
1192057620 X:67788261-67788283 TCTTAAGTAGACAAGAGGGAAGG + Intergenic
1192215148 X:69152993-69153015 TCCAACCTAGAGAAGAGAGAGGG + Intergenic
1192379894 X:70604649-70604671 TATTACTTGGAGAGGAGGGAAGG + Intronic
1194479472 X:94401974-94401996 TGTTGCCTAGACATGAGGGATGG + Intergenic
1194793867 X:98185516-98185538 TAGTACCTAGAGAAGTGACAAGG - Intergenic
1195682966 X:107562518-107562540 GACTGGCTAGAGAAGAGGGATGG + Intronic
1199323112 X:146463951-146463973 TATGACTTAGAGAAGACTGATGG + Intergenic