ID: 1034558555

View in Genome Browser
Species Human (GRCh38)
Location 7:151865159-151865181
Sequence TGCCATGGCCAAGGGGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 311}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034558544_1034558555 26 Left 1034558544 7:151865110-151865132 CCACAGGCAGAGTCTGTCCCTCC 0: 1
1: 0
2: 4
3: 42
4: 344
Right 1034558555 7:151865159-151865181 TGCCATGGCCAAGGGGCCTGAGG 0: 1
1: 0
2: 5
3: 34
4: 311
1034558549_1034558555 0 Left 1034558549 7:151865136-151865158 CCTTGAGTCTCAGCCGTGTGACT 0: 1
1: 1
2: 1
3: 15
4: 135
Right 1034558555 7:151865159-151865181 TGCCATGGCCAAGGGGCCTGAGG 0: 1
1: 0
2: 5
3: 34
4: 311
1034558545_1034558555 9 Left 1034558545 7:151865127-151865149 CCCTCCATCCCTTGAGTCTCAGC 0: 1
1: 0
2: 2
3: 25
4: 333
Right 1034558555 7:151865159-151865181 TGCCATGGCCAAGGGGCCTGAGG 0: 1
1: 0
2: 5
3: 34
4: 311
1034558543_1034558555 30 Left 1034558543 7:151865106-151865128 CCATCCACAGGCAGAGTCTGTCC 0: 1
1: 0
2: 2
3: 23
4: 248
Right 1034558555 7:151865159-151865181 TGCCATGGCCAAGGGGCCTGAGG 0: 1
1: 0
2: 5
3: 34
4: 311
1034558546_1034558555 8 Left 1034558546 7:151865128-151865150 CCTCCATCCCTTGAGTCTCAGCC 0: 1
1: 1
2: 1
3: 140
4: 4834
Right 1034558555 7:151865159-151865181 TGCCATGGCCAAGGGGCCTGAGG 0: 1
1: 0
2: 5
3: 34
4: 311
1034558548_1034558555 1 Left 1034558548 7:151865135-151865157 CCCTTGAGTCTCAGCCGTGTGAC 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1034558555 7:151865159-151865181 TGCCATGGCCAAGGGGCCTGAGG 0: 1
1: 0
2: 5
3: 34
4: 311
1034558547_1034558555 5 Left 1034558547 7:151865131-151865153 CCATCCCTTGAGTCTCAGCCGTG 0: 1
1: 0
2: 1
3: 26
4: 142
Right 1034558555 7:151865159-151865181 TGCCATGGCCAAGGGGCCTGAGG 0: 1
1: 0
2: 5
3: 34
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034558555 Original CRISPR TGCCATGGCCAAGGGGCCTG AGG Intronic
900653816 1:3745164-3745186 TCCCAGGCCCAAGGAGCCTGGGG - Intergenic
900793167 1:4692563-4692585 CGCCATGGTCAGGAGGCCTGCGG - Intronic
900828756 1:4949008-4949030 TGCCATGGCCCAGTGTCCAGTGG - Intergenic
901442954 1:9290681-9290703 TGCTACGGCCACGTGGCCTGGGG - Intergenic
902384772 1:16070152-16070174 TGCCCTGGCCATGTGACCTGAGG + Intronic
902738559 1:18418050-18418072 TGGCATGGACAAAGGCCCTGTGG - Intergenic
903550597 1:24155293-24155315 TGACATGGACAAGGGGTCAGAGG + Exonic
905522792 1:38613367-38613389 TGCCTTGACAAAGGGGCGTGGGG + Intergenic
905741398 1:40374104-40374126 TGTCATGGCCAGGGTGCCGGCGG - Exonic
905807421 1:40887011-40887033 TGCCATAGGCAAGGGGCTGGGGG - Intergenic
905975012 1:42168374-42168396 AGCCTTGGCCAGGGGGGCTGTGG - Intergenic
906280519 1:44550188-44550210 TGGCTTTGCCAAGGGGACTGTGG - Intronic
907159796 1:52361600-52361622 GGCCATGGGCAGGGGGGCTGGGG + Exonic
907302725 1:53498657-53498679 AGCCATCTCCACGGGGCCTGGGG - Intergenic
907303482 1:53502005-53502027 TGGGAGGGACAAGGGGCCTGGGG + Intergenic
908117483 1:60954216-60954238 TGCCATGGGCAGGGGGCCGTGGG - Intronic
908353093 1:63305593-63305615 TGCCATGGCCAAGAGACCTAAGG - Intergenic
910710470 1:90174550-90174572 TGCCATGGCTGCAGGGCCTGGGG + Intergenic
911254093 1:95614411-95614433 TGCCACGGCCAGAGGGCCAGTGG - Intergenic
912373357 1:109190751-109190773 AGCCATGCCCAAGCGGGCTGGGG - Intronic
912500074 1:110115773-110115795 TGCCATGGACCAGTGGACTGAGG - Intergenic
