ID: 1034553994

View in Genome Browser
Species Human (GRCh38)
Location 7:151838332-151838354
Sequence GGTGCTGAGGGGATTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034553994_1034553998 -5 Left 1034553994 7:151838332-151838354 CCTTGCTCAATCCCCTCAGCACC 0: 1
1: 0
2: 3
3: 28
4: 290
Right 1034553998 7:151838350-151838372 GCACCCTCGTCTCCAGCAGACGG No data
1034553994_1034554002 4 Left 1034553994 7:151838332-151838354 CCTTGCTCAATCCCCTCAGCACC 0: 1
1: 0
2: 3
3: 28
4: 290
Right 1034554002 7:151838359-151838381 TCTCCAGCAGACGGGTATCCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1034553994_1034553999 -4 Left 1034553994 7:151838332-151838354 CCTTGCTCAATCCCCTCAGCACC 0: 1
1: 0
2: 3
3: 28
4: 290
Right 1034553999 7:151838351-151838373 CACCCTCGTCTCCAGCAGACGGG 0: 1
1: 0
2: 0
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034553994 Original CRISPR GGTGCTGAGGGGATTGAGCA AGG (reversed) Intronic
900118532 1:1038844-1038866 GATGCTGAGGGGAGAGAGAAGGG + Intronic
902072459 1:13751927-13751949 GGTGATGAGGGGAGAGAGAAGGG - Intronic
902385191 1:16072361-16072383 TGTCCTGGGGGTATTGAGCAAGG - Intronic
902599627 1:17532154-17532176 GCTGCTGAGGAGAGGGAGCAGGG - Intergenic
902877548 1:19349860-19349882 GGTGTGGAGGGGAGTGAGCAGGG - Intronic
903330991 1:22597293-22597315 GGTGCTGAGGGGCGGGAGGAGGG - Exonic
903749362 1:25611186-25611208 GGTGCTTAGTGGTTAGAGCAGGG - Intergenic
904267933 1:29328508-29328530 GGTTGTTAGGGGATTGTGCAAGG - Intergenic
905182463 1:36175686-36175708 GCAGCTGAGGGGACAGAGCAGGG + Intronic
905237009 1:36557202-36557224 GTTGCTGAGTGGCTTGATCAGGG + Intergenic
905282015 1:36855309-36855331 GGTGCTGGGGGCATTCCGCAGGG - Intronic
906237115 1:44218812-44218834 GGAGTTGAGGGGATGGAGGATGG - Intronic
906458576 1:46019875-46019897 GGTCCTGAGGGGATGCGGCAGGG + Intronic
906763201 1:48399110-48399132 GGTACTGAGAGGATTTAACATGG + Intronic
906795444 1:48693170-48693192 CTTGCTGAGGAGATTAAGCAAGG - Intronic
907290091 1:53408076-53408098 CTTGCTGAGGGGAGTGGGCAGGG + Intergenic
907463714 1:54621561-54621583 TGTGCTGAGGGCAGTGAGCGAGG + Intronic
907544516 1:55247938-55247960 GGTGCTCAGAGGATAGAGCCTGG + Intergenic
909980296 1:82091785-82091807 AGTGCTGAGGGGATTGGGAATGG - Intergenic
910858042 1:91715832-91715854 GGGGCTAAGGGGACTGTGCAGGG + Intronic
912006479 1:104908063-104908085 GATGCTGATGGGAGTGAGAATGG - Intergenic
912404112 1:109422354-109422376 GGTAATGAGGGCATTGAGAATGG - Intronic
913183505 1:116345243-116345265 GGTGCTGTGTTGATTGAGCAAGG - Intergenic
914357710 1:146901893-146901915 GGTGGAGAGGGGATTGAGACAGG + Intergenic
914440363 1:147700285-147700307 GGTGTTGAGGAGATTGAGGTGGG - Intergenic
915514016 1:156402266-156402288 GGTGCTGGGGGGCCTGAGCAGGG - Intergenic
916161720 1:161922902-161922924 GGTGCTGAGGAGTTTGAGGTGGG + Intronic
916862459 1:168820770-168820792 GGGGCTGAGGGGAGTGGGAATGG + Intergenic
917581480 1:176382699-176382721 GGTGGTGAGGGGATAGAGTGGGG + Intergenic
