ID: 1034559468

View in Genome Browser
Species Human (GRCh38)
Location 7:151870840-151870862
Sequence ACGTTTGCAGAGATGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034559468_1034559473 -2 Left 1034559468 7:151870840-151870862 CCCAGCCCCATCTCTGCAAACGT 0: 1
1: 0
2: 2
3: 8
4: 191
Right 1034559473 7:151870861-151870883 GTTGTGACTGCCCAGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034559468 Original CRISPR ACGTTTGCAGAGATGGGGCT GGG (reversed) Intronic
900142839 1:1145716-1145738 ACGTTGGCAGAGGTGGTGCCAGG + Intergenic
900624761 1:3603142-3603164 AGTTTGGCAGGGATGGGGCTGGG - Intronic
900951836 1:5862479-5862501 TCGTTTGCAGAGATCAGTCTCGG - Intergenic
901287365 1:8091549-8091571 TTTTTTGCAGAGATGGGGTTTGG + Intergenic
901867882 1:12119242-12119264 ACTTTTGCAGACATGAGGCCTGG - Intronic
902555794 1:17245845-17245867 AGCATTGCAGAGATAGGGCTGGG + Exonic
903812186 1:26040918-26040940 ATGTTTGTAGAGATGGGGGGGGG - Intronic
904287637 1:29462341-29462363 ACGTATGCAGGCAGGGGGCTTGG - Intergenic
904376554 1:30085673-30085695 AGGTGTGGAAAGATGGGGCTGGG + Intergenic
904581078 1:31544750-31544772 ACATTGTCAGAGATGGGGGTAGG + Intergenic
904938088 1:34145922-34145944 ACATCTGCAGAGTTAGGGCTAGG - Intronic
904990790 1:34590914-34590936 ACGATTGAAGAAATGGGGCCGGG + Intergenic
905533288 1:38699347-38699369 TGGTTAGCAAAGATGGGGCTGGG - Intergenic
906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG + Intergenic
906725348 1:48040304-48040326 ATGTTTGCACAGCTGGGGATGGG + Intergenic
907048622 1:51315116-51315138 AAGTTTCCACAGGTGGGGCTGGG - Intronic
917429957 1:174955902-174955924 ACTTTTGTAGAGATGGGGTCTGG - Intronic
917815731 1:178708143-178708165 AAGTTTCCACAGCTGGGGCTGGG + Intergenic
920397973 1:205660289-205660311 ACATTAGCACAGCTGGGGCTGGG - Intronic
1063927507 10:10994972-10994994 ACTTTTGCAGAGACAGGACTTGG - Intergenic
1067544149 10:47179842-47179864 AATTTTGTAGAGATGGGGGTGGG - Intergenic
1070445457 10:76496392-76496414 CAGTTTGCTGAGATGGAGCTGGG - Intronic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1070986590 10:80695032-80695054 ACGTTTGCAGGGATGGGATATGG + Intergenic
1071289213 10:84176542-84176564 AGGTTTGTTGAGTTGGGGCTAGG - Exonic
1076247652 10:128959801-128959823 ACCTTTGCAGCTCTGGGGCTGGG + Intergenic
1077017861 11:404824-404846 ACATTGGCAGAGGTGGGGGTTGG + Exonic
1077177018 11:1195610-1195632 AGGTTTGCAGGGCAGGGGCTGGG + Intronic
1081604399 11:44518342-44518364 ACATTTTCAGAGATGGGGTCTGG - Intergenic
1081816372 11:45945838-45945860 ACGTCTGTGGAGGTGGGGCTGGG + Exonic
1085273725 11:75285125-75285147 AGGTTTTCAGAGCTTGGGCTTGG + Intronic
1087161354 11:94950906-94950928 ACATTTGTAGATATGGGGCTGGG + Intergenic
1087794071 11:102437274-102437296 AGGGTTAAAGAGATGGGGCTGGG - Intronic
1089541677 11:119193111-119193133 ACTCTTGGAGAGAAGGGGCTTGG + Intronic
1090476846 11:127030442-127030464 AGGTTTGAAGAGAGTGGGCTGGG - Intergenic
1090974703 11:131671332-131671354 AAGTGTGCAGTGATGGGGTTGGG - Intronic
1091368223 11:135039183-135039205 ACCTTTGCGGAGGTGGAGCTGGG - Intergenic
1092284855 12:7122808-7122830 ACATCTGCAGAGATTGGGCAGGG + Intergenic