912978653 1:114351345-114351367 TGCCAGGGCCCAGGAGCCAGTGG - Intergenic
913978522 1:143487397-143487419 AGCCAAGGTCCAGGGGCCTGAGG + Intergenic
914072933 1:144313045-144313067 AGCCAAGGTCCAGGGGCCTGAGG + Intergenic
914106221 1:144653315-144653337 AGCCAAGGTCCAGGGGCCTGAGG - Intergenic
914921412 1:151850073-151850095 TGGGATGGCCAAGGTGACTGAGG + Intronic
915029143 1:152861132-152861154 AGCCAAGGCCAAGAGGCCTGAGG - Intergenic
915062788 1:153200272-153200294 TGCTATGGAGAAGGGGTCTGAGG + Intergenic
915440328 1:155941835-155941857 TGCCCTGGCCTATGGGCTTGTGG + Exonic
916057395 1:161077370-161077392 TGGCATGGCTCAGGGACCTGTGG + Intronic
918216340 1:182394637-182394659 TGCCATGTCCAAGGGGTGGGTGG + Intergenic
921324473 1:213977503-213977525 TGGCTTTGCCAAGGGGCCTTGGG - Intergenic
923540684 1:234886092-234886114 TCCCATGGCCCAGGGGTCTATGG + Intergenic
924707110 1:246510241-246510263 GGCCAAGGCCCAGGGGCGTGAGG - Intergenic
1063074364 10:2700183-2700205 TCCAATGGCCCAGGGGCATGTGG + Intergenic
1063368755 10:5507584-5507606 TGCAATGGCCAGGGGGACTGAGG + Intergenic
1063520940 10:6740034-6740056 TGCCATGGCCTCTGGGCCTTTGG + Intergenic
1066442896 10:35455510-35455532 TGCAATGGCCTTGGGACCTGGGG + Intronic
1066453355 10:35550877-35550899 AGCCAGGGGCAAGGGACCTGGGG - Intronic
1067031932 10:42884171-42884193 TGGCCTGGGGAAGGGGCCTGGGG + Intergenic
1069559847 10:69421767-69421789 TGCCCAGGCCAAGGGGCAGGGGG - Intergenic
1070758259 10:79006730-79006752 TGCCAGGGGCCAGGGGCCTGGGG - Intergenic
1070813830 10:79311395-79311417 GGCTATGGCCAAAGGGACTGGGG - Intronic
1072275576 10:93819519-93819541 TCACATGGCCAGGGGGCCTCAGG + Intergenic
1074104178 10:110376373-110376395 GGCCAAGGCCAAGTCGCCTGGGG - Intergenic
1074272049 10:111963806-111963828 TGCAATGGACAAGGAGCCTGGGG - Intergenic
1074420954 10:113308601-113308623 TGCCATGGGCTAAGGGCTTGGGG - Intergenic
1074719284 10:116250762-116250784 AGCTATGGCCAGGGGTCCTGAGG - Intronic
1075802722 10:125162328-125162350 AGCCAGGGCCAGGGGGCCGGAGG + Intergenic
1076354446 10:129841767-129841789 AGCCATGGCCTAGGGAGCTGAGG - Intronic
1076941847 10:133615361-133615383 GGCCATGCACAAGTGGCCTGGGG - Intergenic
1077209434 11:1361982-1362004 TGAGATGGTCAAGGGCCCTGAGG + Intergenic
1077303365 11:1857061-1857083 TGCCCTGGGTAAGGGGTCTGAGG + Intronic
1077318339 11:1929036-1929058 AGCAGTGGGCAAGGGGCCTGTGG - Intronic
1077319567 11:1935207-1935229 AGCCATGGCCAAGTGGACTCAGG + Intronic
1077976467 11:7252590-7252612 TCCCATCGCCAAGGCTCCTGGGG + Intronic
1078325113 11:10374169-10374191 AGTCATGGCCTAGGGGCCTGAGG - Intronic
1081701460 11:45155307-45155329 CACGATGGCCAAGGGGCATGGGG + Intronic
1081802495 11:45869655-45869677 GGCCCTGGCCAAGTGGGCTGAGG + Exonic
1081884603 11:46484118-46484140 TGCCATGCACAAGGGGCCCAAGG + Intronic
1082027534 11:47583898-47583920 TGCCAAGGGCACCGGGCCTGAGG + Intronic
1083256931 11:61502332-61502354 TGGCATGTCCAAAGGTCCTGGGG + Intergenic
1083777731 11:64902439-64902461 TGCCATGGCCCTCGGGCCTGGGG - Intronic
1083802160 11:65053102-65053124 TGCCATGCCTGAGGGCCCTGGGG - Intronic
1084162338 11:67356614-67356636 TGGCAGGGCCCAAGGGCCTGAGG - Intronic
1084500151 11:69530492-69530514 AGCCATGGGGGAGGGGCCTGGGG + Intergenic
1084591752 11:70094385-70094407 TGCCAGTGCCCAGGGCCCTGTGG - Intronic
1084683541 11:70680702-70680724 TGGCATGGCCAAGTGAACTGTGG - Intronic