918708414 1:187696875-187696897 GGGGCTGAGGGGACATAGCATGG - Intergenic
920344625 1:205298380-205298402 GCAGCTGATGGGATGGAGCAGGG + Intergenic
920438653 1:205964141-205964163 GGAGCTGAGGTGTGTGAGCATGG - Intergenic
920693050 1:208161286-208161308 GGTGAGAAGGGGATTGAGGAAGG - Intronic
921625092 1:217370912-217370934 TGTGCGGAGGGGATGGAGCGAGG + Intergenic
921730889 1:218576747-218576769 GATGCTGTGGGAACTGAGCAAGG + Intergenic
922530926 1:226344508-226344530 TGTTCTGAGGGTACTGAGCATGG + Intergenic
922751420 1:228071816-228071838 GGTGTTGAGGGGATAGTGTAGGG + Intergenic
922794426 1:228333115-228333137 GGTGCTGAGGGGCTTGGGCATGG - Intronic
922980129 1:229818629-229818651 GGTGGTGAGGGGACTTAGGAAGG - Intergenic
923469018 1:234273696-234273718 GGTGTTGAGGGTCTGGAGCAGGG + Intronic
924877646 1:248122779-248122801 GTAGATGAGGGGATTCAGCATGG - Intergenic
924879634 1:248145995-248146017 GTAGATGAGGGGATTCAGCATGG - Exonic
924882788 1:248180833-248180855 GTAGATGAGGGGATTCAGCATGG - Exonic
1063228353 10:4038281-4038303 GGCTCTGAGGGGATTGAAAAAGG + Intergenic
1064010038 10:11728191-11728213 GGTGGGGAGGAGATTGAGGAGGG + Intergenic
1065857562 10:29842558-29842580 GGTGCTGTGAGGATCGGGCAAGG + Intergenic
1067142460 10:43668584-43668606 GGAGCTGAGGGGAGTGAGCAGGG + Intergenic
1067897039 10:50193639-50193661 GGTGCTGGGGGAAGTGAGGAAGG + Intronic
1067951934 10:50748401-50748423 GGTGCTGGGGGAAGTGAGGAAGG - Intronic
1068809667 10:61241795-61241817 GGTGGAGAGGGAATAGAGCAAGG - Intergenic
1069865898 10:71502639-71502661 GGTGCAGAGGGAAATGTGCATGG + Intronic
1071181937 10:82996499-82996521 GGTTCTGAGGGAATAGAGTAAGG + Intergenic
1071225850 10:83526932-83526954 GGTGCTGAGGGGATTGTACCAGG - Intergenic
1072582762 10:96753933-96753955 GGTGCAGAGGGGATGGTGAAGGG + Intergenic
1073478598 10:103771337-103771359 GATGCTGTGGGGAGTGGGCAGGG + Intronic
1073509383 10:104033899-104033921 GGTGCTGGGGGGAAGGAGCGTGG - Intronic
1074263276 10:111875270-111875292 TGTGCTGAAGGGATAGAGCTCGG + Intergenic
1075385675 10:122053664-122053686 GGTTCAGAGGGGAATGAGCAGGG - Intronic
1076715005 10:132359165-132359187 GGTGCTGAGGTGGTGGAGCGTGG + Intronic
1076929237 10:133518654-133518676 GGTGCGGAGGAGGTTGACCAGGG - Intergenic
1077310958 11:1888974-1888996 GGTGCTGAGGGAAGTCTGCATGG - Intronic
1077331058 11:1983976-1983998 GGGGCTGAGGAGAGTGAGCAGGG - Intronic
1077347442 11:2070196-2070218 GGGGTTGAGAGGATGGAGCATGG - Intergenic
1077363005 11:2149138-2149160 GGAGCTGCGGGGACTGCGCAGGG - Exonic
1080422566 11:32124470-32124492 GGTGCTGTGGGCATGGAGGAAGG + Intergenic
1080779885 11:35419866-35419888 GGTGCTCCGGGGAGTGAGGAGGG - Intronic
1082129248 11:48468303-48468325 GGTTGTGAGGGGCTAGAGCAGGG - Intergenic
1082562782 11:54639195-54639217 GGTTGTGAGGGGCTAGAGCAGGG - Intergenic
1082785659 11:57314905-57314927 GTTGCAGAGGGGAGTGAGCATGG - Intronic
1082880453 11:58031812-58031834 GTAGATGAGAGGATTGAGCATGG - Exonic
1082930196 11:58595100-58595122 GCTGCTGAGGGAACTGAACACGG - Intronic