1092965985 12:13642857-13642879 GCTTTGGCAGAGTTGGGGCTTGG + Intronic
1093429649 12:19070425-19070447 ATGCATGCAGTGATGGGGCTGGG - Intergenic
1095814000 12:46401402-46401424 CCATTTGCTGAGAAGGGGCTTGG + Intergenic
1098908041 12:76181387-76181409 ACTTTTGTGGAGATGGGGTTTGG + Intergenic
1100213330 12:92421101-92421123 ACATATGCAGAGATGGCTCTTGG + Exonic
1100443550 12:94640359-94640381 TCTTTTGTAGAGATGGGGTTTGG + Intronic
1102078538 12:110079512-110079534 ACGTGTGAAGAAATGGGGATTGG + Intergenic
1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG + Intergenic
1102837528 12:116079392-116079414 CCTTTTGCAGAGATGGGGGAGGG + Intronic
1104430072 12:128709048-128709070 TAGTTTGCAAAGCTGGGGCTCGG - Intergenic
1104621819 12:130319500-130319522 AACTTTGCGGAGTTGGGGCTGGG + Intergenic
1109711029 13:66160718-66160740 ACTTTTGCATTGTTGGGGCTGGG + Intergenic
1112190793 13:97175419-97175441 ACGGGTGCAAAGATGGGCCTGGG + Intergenic
1113274005 13:108707877-108707899 AGGATTGAAGAGATGGGACTAGG + Intronic
1114458246 14:22871339-22871361 CAGTTTGCAGAGAAGGGGCGGGG + Intergenic
1115030504 14:28787877-28787899 ACGTTTGATGAGATGGAGTTTGG + Intronic
1117160095 14:52980921-52980943 AAGTTTAAACAGATGGGGCTGGG - Intergenic
1120898956 14:89559200-89559222 TTTTTTGCAGAGATGGGGTTGGG - Intronic
1121319812 14:92985616-92985638 ACATTTGCAAACACGGGGCTGGG + Intronic
1121555388 14:94832477-94832499 CAGGTTCCAGAGATGGGGCTTGG + Intergenic
1122409524 14:101518735-101518757 ACTTGGGCAGAGGTGGGGCTGGG + Intergenic
1124339915 15:28884387-28884409 ACGTTCACACAGATGGGGGTGGG + Intergenic
1129012365 15:72432478-72432500 ATTTTTGTAGAGATGGGGTTTGG + Intergenic
1129040096 15:72678477-72678499 AAGTTTGTAGAGATGGGGTCTGG + Intronic
1129542156 15:76359216-76359238 CCTTATGGAGAGATGGGGCTGGG - Intronic
1130257415 15:82332232-82332254 ACTTATGCAAGGATGGGGCTTGG - Intergenic
1130597530 15:85257733-85257755 ACTTATGCAAGGATGGGGCTTGG + Intergenic
1131146449 15:90016778-90016800 CCCTTTGCAGAGATGGGTCTAGG - Intronic
1131666473 15:94576442-94576464 ATGTTTGCAGAGGTGAGGCAGGG - Intergenic
1131706232 15:94999365-94999387 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1134481309 16:14621895-14621917 AAGATTGAAGAGATGAGGCTGGG + Intronic
1134827497 16:17296323-17296345 AAGATTGCAGAGATGGGGCTGGG + Intronic
1136586530 16:31189807-31189829 AGGCTGGCAGAGGTGGGGCTGGG + Intronic
1137677761 16:50312190-50312212 AGGTGTGCTGAGAAGGGGCTGGG + Exonic
1138458906 16:57136483-57136505 GCCTTTCCAGAGAAGGGGCTTGG - Intronic
1138984696 16:62314260-62314282 AGGTTTACAGAGATGGAGCCAGG + Intergenic
1140949231 16:79800160-79800182 ATGTTTACATAGATCGGGCTTGG - Intergenic
1142636278 17:1259763-1259785 ATTTTTGTAGAGATGGGGGTGGG - Intergenic
1143391051 17:6559456-6559478 ACGTGTGCAGAGATGTGGACAGG + Intergenic
1143917817 17:10306902-10306924 TCCTTTTCAGAGATGGGGTTTGG - Intronic
1144760784 17:17706195-17706217 AGATTTGCAGAGCTGGGGCGAGG + Intronic
1145934017 17:28704574-28704596 AGGTGTGCAGAGCTGGGACTGGG + Intronic
1148386537 17:47238466-47238488 AGGTGTGCAGAGAGGGGCCTGGG - Intergenic
1148774672 17:50088651-50088673 TGGTTTACAGAGATGGGGCCTGG - Intronic