1085181787 11:74542606-74542628 AGACAAGGCCATGGGGCCTGAGG + Intronic
1086077142 11:82866678-82866700 TGCCATGTACAAGGGCACTGTGG - Intronic
1089332844 11:117701866-117701888 TGCCATGGGCATGAGGTCTGGGG - Intronic
1089492713 11:118893862-118893884 TGCCGTGGCCGAGGGCTCTGTGG + Exonic
1089949915 11:122516007-122516029 TGCAAGGGGCAAGGGGACTGGGG + Intergenic
1090025452 11:123163652-123163674 TGCCAGGCCCTAGGGGCCAGTGG - Intronic
1090496930 11:127222263-127222285 TGCAGTGGCCAAGGGCCTTGGGG - Intergenic
1091516815 12:1192579-1192601 AGCCATGGCCAAGGGGCAGAAGG - Intronic
1091750213 12:3017628-3017650 TGCCCTGGCCAAGAGGACTCAGG - Intronic
1092083656 12:5738312-5738334 TGCCTTGGACTAGGGACCTGGGG - Intronic
1092333473 12:7606872-7606894 TGCCATGTGCCTGGGGCCTGGGG - Intergenic
1093097624 12:14989824-14989846 TGCCATGGACATGGGGCCTGTGG - Intergenic
1094820104 12:34217906-34217928 TGCCATATCCAACGGCCCTGGGG + Intergenic
1095953112 12:47792042-47792064 AGCCAAGGCCATGGGGCGTGAGG - Intronic
1096232650 12:49904842-49904864 TGCCAAGGCCACGCGGCCAGTGG - Intergenic
1096396499 12:51270181-51270203 TGCCACGGCCGAGGTGGCTGCGG + Intronic
1099510401 12:83528977-83528999 TGCCATGGTCCTGGGGCATGAGG + Intergenic
1102539654 12:113609650-113609672 TGGCATGAGCAAGGGTCCTGAGG + Intergenic
1102923906 12:116812417-116812439 TGCCACGCCCCAGGGACCTGCGG - Intronic
1103884636 12:124191374-124191396 TACCATGCCCAAGCCGCCTGTGG + Intronic
1103928809 12:124438240-124438262 TCCCAGAGCCGAGGGGCCTGTGG + Intronic
1104797301 12:131528609-131528631 GGCCAAGGTCAAGGGGCCAGAGG + Intergenic
1105220806 13:18323998-18324020 AGCCAAGGTCCAGGGGCCTGAGG - Intergenic
1106224140 13:27772559-27772581 CACCATGGCCAAGGGCTCTGGGG - Intergenic
1108786557 13:53909971-53909993 TGCCATAGCCTGGGGCCCTGAGG + Intergenic
1113866694 13:113531115-113531137 TGCGGTGACCAAGGAGCCTGTGG - Intronic
1114618871 14:24082816-24082838 TTCCATGGCCAGGGGGCTGGGGG + Exonic
1119171487 14:72539371-72539393 TGCCATGGACAAAGGGTCTTGGG - Intronic
1119445947 14:74663509-74663531 TACCATGCCAAAGTGGCCTGTGG + Exonic
1119509362 14:75198880-75198902 AACCTTGGCCAAGGGGACTGAGG - Intergenic
1120865333 14:89291498-89291520 CGCCATCCCCAGGGGGCCTGTGG + Intronic
1121120221 14:91371768-91371790 TGCCCTGGCATAGGTGCCTGTGG - Intronic
1122204457 14:100141648-100141670 GGCCATGTCCAAAGGGCTTGGGG - Intronic
1122272266 14:100573551-100573573 AGCCAGGCCCACGGGGCCTGGGG + Intronic
1122319690 14:100846320-100846342 TGCCTTGCCCAGGGGGCCTGGGG + Intergenic
1123058037 14:105581644-105581666 GGCTCTGGCCAAGGGCCCTGGGG + Intergenic
1123121158 14:105917773-105917795 TGCCATGGCTCAGGGGCCCCAGG + Intergenic
1124253181 15:28120937-28120959 TGCCATGGAATAGGGTCCTGTGG - Intronic
1125513686 15:40306516-40306538 TGACATGCCCCAGGAGCCTGTGG - Intronic
1125522494 15:40356130-40356152 GGCCATGGCCCAGGGCCCTGCGG + Exonic
1125522526 15:40356196-40356218 GGCCATGGCCCAGGGCCCTGCGG + Exonic
1125794943 15:42397137-42397159 TGCTAAGGCCAGGGTGCCTGTGG - Intronic
1126727834 15:51651022-51651044 AGGCATGGCAAAGGGGCCAGTGG - Intergenic
1127311576 15:57756183-57756205 TGCCATTGCCAGGGGTTCTGGGG + Intronic
1128052476 15:64676046-64676068 TGGCAAGGCCAAGGAGCCAGGGG + Exonic
1128233321 15:66050484-66050506 TGCCATGTGCAAGGGGCAGGAGG + Intronic