1083886784 11:65576950-65576972 AGTGCTGGGAGGATTGAGGAGGG + Intronic
1084084796 11:66850050-66850072 GGTGCAGAATGGATTGAGCCGGG - Exonic
1084356313 11:68641134-68641156 GGAGCTGAGGGGTGGGAGCAGGG + Intergenic
1085457953 11:76676045-76676067 GGTGAGGAGGGGACTGAGAAGGG + Intergenic
1087006531 11:93477389-93477411 GATGCTGTGAGGATGGAGCAAGG - Intergenic
1089046238 11:115503987-115504009 GGTGCAGAGTGGAGTGAGAATGG - Intronic
1089311571 11:117561531-117561553 GGTTCTGGGTGGATGGAGCAAGG - Intronic
1089590569 11:119537793-119537815 TGTGCTGAGGGAAGTGAGAAAGG + Intergenic
1090150846 11:124382477-124382499 GTAGATGAGGGGATTGAGCATGG + Exonic
1090152135 11:124396485-124396507 GTAGATGAGAGGATTGAGCATGG + Exonic
1091041951 11:132289547-132289569 GGGGGTGAGGGGATGGAGTATGG - Intronic
1202814039 11_KI270721v1_random:39152-39174 GGGGCTGAGGAGAGTGAGCAGGG - Intergenic
1091449649 12:564559-564581 GGTGCTGTGGGTAGGGAGCAAGG + Exonic
1092626183 12:10331783-10331805 GGTGATGATGGGATTGGGAAGGG - Intergenic
1098271623 12:68775465-68775487 CGTGGTGAGGGACTTGAGCATGG + Exonic
1099974546 12:89532836-89532858 GGGGCTGTGGGGAGAGAGCATGG + Intergenic
1100702310 12:97161482-97161504 GGTGAGGAGGGGAGTGAGGAGGG + Intergenic
1100974913 12:100112393-100112415 GTTACTGAGGGGACTGAGCTGGG + Intronic
1103239779 12:119403578-119403600 GGGGCTGAGGGGTTTGAGTGTGG - Intronic
1103738561 12:123076597-123076619 GGTGCAGTGGGGATTGAGGGTGG - Intronic
1104637375 12:130446819-130446841 GGTGCTGTGTGGATGGAGCTTGG + Intronic
1104650010 12:130524676-130524698 GGTGTTAAGGGGATTGAAGAAGG + Intronic
1105811615 13:24001035-24001057 GGGGGTGAGGGGAGTGAACAAGG - Intronic
1106252660 13:27994534-27994556 GGTGGTGAGGGGCTGGAGGAAGG + Intergenic
1108416856 13:50206235-50206257 GGTGATGGGGGGATTGGGAATGG + Intronic
1109111858 13:58331002-58331024 GCTGCTGAGAGGGTTGAGTAAGG + Intergenic
1109305668 13:60638045-60638067 GGTCCTGATGGGATGGAGCCTGG - Intergenic
1110252648 13:73397681-73397703 GGTGGTGAGGCCAATGAGCAGGG + Intergenic
1110500717 13:76224572-76224594 GATTCTGTGGGGATTCAGCATGG + Intergenic
1111474319 13:88725450-88725472 GGTGCTGTGGGCATTGTGGATGG + Intergenic
1111994624 13:95152441-95152463 TGGGCTCAGGGGATTTAGCAAGG + Intronic
1112350421 13:98628649-98628671 GGCGCTGGGGAGATTGAGTAGGG + Intergenic
1112939643 13:104845589-104845611 GGGGCTGAGGGGATGGAACCAGG - Intergenic
1113764327 13:112871422-112871444 GTGGCTGAGAGCATTGAGCAGGG + Intronic
1114402483 14:22422681-22422703 GGGGCTGAGGTCATTGAGTAAGG - Intergenic
1114616572 14:24071738-24071760 GGTGGTGAAGGGATTGGGCAGGG - Intronic
1118752583 14:68817544-68817566 GGTCCTGAGGGGAATGGGGAGGG + Intergenic
1119431369 14:74570132-74570154 TAGGCTGAGGGGATTGAGCTAGG + Intronic
1119860522 14:77932764-77932786 GGTGCAGAAGGGATTGAGCTGGG + Intronic
1122076679 14:99239645-99239667 GATGCTGAGGGGATAGAAAAAGG - Intronic
1122625083 14:103080937-103080959 GGTGCTGAGCGGATGGATGAAGG + Intergenic