1149454562 17:56777403-56777425 GAGCTTGCAGAGATGGGGCAGGG - Intergenic
1153929626 18:9866754-9866776 CCTTTTGGAGAGCTGGGGCTGGG + Intergenic
1155971012 18:32083732-32083754 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1156901055 18:42300461-42300483 CCTTTTGCATAAATGGGGCTGGG + Intergenic
1158565662 18:58552222-58552244 ACATTTGCAGAACTGGGGTTGGG - Intronic
1161842732 19:6692799-6692821 CCCTTTGCAAAGATTGGGCTGGG - Intronic
1162742899 19:12783341-12783363 AGGTTTGCAGGGGTGGGGGTGGG - Intronic
1163294354 19:16402719-16402741 TTTTTTGCAGAGATGGGTCTTGG - Intronic
1164403113 19:27916475-27916497 TCTTTTGCAAAGATGGGGATTGG + Intergenic
1165446826 19:35861183-35861205 ATGTGTGCAGAGCTGAGGCTGGG + Exonic
1166342864 19:42149253-42149275 ACACTCGCAGAGATGGAGCTGGG - Intronic
1168492165 19:56820375-56820397 AATTATGCAGACATGGGGCTCGG + Intronic
926157157 2:10462666-10462688 CTGTGTGCAGAGCTGGGGCTGGG - Intergenic
926351041 2:11994612-11994634 ACTTTTGCAGATATTGGGATGGG + Intergenic
927467429 2:23347901-23347923 ACGTCTGCACAGATGAGGCATGG + Intergenic
927518715 2:23686776-23686798 AGGTTTGTAGAGATGGGGCTGGG + Intronic
928373200 2:30756118-30756140 ATGTTTGCAGAGCAGGGACTGGG - Intronic
928436371 2:31257173-31257195 CTGTTTGCAGAGGTGGGGGTTGG + Intronic
932472286 2:71967895-71967917 ATGTTTGAAGATATGGGCCTTGG + Intergenic
934744940 2:96753216-96753238 ACTTTTGTAGAGATGGGGGCGGG + Intergenic
935743623 2:106172560-106172582 ACACTGACAGAGATGGGGCTGGG + Intronic
936998732 2:118441960-118441982 AGGTTTCCAGAGATGGAACTGGG - Intergenic
937909849 2:127070171-127070193 AGCTGTGAAGAGATGGGGCTGGG - Intronic
938418184 2:131121813-131121835 AGGTTTGCAGAGATAAGCCTAGG - Intronic
939515212 2:143158366-143158388 ACGTTTGCATAGCTGAGGGTTGG - Intronic
939888709 2:147709948-147709970 ACCTTTCCAGAGTTGGGGTTGGG - Intergenic
940570519 2:155427206-155427228 ATGTGTGAAGTGATGGGGCTAGG + Intergenic
942100622 2:172579230-172579252 ATGTTTCCAGGGATGGGGGTGGG + Intronic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947768198 2:232650946-232650968 ATGTTGGCAGAGAAGGAGCTGGG + Intronic
947885278 2:233564450-233564472 TGGTTTGCAGAGATGGGGTATGG + Intronic
948539806 2:238682525-238682547 ATTTTTCCACAGATGGGGCTGGG + Intergenic
1170388862 20:15850631-15850653 ACATCTGCAGAGATGTGTCTTGG + Intronic
1170441762 20:16386430-16386452 ACCTTTGCTGGGCTGGGGCTGGG + Intronic
1173873077 20:46353754-46353776 GGTTTTGCAGAGATGGGGCATGG + Intronic
1174387329 20:50194885-50194907 ATGTTTGCAGTTCTGGGGCTTGG - Intergenic
1175937235 20:62519438-62519460 ACCTTAGCAGAAATGGGGCCTGG - Intergenic
1182358784 22:29734836-29734858 CCATTTGCAGGGCTGGGGCTGGG - Intronic
1182580251 22:31304219-31304241 ACATTTTCTGAGATGGGGCAAGG + Intergenic
1183619801 22:38965807-38965829 ACCTTTGCAGAGACCTGGCTGGG + Intronic
1184152563 22:42647216-42647238 ACCCTTGGAGAGATGGGGCTGGG + Intronic
952321393 3:32281067-32281089 CCCCATGCAGAGATGGGGCTTGG - Intronic
953262421 3:41352744-41352766 AGCTCTGCAGAGATGAGGCTGGG - Intronic
953304300 3:41812511-41812533 ACGATTTCAGAGCTGGTGCTGGG + Intronic