1128501371 15:68229592-68229614 AGGCAGGGCCGAGGGGCCTGCGG - Exonic
1128548557 15:68583438-68583460 TGCCCTGGCAAGGGGTCCTGGGG + Intronic
1128945151 15:71814741-71814763 TGGCATGGCCATGGGTCCAGAGG + Intronic
1129000054 15:72325343-72325365 TGCCATGGCCAAAGGGGTTGAGG + Intronic
1129513117 15:76139454-76139476 GGCCCTGGCCCAGGGGCCTCAGG - Intronic
1129601359 15:77000387-77000409 TACCATGGCCCAGGGGCATCAGG + Intronic
1129608075 15:77034484-77034506 AGCCATGACTCAGGGGCCTGTGG - Intronic
1130053200 15:80501191-80501213 TCCTATGGCCAAGGGTGCTGGGG - Intronic
1130122225 15:81060875-81060897 TGGAATGGGGAAGGGGCCTGAGG - Intronic
1131071176 15:89466938-89466960 TGGGATGGCCAAGTTGCCTGTGG + Intergenic
1131110593 15:89762091-89762113 TGCCTTGGCCAAGGTGCCCCAGG + Intronic
1131265013 15:90910642-90910664 TGGCACGGCCAAGGAGGCTGTGG + Exonic
1132560367 16:590665-590687 TGCCATGGACCCGGGGTCTGGGG + Intronic
1132761257 16:1509578-1509600 AGCCATGGGAAAGGGGCCTGGGG - Intronic
1133688719 16:8192025-8192047 TGCCATGGCCATGCTGCCTTGGG - Intergenic
1133744718 16:8677312-8677334 TGCCAGGGCCAAGGTGCCTGGGG + Intronic
1134797357 16:17053790-17053812 TGCCATGGCAAAGGGAGGTGGGG + Intergenic
1135626818 16:24002745-24002767 TCACATGGCCAAGGAGCATGCGG + Intronic
1136060670 16:27724185-27724207 TGCCATGGCTATGTGGGCTGGGG - Intronic
1136178532 16:28535143-28535165 TCCCCAGGCCAAGGGGGCTGTGG - Intronic
1136382261 16:29901141-29901163 GGCCCTGGCCAAGAGGCCTGGGG - Exonic
1137875680 16:51994567-51994589 TGCCATGGCCCAGGGCACAGTGG - Intergenic
1138340605 16:56286791-56286813 CACCATGACCAAGGGGGCTGAGG + Intronic
1139370085 16:66461664-66461686 TGCCATGGCCAGGGGTCATGGGG + Intronic
1140770803 16:78202273-78202295 TGCCATGACCATGAGGCCTCTGG + Intronic
1141548914 16:84791377-84791399 TGCAATGCCCAAGAGGTCTGTGG - Intergenic
1141659002 16:85431616-85431638 TGCCATGGCCAAGTGTCTCGGGG - Intergenic
1141851720 16:86650635-86650657 TGCCAAGGACGAGGGCCCTGGGG + Intergenic
1142201962 16:88765335-88765357 TGCCCTGTCCCAGTGGCCTGGGG - Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143601346 17:7948226-7948248 TGCCATGGCTAAGGGAACTTTGG - Exonic
1143620170 17:8076040-8076062 GGCCTTGGGGAAGGGGCCTGGGG - Intronic
1145901758 17:28494491-28494513 TGCCCTGGCCAAGGGCAGTGAGG + Exonic
1147166866 17:38598170-38598192 TTCCATGGATAAGGGGGCTGGGG + Intronic
1147167815 17:38602768-38602790 TGCTCTTGCAAAGGGGCCTGTGG - Intronic
1147255293 17:39177575-39177597 GGGCATGGCCAAGGGGGTTGAGG + Intronic
1148201350 17:45752063-45752085 TGCCATGGCCACAGCCCCTGGGG + Intergenic
1149943778 17:60899260-60899282 TGCCATTGCCACCGGGACTGGGG - Intronic
1151243587 17:72777250-72777272 TGCCAGGTCAAAGGGGACTGGGG + Intronic
1151658274 17:75505781-75505803 TACCCTGCCCAGGGGGCCTGGGG - Intronic
1151963633 17:77420053-77420075 TTCCATGGCCCAGGCACCTGGGG - Intronic
1152105174 17:78324509-78324531 TGCCAAGGCAACCGGGCCTGTGG - Intergenic
1152198089 17:78929285-78929307 TGCCCTGGGCATGGGGCATGCGG - Intergenic
1152525517 17:80886161-80886183 GGCCGTGGTCCAGGGGCCTGGGG + Intronic
1152562200 17:81084158-81084180 TGCCATCGCTGAGGGCCCTGGGG - Intronic
1152757163 17:82091828-82091850 TGCCATGGCACAGGGGTCCGAGG + Intronic
1152822332 17:82443758-82443780 AGCCAAGGCCACGGGTCCTGTGG + Exonic
1155151254 18:23124793-23124815 TGCCCTTGGCAGGGGGCCTGAGG - Intergenic