1123478742 15:20612139-20612161 GGTTCTGAAGGGAGTGAGGATGG + Intergenic
1123639271 15:22388246-22388268 GGTTCTGAAGGGAGTGAGGATGG - Intergenic
1127499499 15:59543343-59543365 GTTAGTGAGGGGATTGAACACGG + Intergenic
1128887544 15:71302593-71302615 GGTGCTGGGGGCAGTGAGCAAGG + Intronic
1129198184 15:73983401-73983423 CGTGCTGGCGGGATTGGGCATGG - Exonic
1129988233 15:79937391-79937413 GCTGCTGAGGAGATTGAGGCAGG + Intergenic
1130012079 15:80159900-80159922 GGGGATGAGGGGATGCAGCAGGG + Intronic
1130152956 15:81324956-81324978 GGAGCTGCGGGGAGTGAGCCAGG + Intergenic
1130573007 15:85065750-85065772 GCTTCTGAAGGGATGGAGCACGG + Intronic
1130780548 15:87034014-87034036 GGTACTGTGTGGAATGAGCAAGG - Intergenic
1132087210 15:98918237-98918259 GGTGCTGTGGGGACTGCGGATGG - Intronic
1135063764 16:19292074-19292096 GGGGCTGAGTGGAGTGAGAAGGG - Intronic
1136052958 16:27666078-27666100 GATGCTGAGGGGTTTGGCCAGGG + Intronic
1136275165 16:29175554-29175576 TGTGCAGATGGGACTGAGCAAGG + Intergenic
1138102937 16:54268960-54268982 GCAGCAGAGGGGACTGAGCAGGG - Intronic
1139225364 16:65229245-65229267 GCAGCTGAGGGGATTTAGCATGG + Intergenic
1139665520 16:68452717-68452739 GGTGCTGCGGTGATCCAGCATGG + Intergenic
1139976472 16:70815399-70815421 GGTGGAGAGGGGATTGAGACAGG - Intronic
1140095028 16:71867829-71867851 TGTGCTCTGGGGATTGTGCATGG - Intronic
1140418620 16:74797224-74797246 GCTGCAGAGGGGAATGGGCAGGG + Intergenic
1141456351 16:84145004-84145026 GGCGCTGAGGGGACCGAGGAGGG + Intronic
1141544292 16:84753944-84753966 GGTGTTGAGGGGAGAAAGCAAGG + Intronic
1141741389 16:85895440-85895462 GGTGCAGAGGTGATGAAGCAAGG - Intergenic
1141798721 16:86292546-86292568 TGGGCTGTGGGGATTGAGGAAGG - Intergenic
1142192133 16:88722974-88722996 GGTGCAGAGGGTGCTGAGCACGG - Exonic
1144513936 17:15902028-15902050 GGGGCTGAGGGGAGGGAGAATGG - Intergenic
1147741846 17:42674488-42674510 GCTGCTCAGGGGATTGAGGAAGG + Intronic
1148243696 17:46016440-46016462 GGTGGGGAGGGGAGTAAGCATGG - Intronic
1148552477 17:48558705-48558727 GGTAGTGAGGAGTTTGAGCAGGG + Intronic
1148860093 17:50600250-50600272 GGTGATGAGGGGCTGGGGCAGGG - Intronic
1149439339 17:56661978-56662000 GGTGGTGAGGGGAGTGAAGAAGG - Intergenic
1151309049 17:73282337-73282359 GGTGCTCAGGGGAGAGTGCAGGG + Intergenic
1151564061 17:74887468-74887490 TGTGATGAGGGCATTGACCAGGG - Intronic
1152210607 17:79001215-79001237 AGTGCTGAGGGAGTTGAACAGGG - Intronic
1156839822 18:41598285-41598307 GGCGCTGAGGGGAAGGAGAATGG - Intergenic
1157312964 18:46566186-46566208 GGGGCTGAGGGGAAGGAGGAGGG - Intronic
1157493310 18:48138625-48138647 GGTGCTGAAGGGAAGAAGCAGGG + Intronic
1157884047 18:51349290-51349312 GGTGATCAGGAGATTCAGCAGGG - Intergenic
1160698701 19:496481-496503 GGGACAGAGGGGACTGAGCATGG + Exonic
1160821182 19:1058919-1058941 GGTGCTGAGGAACTTGACCAAGG + Exonic
1161288422 19:3480247-3480269 GGTACTGCGGGGGTTGAGAAGGG + Intronic
1161403588 19:4079958-4079980 GGTGCTGAGGGGATCCACCTGGG + Intergenic