1156459319 18:37312843-37312865 GTCCTTGGCCAAGGGTCCTGGGG - Intronic
1157624574 18:49040347-49040369 TGACCTGGCCAAGGGTCTTGGGG + Intergenic
1157904325 18:51554833-51554855 TTTCATGTCCAAGGGACCTGTGG + Intergenic
1158350883 18:56563536-56563558 TGCCATGGGAAGGGGGCCTGCGG + Intergenic
1159580771 18:70232389-70232411 TGACAAGGCAAAGGGGCTTGGGG + Intergenic
1159919465 18:74214588-74214610 TGCTATGGCCCGGTGGCCTGAGG - Intergenic
1160265189 18:77335959-77335981 TGCCACACCCCAGGGGCCTGGGG - Intergenic
1161322453 19:3647468-3647490 GGCCATGGCCCAGTGTCCTGGGG - Intronic
1161478354 19:4498526-4498548 TCTCCTGGCCAAGGGCCCTGGGG + Intronic
1161608206 19:5226294-5226316 GGCCAGTGCCAAAGGGCCTGAGG - Intronic
1162389708 19:10381979-10382001 TGCCATGGCCAAGGGACATGTGG + Intergenic
1163437170 19:17302784-17302806 TGCCATGGACACGGGGGCGGGGG - Intronic
1164296087 19:23911273-23911295 TGCCATGGCAAAGGTTACTGAGG - Intergenic
1165774239 19:38395532-38395554 TGGCAGGGGCAGGGGGCCTGGGG + Exonic
1165794690 19:38512022-38512044 TGCCATGGCTAAGAGGACAGAGG - Intronic
1166141627 19:40808299-40808321 TGCCATGGCCAAAGGGGTTGGGG - Exonic
1166313323 19:41975505-41975527 CTCCAGGGCCAGGGGGCCTGTGG + Intronic
1166677544 19:44748811-44748833 GGCCATGGACGAGGGGCCCGTGG + Exonic
1166684852 19:44790148-44790170 TGCCTTGGCTCAGAGGCCTGGGG + Intronic
1166720752 19:44994531-44994553 TGCCATGGCCTGTGGACCTGTGG - Intergenic
1167384179 19:49154577-49154599 TCCCATGGCCTCGGTGCCTGTGG + Exonic
1167593013 19:50414622-50414644 TGGCATTGCCGAGGGGCCTCAGG + Intronic
1167785005 19:51629433-51629455 TGCCATGGTCCTCGGGCCTGGGG + Exonic
1167787106 19:51645857-51645879 TGCCATGGTCCTCGGGCCTGGGG + Exonic
1168714372 19:58518475-58518497 TGCCATCTCGATGGGGCCTGTGG + Intronic
925144975 2:1575272-1575294 TGCCTTGGACTAGCGGCCTGTGG + Intergenic
925339378 2:3125743-3125765 TGGCAGGGCCCAGGGGGCTGAGG - Intergenic
925832458 2:7909839-7909861 GGTCATGGCCAAGATGCCTGTGG - Intergenic
926210944 2:10868946-10868968 TGCCACGGCCTAGGGGCCTGCGG + Intergenic
927506589 2:23619056-23619078 TCCCTGGGCCGAGGGGCCTGTGG - Intronic
928200309 2:29243582-29243604 GGGCATGGCCAAGGGGGCTTGGG + Intronic
929598055 2:43188400-43188422 TGCCAGGGCCAAGGGTCTTTAGG + Intergenic
930256973 2:49104163-49104185 TCCCAAGGCCATTGGGCCTGGGG - Intronic
931771016 2:65498158-65498180 TACCATGGCCAAGGGGGAGGGGG - Intergenic
932196620 2:69789500-69789522 TGTCATGGCCAAGGAGATTGAGG + Intronic
932269132 2:70393785-70393807 TGCCCTGCCCAAGGCACCTGTGG + Intergenic
932769051 2:74490293-74490315 TGACAGGGGCAAGGGGGCTGAGG + Exonic
933299316 2:80524601-80524623 AGCCATGGCCAAAGAGACTGGGG - Intronic
934183249 2:89648478-89648500 AGCCAAGGTCCAGGGGCCTGAGG + Intergenic
934293530 2:91722648-91722670 AGCCAAGGTCCAGGGGCCTGAGG + Intergenic
934717508 2:96552150-96552172 GGCCATGGGCGAGGGGCCTGCGG - Exonic
935328167 2:101956629-101956651 TGCAATGGCCATGGTGGCTGGGG + Intergenic
936890073 2:117359338-117359360 TGCTATCTCCATGGGGCCTGGGG + Intergenic
937381266 2:121379420-121379442 AGGCATGACCAAGGGGCCAGAGG + Intronic
940071320 2:149691230-149691252 TTCCATGGCAAAGGGACTTGTGG - Intergenic
941360618 2:164546888-164546910 ACCCATGGCCAGGGGACCTGTGG - Intronic
945639339 2:212403713-212403735 TGCCAGGGACTAGGGGCTTGGGG + Intronic
946155528 2:217804412-217804434 TGCCATGGGGAAGGGGCTTGTGG - Exonic
946405702 2:219490913-219490935 TGCGGTGGCCAAGGGGCCTAAGG - Exonic
947669791 2:231928913-231928935 GGCCATGCCCCTGGGGCCTGGGG - Intergenic
947705042 2:232267855-232267877 TGCCATGGCTAAGAAGCCTGAGG - Intronic
948764120 2:240210777-240210799 TGCCATTGCCACGAGGGCTGAGG - Intergenic
948826898 2:240577327-240577349 AGCCAGGGCCCACGGGCCTGAGG - Intronic
1171139528 20:22728979-22729001 GCCCATGGCCAAGGGACCAGTGG - Intergenic
1172512651 20:35511485-35511507 TGCCGTGGCCCAGGCCCCTGAGG + Exonic
1172628875 20:36365183-36365205 GGCCCTGGCCTAGGGGCCCGAGG - Intronic
1172786069 20:37469668-37469690 TGCCAAGGAGAAGAGGCCTGGGG - Intergenic
1173344510 20:42186421-42186443 TGGCATGGTCAAAGGTCCTGTGG - Intronic
1173458068 20:43219698-43219720 TGACATGTGCAAGGGCCCTGGGG + Intergenic
1173803821 20:45911447-45911469 GGCCATGGCGAGCGGGCCTGGGG + Exonic
1174841759 20:53907867-53907889 TGCTATGGCTAAGAGGTCTGTGG + Intergenic
1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG + Intergenic
1175422642 20:58844519-58844541 AGCCATGGTCAAGTGGCCTTAGG + Intronic
1178208078 21:30493442-30493464 TGCCATCGCCAAAGACCCTGGGG + Intergenic
1179279830 21:39924961-39924983 GGCCCTGGCCCAGGGGCATGAGG + Intronic
1179616021 21:42583949-42583971 TGCCCTGGCCATGTGCCCTGTGG + Intergenic
1179707960 21:43193546-43193568 CTCCATGGCCAGGGGACCTGGGG + Intergenic
1180616920 22:17134469-17134491 TTTCATGTCCAAGGGCCCTGTGG + Intergenic
1180974705 22:19841971-19841993 AGCCAAGGCCATGAGGCCTGAGG + Intronic
1180997516 22:19972797-19972819 TGCTACTGCCAAGGGGCCTAAGG - Exonic
1181291822 22:21800659-21800681 TTCCTAGGCCAAGGGGCCTGTGG + Intronic
1182447834 22:30399837-30399859 TGTCATTGCCAAGGGCCCTTTGG - Intronic
1182739704 22:32558775-32558797 TGCCTTGGCTAAGGGGCCCTTGG - Intronic
1183678321 22:39312213-39312235 TCCCATGCCCGAGGGGGCTGGGG + Intergenic
1183736171 22:39646062-39646084 GGCCAGGGCCTAGGGGTCTGAGG + Intronic
1184130470 22:42514063-42514085 GGCCAAGGCCGAGGGGTCTGAGG + Intronic
1184140647 22:42575888-42575910 GGCCAAGGCCGAGGGGTCTGAGG + Intergenic
1184332940 22:43837500-43837522 TGCCAGGGCCAAGAGGCCATGGG + Intronic
1184362465 22:44026582-44026604 TGCCAAGGCAAATGGGCTTGCGG - Intronic
1184569168 22:45310991-45311013 TGTCAGGGCCTAGGGACCTGGGG + Intronic
1184607244 22:45581228-45581250 AGCCATAGCCCAGGGGCCCGGGG - Intronic
1184875365 22:47270957-47270979 TGTCGTGGCCAAGGAGCATGAGG + Intergenic
949172189 3:1014128-1014150 TGCCCTGGTCAAAGGGCTTGAGG + Intergenic
950101686 3:10360921-10360943 TGCCATGGCCAGGGAGTCGGGGG - Intronic
950143022 3:10628173-10628195 AGCCCTGGCCATGGGCCCTGAGG - Intronic
950188035 3:10957425-10957447 TCCCATGGCCAGCGGGCCTGTGG - Intergenic
950467424 3:13163499-13163521 TGCCCCAGCCACGGGGCCTGAGG - Intergenic
953571036 3:44072140-44072162 TGCCATGGTTATAGGGCCTGTGG - Intergenic
953888949 3:46736370-46736392 TGCCATGGCCTGTGGGCCGGGGG - Exonic
953913930 3:46906177-46906199 TCCCATAGCCAAGTGGGCTGAGG - Intergenic
954435814 3:50495344-50495366 TGCGATGGCCCAGGGCCCTTGGG - Intronic
959394463 3:105819914-105819936 TTCCATGGACCAGGGGCATGGGG + Intronic
960571134 3:119186341-119186363 TGTCATGGCCAAGGGCAGTGAGG + Intronic
961042796 3:123689173-123689195 TGCCCTGGCCAGGGTGGCTGGGG + Intronic
961391952 3:126557606-126557628 TGCCATGGCCATGGTCCCAGTGG - Intronic