1161439232 19:4280935-4280957 GGTGCTGAGGGGAGGGGGCTGGG - Intronic
1161490434 19:4558161-4558183 GGTGGAGAGGGGTGTGAGCAAGG + Intronic
1161814971 19:6494444-6494466 GGGGCTGAGGGGAGTGAGGCAGG + Exonic
1163433126 19:17280231-17280253 GTTGATGCGGGGATTGAACAGGG - Intronic
1163497746 19:17656395-17656417 GGGGCTGTGGGGATGGAACAGGG + Exonic
1165136784 19:33674632-33674654 GGCGGAGAGGGGATGGAGCAGGG + Intronic
1165375795 19:35440803-35440825 GGGGTTGAGGGGATTGAGGATGG - Intergenic
1165792567 19:38500726-38500748 GGTGCAGAGGGGATGGAACTTGG + Exonic
1166211099 19:41306931-41306953 GAAGCTGAGGGGCTGGAGCAGGG - Exonic
1166385196 19:42376692-42376714 GGTGCTGGGGGCAGTGGGCATGG + Exonic
1168562613 19:57396456-57396478 GGTGTGGAAGAGATTGAGCAAGG + Intronic
1168639306 19:58020195-58020217 GGTCGTGAGGTGACTGAGCAGGG + Intergenic
925032618 2:662600-662622 GGAGCTGAAGGGAATGAGCCGGG - Intergenic
925917368 2:8616183-8616205 GGAGCTGATGGGATGGAGAAGGG - Intergenic
925959701 2:9003564-9003586 GTTGCTGAGGGGCTGCAGCAGGG + Exonic
926609019 2:14926767-14926789 GGGGCTGAGGGGAGAGAGAATGG - Intergenic
926974551 2:18501247-18501269 TGTGCTTAGGGGGTTGGGCATGG + Intergenic
927884807 2:26711862-26711884 GGGGCTGGGGGGAGGGAGCAGGG + Intronic
927940806 2:27101744-27101766 GCTCCTGAGGAGATGGAGCAAGG + Exonic
929089446 2:38200485-38200507 GGTGCTGAGGGGACTATGTAGGG - Intergenic
932274680 2:70443069-70443091 GGAGGTAAGGGGATTGAGCAGGG + Intergenic
933635181 2:84700982-84701004 GGTGAAGAGGGGACTGGGCAGGG + Intronic
934066744 2:88348465-88348487 GGTGATGATGGAGTTGAGCATGG - Intergenic
936012150 2:108931617-108931639 GGGATTGAAGGGATTGAGCATGG + Intronic
939891207 2:147738452-147738474 GGTGCAGAGGGGATTAAAGATGG + Intergenic
941301007 2:163801301-163801323 AGTGCAGAGGGGATTCAGCAAGG - Intergenic
941686495 2:168454028-168454050 GGTGCTGATGGGATTTGGGATGG + Intergenic
942715113 2:178882864-178882886 GGAGTTGAGGGGATGGAGGATGG + Intronic
942825865 2:180175580-180175602 GGGGCAGAGGGGAGTGAGGAAGG - Intergenic
942972904 2:181978655-181978677 GGAACTGAGTGGAATGAGCATGG + Intronic
944646825 2:201788424-201788446 GGTGTTGAGGAGAATGATCAGGG + Intergenic
945625370 2:212198367-212198389 GGGGCTGTGGGGAATGAGAATGG - Intronic
946669191 2:222084572-222084594 GGCGCTGAGTTGAATGAGCAAGG - Intergenic
947603165 2:231467190-231467212 GGTGGTGAGAGGTGTGAGCATGG + Intronic
948882766 2:240868903-240868925 GATGGAGAGGGGCTTGAGCAGGG - Exonic
1169551985 20:6710430-6710452 AGTGCTGAGGGTAAAGAGCAAGG + Intergenic
1171400372 20:24869136-24869158 AGTGCTGATGGGATTGGCCAGGG + Intergenic
1172670738 20:36632994-36633016 GGTGCTTTGGGGACTGAGCAGGG - Intronic
1172896618 20:38304705-38304727 GTTGCTGAGGAGGCTGAGCAGGG + Intronic
1173959062 20:47057269-47057291 GGAGGTGAGGGGATGGGGCAGGG + Intronic
1174216680 20:48921552-48921574 GGTGGGGAGGGGAGTGGGCATGG - Intergenic
1176270590 20:64233854-64233876 GGTGCTGAGGGCCTGGAGCCAGG + Intronic
1176286491 21:5021724-5021746 GGTGCGGTGGGGAAGGAGCAGGG + Intergenic
1176299357 21:5091206-5091228 GGAGCTGAGGGGCCTGGGCAGGG + Intergenic
1179630067 21:42672267-42672289 GGAGCTGAGGGCCTGGAGCAGGG + Intronic
1179857669 21:44170741-44170763 GGAGCTGAGGGGCCTGGGCAGGG - Intergenic
1179870690 21:44241751-44241773 GGTGCGGTGGGGAAGGAGCAGGG - Intergenic
1181582829 22:23837417-23837439 GGTCCTGATGGGAGTGAGGATGG - Intronic
1182734075 22:32518302-32518324 GGGGCTGAGGAGACTGAGCTTGG + Exonic
1183899049 22:40991364-40991386 GGTGCTGCGAGGTTTGAGGAAGG - Intergenic
1184209249 22:43025600-43025622 AGTGCTCAGGGGAGTGAGGAGGG - Intergenic
1184230334 22:43155272-43155294 GCTGCTGTGGGGACTGAACAAGG + Intronic
1184235377 22:43180399-43180421 AGTGGTGAGGGGCTGGAGCATGG + Intronic
1184421325 22:44384464-44384486 GGTGCTGAGTGGCTGGAGCCTGG + Intergenic
1184885669 22:47343348-47343370 GGTAGGGAGGGGATTGAGTAGGG - Intergenic
949608803 3:5682508-5682530 AGTGCTGAGTGGCTTGGGCAAGG - Intergenic
949988192 3:9555699-9555721 GATGCTGAGGGCAGGGAGCAGGG + Intergenic
952496001 3:33916272-33916294 GAAGCTGAGGGAATTAAGCATGG + Intergenic
953414602 3:42708530-42708552 GGGGGTGAGGGGATAGGGCAGGG + Exonic
953417804 3:42732895-42732917 GGTCCTGTGGGGACTGGGCAGGG + Exonic
954700566 3:52448765-52448787 GGTGCTGGGGAGAGTGGGCAGGG - Intergenic
955668083 3:61371329-61371351 GGTGGGGAGGGGACAGAGCAGGG + Intergenic
956325655 3:68049775-68049797 GGTGGTGAGGGGAAGGAGCAGGG + Intronic
962251950 3:133840967-133840989 GGTGCAGAGAGGCTGGAGCAGGG + Intronic
962887238 3:139638793-139638815 GGTGGGGAAGGGATTAAGCAGGG - Intronic
963705700 3:148685480-148685502 GATGCTGAGAGAATTGAGCCAGG - Intergenic
963822704 3:149915829-149915851 GGGACTGAGGGGACTGAGGAAGG + Intronic
965694159 3:171389753-171389775 TGTACTTAGGGGATTGATCAGGG + Intronic
966943606 3:184762048-184762070 GGGGCTGAGGGATGTGAGCAGGG + Intergenic
967321231 3:188197304-188197326 GGTGGTGATGGTATTGAGCAGGG - Intronic
967453101 3:189649737-189649759 GGATCTGAGGGGAATGAGGATGG + Intronic
968274945 3:197433824-197433846 AGTGCTGAGGGGACTCAGCAGGG + Intergenic
968531379 4:1093772-1093794 GGTCCTGCTGGGATGGAGCAGGG + Intronic
969186015 4:5474905-5474927 AGAGCTCAGGCGATTGAGCAAGG + Intronic
969478963 4:7436951-7436973 GCTGCTGAGGGGAGTGGGAACGG - Intronic
970365338 4:15352584-15352606 GTTGCAGAAGGGCTTGAGCAAGG + Intronic
971264766 4:25087965-25087987 GGTGCAGAGGGCGTGGAGCAGGG + Intergenic
973097770 4:46224336-46224358 GGTCCTGAGGAGAATCAGCAGGG - Intergenic
974475294 4:62371144-62371166 GAGGGTGAGGGGATTGATCATGG + Intergenic
976302680 4:83530177-83530199 GGTCCTGAGGAGAATGAGCAAGG - Intergenic
976744420 4:88389199-88389221 GGTCTTGAGAGGAGTGAGCAGGG + Intronic
977796181 4:101167836-101167858 GGGGCTGAGGTGAATGAACAAGG + Intronic
980237795 4:130131467-130131489 GGTGCTGTTGGGAGTGGGCATGG + Intergenic
980867689 4:138572673-138572695 GTTGTTGAGGGGATTGAATAAGG + Intergenic