961518353 3:127452521-127452543 TGCCTGGGACAAGGGGCCTGGGG + Intergenic
961713865 3:128846010-128846032 GGCCAAGGCCAAGGGCCCTCTGG + Intergenic
968086354 3:195875681-195875703 TCCCATGGCCACGGGGACTCCGG - Intronic
968425727 4:522066-522088 TGCCCTGGACAGGGGGCCTCAGG + Intronic
968548927 4:1212669-1212691 TGCCATGGGCACGGGGCCTGTGG - Intronic
968810316 4:2796833-2796855 TGCCATGGCACACGGGGCTGAGG + Intronic
969306417 4:6328605-6328627 GGGCATGGACAAGGGGGCTGTGG - Intronic
971161827 4:24141252-24141274 GGCCTTGGCCAAGCGGCCTCAGG + Intergenic
972339827 4:38142382-38142404 TGGCATGGCCAAGGGGTGGGGGG + Intergenic
972628707 4:40824876-40824898 TGCCTTGGTCTAGGGGTCTGGGG - Intronic
975523988 4:75329424-75329446 TAGCATGTCCAAGGGCCCTGAGG - Intergenic
976560703 4:86497389-86497411 TGGCAGAGCCAAGGAGCCTGAGG - Intronic
979587415 4:122437424-122437446 TGGAACGTCCAAGGGGCCTGGGG - Intergenic
981207513 4:142060741-142060763 TACCCTGGCCAAGGGGTCTCAGG + Intronic
981453035 4:144921025-144921047 GGACATGGCCAAGGGGCGAGAGG + Intergenic
985936399 5:3101190-3101212 TCACATGGACAAGGGGCTTGGGG - Intergenic
986292343 5:6410308-6410330 TCCCATGGCCAACAGGCGTGGGG - Intergenic
986708494 5:10470777-10470799 TGCCCTGGCCGTGGGGCCTCGGG + Intronic
988455193 5:31381392-31381414 TCACATCGCCAAGGGGGCTGGGG - Intergenic
988468492 5:31514034-31514056 TGCCAGGGCCGGGGCGCCTGTGG - Intronic
990853554 5:60236572-60236594 TGGCATGGCAAAGGGGGCTGTGG + Intronic
991305302 5:65170587-65170609 TTCCATGGAGGAGGGGCCTGTGG - Intronic
997417234 5:133738533-133738555 TGCCATGGCCAAGCAGAGTGGGG - Intergenic
999330665 5:150671757-150671779 TGCCAATGCCAATGGCCCTGAGG + Exonic
1001092592 5:168752269-168752291 GGGCATGTCCAAGGGCCCTGTGG - Intronic
1002420138 5:179141797-179141819 TGGGATGGCCAAGAGGCCTGGGG + Intronic
1002430321 5:179199539-179199561 TGCCCTGGCCAGGGCGTCTGGGG - Intronic
1002660438 5:180787896-180787918 TGCAAAGGCCAAGAGGCTTGAGG + Intergenic
1003507035 6:6748630-6748652 GGCCATGGCCATGGAGCATGTGG + Intergenic
1004017239 6:11743475-11743497 TGTGAAGGCCAAGGGGGCTGAGG - Intronic
1004351380 6:14893179-14893201 TGCCCTGGCCCTGGGGGCTGAGG + Intergenic
1005920667 6:30397873-30397895 TGCCAGGCCCAGGGGCCCTGGGG + Intergenic
1006781926 6:36637777-36637799 TGACATGACCCAGGGGCCAGGGG + Intergenic
1007053108 6:38853197-38853219 TGTTATGGCCAAAGGTCCTGTGG + Exonic
1010063792 6:71656301-71656323 TGCTATGGCCAGGTGGCCTTGGG - Intergenic
1010251020 6:73707195-73707217 TGCCATGGCCATGGGAGTTGGGG + Intronic
1011557987 6:88588885-88588907 AAGCCTGGCCAAGGGGCCTGGGG - Intergenic
1012547994 6:100441255-100441277 TGGCAGTGCCAAGGGGCCAGAGG + Intronic
1013878364 6:114862704-114862726 TACTATGGCCAAAGAGCCTGAGG + Intergenic
1015736992 6:136411594-136411616 GGCCATGGACACGGGGCCTGGGG + Intronic
1018152815 6:160956160-160956182 TGGCAAGGGCAAGGGCCCTGAGG + Intergenic
1019136029 6:169908124-169908146 GGCCATCGCCAGGGGCCCTGGGG + Intergenic
1019317148 7:391975-391997 TGCCAAGCCCAGGGGGCCTGAGG - Intergenic
1019621357 7:1993975-1993997 TGCCCTGGCCACAGGGTCTGGGG + Intronic
1022503732 7:30897828-30897850 TGTCAGGGGCAAGGGGCCTGGGG + Intergenic
1025812797 7:64885780-64885802 TGCCTTGGCCAATGGCACTGTGG - Intronic
1027050533 7:75018772-75018794 TGCAAAGGCCCAGGGGCCTGAGG + Intronic