981037860 4:140190946-140190968 GATGCTGAGGGATTTGAACAGGG + Intergenic
985166198 4:187097363-187097385 GATCCTGAGGGGATAGAGCATGG - Intergenic
985750149 5:1668852-1668874 GGTGCTGTGGGCATTGTGAAAGG + Intergenic
986192097 5:5506995-5507017 GCTGCTTGGGGGATTGAGCTGGG + Intergenic
987097153 5:14560253-14560275 GTTGCTGATGGGAGGGAGCAGGG - Intergenic
987230865 5:15892206-15892228 GGTCCTGAGGGAAGTGTGCATGG + Intronic
991011554 5:61888124-61888146 TGTGCTGGGCAGATTGAGCAGGG - Intergenic
991105226 5:62835501-62835523 CCTGCTGAGGGGCTTTAGCAGGG + Intergenic
992533851 5:77678493-77678515 GTTGCAGAGGGGATGGAGGAAGG + Intergenic
996341397 5:122442956-122442978 GGTGAGGAGGGGACTGAGTAAGG + Intronic
998215653 5:140237038-140237060 GCTGCTGAGGAGCCTGAGCAAGG - Intronic
998253110 5:140565803-140565825 GCTTCTGATGGAATTGAGCAAGG + Exonic
1001103881 5:168836368-168836390 GGAGCTGAGGGGATGGTGAAAGG + Intronic
1001799933 5:174534368-174534390 AGTGCTGAGGGGCTTGGGGAGGG - Intergenic
1002087764 5:176786365-176786387 GGTGCTGAGGGGCTGGAGCATGG + Intergenic
1002091492 5:176809460-176809482 GGTCGGGAGGGGAATGAGCAGGG - Intergenic
1002454961 5:179340699-179340721 GGTGCTGTGAGGATTAAACAAGG + Intronic
1002632435 5:180590732-180590754 GGTGCCGAGGGGGTTGGCCAGGG + Exonic
1005802033 6:29436091-29436113 GGTGCTGTGAGTATTGAGCTAGG - Intronic
1005879306 6:30042996-30043018 GGTGCTGAGGGGTGTGAGGCAGG + Intergenic
1006102192 6:31692577-31692599 GTTGCTGAGGAGATTAAGTAAGG - Intronic
1006181408 6:32155312-32155334 GGTGCTGAGGGAAGTCAGAAAGG - Intronic
1007716871 6:43861836-43861858 GGTGTTGGGGGGAGGGAGCAGGG + Intergenic
1008455045 6:51700377-51700399 GGTGGGGAGGAGATTGAGCTTGG - Intronic
1010766449 6:79781298-79781320 GGTGCTAAGGAGAGGGAGCAGGG + Intergenic
1011334346 6:86243451-86243473 GGTGGTGTGAGGTTTGAGCAAGG + Intergenic
1014440228 6:121465356-121465378 GGTGAAGAGGGGATTGGGCAGGG + Intergenic
1016896949 6:149062827-149062849 GGTACTGGGAAGATTGAGCAAGG + Intronic
1017318040 6:153055213-153055235 GGTGCTGAGGGGATTGGTGTGGG + Intronic
1018964678 6:168475418-168475440 GGTGGGGGAGGGATTGAGCAAGG - Intronic
1022385804 7:29898056-29898078 GGTGCTGAGGGGAGAAAGCCTGG - Intronic
1022955480 7:35376535-35376557 GCTGCTGAGGGAATTGAAAAGGG - Intergenic
1024220906 7:47285705-47285727 GCTTCTGAGGAGATTGAGAAAGG + Intronic
1027130452 7:75586691-75586713 GGGGCTGAAGGGATGGAGCAGGG + Intronic
1028929679 7:96398478-96398500 GCTGCTCAGGGGATGGAGGAGGG + Intergenic
1033597778 7:142868955-142868977 GCTGCTGAGGGGAAGGGGCAGGG - Exonic
1034553994 7:151838332-151838354 GGTGCTGAGGGGATTGAGCAAGG - Intronic
1035745053 8:1955888-1955910 GGAGCTGGGGGGACTGTGCAGGG - Intronic
1037753177 8:21695836-21695858 GGGACTGAGGTGACTGAGCAAGG - Intronic
1038190912 8:25319489-25319511 GGGGGTGAGGGGCTTGTGCATGG + Intronic
1038363041 8:26902006-26902028 GTGGCTGAGGAGAGTGAGCAAGG + Intergenic
1040034656 8:42858765-42858787 TGTGCTGAGAGCATAGAGCAGGG + Intronic