1027185429 7:75968164-75968186 TCCCCTGGCCAAGGGGCATGAGG - Intronic
1030200194 7:106895360-106895382 TACCTTGGCCTAGAGGCCTGTGG - Intronic
1032055597 7:128681889-128681911 AGCCATGGCCAGGGGGGTTGTGG - Intronic
1032228666 7:130054902-130054924 TGACATTGCCAAGTGTCCTGTGG - Intergenic
1034256585 7:149728111-149728133 CGCCATGGCCCAGAGGCCAGGGG + Intronic
1034437123 7:151068035-151068057 TACCATGGGCCAGGGTCCTGCGG - Exonic
1034558555 7:151865159-151865181 TGCCATGGCCAAGGGGCCTGAGG + Intronic
1035319106 7:158017100-158017122 CGCCATGGCAAAGGGCCCAGTGG + Intronic
1037826104 8:22161617-22161639 TGCCAGGGCCAAGGGCCCTTGGG + Intronic
1037908244 8:22727993-22728015 TGCCATGGCTCAGGGGCCCCAGG + Intronic
1038653043 8:29422907-29422929 TGACAAGGCCAAGGGGTTTGGGG + Intergenic
1039251945 8:35675679-35675701 TTCAAAGGTCAAGGGGCCTGGGG + Intronic
1039983280 8:42427286-42427308 GACCATGGCCAAGGTGCCTGGGG - Intronic
1040280367 8:46038473-46038495 TGCCATGTCCAACGGCCTTGGGG + Intergenic
1040470800 8:47734442-47734464 TGTCATGGCCAAAGAGACTGAGG - Intronic
1044125731 8:88456729-88456751 TGCCATGGGAGTGGGGCCTGGGG - Intergenic
1045363864 8:101457441-101457463 TACCATGGCCAAGGAGGTTGAGG + Intergenic
1045547454 8:103141098-103141120 TGCCCGGGCCAAGGCGCCCGGGG - Intronic
1048293655 8:133198845-133198867 TGCAAAGGCCCTGGGGCCTGAGG - Intronic
1048888583 8:138928648-138928670 TGCCTTGCCCAGGGAGCCTGAGG - Intergenic
1049086228 8:140480560-140480582 TTCCATGGCAAAAGGGACTGTGG - Intergenic
1049271700 8:141699561-141699583 TGCCTTGGCTCAGTGGCCTGGGG - Intergenic
1049379273 8:142303933-142303955 TGCCCCTGCCGAGGGGCCTGAGG - Intronic
1049434604 8:142580552-142580574 TGCCATGGTCAGAGGGCCTGAGG - Intergenic
1049610427 8:143552646-143552668 TGCTAAGGCCAGGGGGCCTCAGG - Intergenic
1049686170 8:143940152-143940174 TGCCCTGGCCCTGGGGCCAGTGG + Intronic
1052577843 9:30312720-30312742 TGCCATGCCCTAGGGATCTGTGG - Intergenic
1053130928 9:35615292-35615314 TGCCACGCCTAAGGGGACTGGGG - Intronic
1053286237 9:36851199-36851221 TCCCCAGGCCAAGGGGACTGGGG + Intronic
1055308292 9:74952593-74952615 GCCCATGGCCAAGCGGCGTGCGG - Exonic
1058887161 9:109330271-109330293 TGCAGTGGTCCAGGGGCCTGAGG - Intergenic
1059422010 9:114197948-114197970 TGCCATGGGCAATGTGCCTGGGG + Intronic
1060180413 9:121529818-121529840 TGCCAAGGCCCAGGGCCCTCGGG + Intergenic
1060434294 9:123580563-123580585 GGAAATGGCCAAGGGCCCTGGGG - Intronic
1060523462 9:124307644-124307666 TGCCCTGGCAGAGGAGCCTGAGG + Intronic
1061184153 9:129042354-129042376 TGCCACGGCCCTGGGGACTGTGG + Exonic
1062018368 9:134303817-134303839 TGCCATGGGGAGGGGGGCTGAGG - Intergenic
1062217979 9:135399410-135399432 GGCGATGGCCAGGGGGACTGAGG + Intergenic
1062390523 9:136331942-136331964 CACCATGGCCACGGGTCCTGGGG - Intronic
1062622441 9:137428953-137428975 GGCCATGTCCAAGTGGCCGGAGG + Exonic
1185752693 X:2626891-2626913 TGGCATGTGCAAAGGGCCTGTGG + Intergenic
1189299303 X:39941347-39941369 TGCCCAGGTCAAGAGGCCTGGGG + Intergenic
1195999051 X:110761568-110761590 AGACATGGCCAAGTTGCCTGGGG - Intronic
1197944752 X:131827166-131827188 TGCTATGGGCAAGTGTCCTGAGG + Intergenic
1199571528 X:149271568-149271590 TGCCAGAGCCTAGGGTCCTGGGG - Intergenic
1199778548 X:151037301-151037323 TGGCATGTGCAAGGGCCCTGAGG + Intergenic
1199924655 X:152450236-152450258 TGGCATGGGCAAGAGGACTGGGG - Intronic