1042236897 8:66622294-66622316 GGTGGTGAGGGGACAGAGAATGG + Intergenic
1042416797 8:68529051-68529073 CATGCTGAGGGGAATGAGCTAGG - Intronic
1042507285 8:69574060-69574082 GGTGGTGTGTGGATTGAGGAGGG - Intronic
1042666599 8:71213671-71213693 GGTGCTGATGGGATTCATCCAGG - Intronic
1043993843 8:86788586-86788608 AGTCCTGAGGGGTTTGAGCAGGG - Intergenic
1047680625 8:127250779-127250801 GCTGTTGAGGGCAGTGAGCAGGG - Intergenic
1048719966 8:137312403-137312425 GATGCTGAGGAAATTGAGAAGGG - Intergenic
1048839152 8:138549854-138549876 GTTGCTGATGGGCTTGAGGAAGG + Intergenic
1052914785 9:33916481-33916503 GGTGCTTAGGGGATTGGCTAGGG - Intronic
1053249495 9:36562524-36562546 GGGGATGAGGGGAGTGAGGAAGG - Intergenic
1054971254 9:71090177-71090199 GATGGTGAGGGGATTGAACAAGG + Intronic
1055631302 9:78226631-78226653 GCTACTCAGGGGATTGAGGAGGG + Intergenic
1055914591 9:81387975-81387997 GGTGCTAAATGGGTTGAGCAGGG + Intergenic
1057483235 9:95462065-95462087 TGGGCTGAGGAGACTGAGCAGGG + Intronic
1058969563 9:110068360-110068382 GTTGCTGAGGGGAATGACAATGG + Intronic
1060010138 9:120036673-120036695 GGTGCAGGTGAGATTGAGCAAGG + Intergenic
1060883486 9:127134888-127134910 GGTGGAGAAGGAATTGAGCATGG - Intronic
1061084208 9:128389840-128389862 GGAGCTTAGGGGACAGAGCAGGG - Exonic
1061448383 9:130655024-130655046 GGAGCTGGGGGCATGGAGCAAGG - Intergenic
1185625730 X:1480671-1480693 GGGGGTGAGGGGATAGAGGAGGG + Intronic
1185858764 X:3559025-3559047 GCTGCTGAGGGGAAGGAGAAGGG + Intergenic
1186226779 X:7407408-7407430 GGGGTTGAGATGATTGAGCATGG - Intergenic
1186387092 X:9120936-9120958 GGTGGTCAGGGGCTGGAGCAGGG + Intronic
1186393195 X:9181713-9181735 GGTCCTGGGGGGATTTAGGATGG + Intergenic
1186565740 X:10660388-10660410 AGCGCTGTGGTGATTGAGCAGGG - Intronic
1189368498 X:40408978-40409000 TGTGCTGTGGGGATTAAGGAGGG + Intergenic
1193038234 X:76976823-76976845 GGTACATAGGGGATTGAGCCAGG + Intergenic
1194294073 X:92107134-92107156 AGTGATGAAGGGATTGAGGAGGG - Intronic
1195755612 X:108196148-108196170 TATTCTGAGGGAATTGAGCAGGG - Intronic
1195767175 X:108308117-108308139 GTGGCTGAGGGGATGGAGGATGG - Intronic
1195989524 X:110668669-110668691 GGTGAGGAGAGGAGTGAGCAGGG - Intergenic
1196085881 X:111681729-111681751 AGTGCTGAGGGGAAGGAGCCGGG - Intronic
1196745433 X:119067643-119067665 GGTGCTGTGGTGATATAGCATGG + Intergenic
1197183782 X:123563691-123563713 GGGGCTGAGGGGAGTGAGGCAGG - Intergenic
1199696776 X:150348239-150348261 TCTGCTGAGGGGTTTGAGAATGG + Intergenic
1199934541 X:152559601-152559623 AGTGATGAGGGGATGGAGGAAGG - Intergenic
1200021526 X:153214759-153214781 GCTTCTGAGGGGATTGGGCTGGG - Intergenic
1200154209 X:153966783-153966805 GGTGCTCAGGGGAGTGAGGGTGG - Intronic
1200611581 Y:5331653-5331675 AGTGATGAAGGGATTGAGGAGGG - Intronic
1202248616 Y:22844942-22844964 TGTCCTCAGGGGGTTGAGCACGG - Intergenic
1202401604 Y:24478690-24478712 TGTCCTCAGGGGGTTGAGCACGG - Intergenic
1202469177 Y:25191393-25191415 TGTCCTCAGGGGGTTGAGCACGG + Intergenic