963162138 3:142161730-142161752 AAGGCTGCAGAGGTGGGGCTGGG + Intergenic
964246489 3:154659820-154659842 AGGTATGCAGAGCTGTGGCTGGG + Intergenic
964901425 3:161663750-161663772 AGAGTTGAAGAGATGGGGCTAGG + Intergenic
965916009 3:173846609-173846631 ACATTTGTAGAAATGGGGGTGGG - Intronic
968686891 4:1966359-1966381 ATGATTGAAGAGATAGGGCTGGG + Intronic
971173431 4:24257681-24257703 GTGTTTGCAGACATGGGGCAGGG - Intergenic
972514314 4:39797900-39797922 ATTTTTGCAGAGGTGGGGTTTGG + Intergenic
975213541 4:71728706-71728728 AACTGGGCAGAGATGGGGCTGGG - Intergenic
975738198 4:77402512-77402534 AACTTTGCAGAGATGGGGATAGG + Intronic
978304044 4:107302722-107302744 AATTTTGTAGAGATGGGGTTTGG - Intergenic
978559909 4:110022147-110022169 AAGTTTACAGAGTTTGGGCTAGG - Intergenic
981998844 4:151003611-151003633 TTGTTTGCAGAGAAGGGGCGGGG - Intronic
982241959 4:153308846-153308868 TAGTTTGCAGAGGTGGGGCAGGG - Intronic
983040859 4:162924043-162924065 ATGTTTCCATAGATGGGGGTGGG - Intergenic
984310065 4:178046659-178046681 AATTTGGCAGACATGGGGCTAGG + Intergenic
985095970 4:186413751-186413773 AGGTTGGGAGAGATGGCGCTGGG - Intergenic
991301446 5:65132923-65132945 TCATTTTCAGAGATGGGGCTGGG + Intergenic
992623435 5:78615932-78615954 ACCTTTGCAAAGCTGGTGCTAGG + Intronic
995015764 5:107306906-107306928 ACGTTGGCAGAGATGGAGGGAGG + Intergenic
995553927 5:113308475-113308497 AGGTTTTTAGAGATGGGGATGGG - Intronic
995948848 5:117684896-117684918 ATGCTTGTAGAAATGGGGCTGGG + Intergenic
997352243 5:133239230-133239252 ACGTTGGCAGGGAGGGGGGTGGG - Intronic
997503543 5:134397610-134397632 ACTTTTGCAGGGATGGAGCCTGG + Intergenic
998257860 5:140602584-140602606 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
999059887 5:148622386-148622408 AAGTTTGGTGAGATGTGGCTGGG - Intronic
999374128 5:151074953-151074975 TTGTTTGCAGAGATGGGTTTTGG + Intronic
1001186761 5:169581598-169581620 ACGTAAGGAGAGATGGGACTTGG - Intergenic
1001597546 5:172907729-172907751 ACCTTTGGGGAGAAGGGGCTGGG - Intronic
1002056587 5:176601341-176601363 CCTGTTGCAGAGAAGGGGCTAGG - Intronic
1002210971 5:177599292-177599314 ACAGATGCAGAGATGTGGCTTGG + Intergenic
1005986453 6:30878783-30878805 AGATTTGCAGAGATGAGGCAAGG - Intronic
1006298647 6:33181381-33181403 GTGTTTGCTGAGGTGGGGCTGGG - Intronic
1007626244 6:43247823-43247845 ACGTTTTCAGAGATGTCTCTGGG + Intronic
1007764402 6:44152378-44152400 GCGGTTGCAGTGATGGGGCACGG - Intronic
1008428684 6:51389134-51389156 ACCTTTGCACAGTTGGGGCATGG + Intergenic
1008694139 6:54014414-54014436 ATTTTTCCACAGATGGGGCTAGG + Intronic
1012418328 6:99034341-99034363 CAGTTTGCAAAGATGTGGCTCGG - Intergenic
1013113569 6:107083440-107083462 TCTTTTGTAGAGATGGGGTTTGG - Intronic
1014098415 6:117483419-117483441 ACGTTTGCCGAGGTTGGCCTTGG + Intronic
1016601046 6:145861048-145861070 AAGTTTGCAGACATTGGACTGGG + Intergenic
1017160910 6:151365361-151365383 GCCTTTACAGAGGTGGGGCTGGG + Exonic
1017699917 6:157058779-157058801 GCAGTTGGAGAGATGGGGCTGGG + Intronic
1018870290 6:167777456-167777478 AGGTTGGCAGAGATGAGGCGAGG - Intergenic
1019067564 6:169315118-169315140 GAGTGTGCAGAGATGGGGATTGG - Intergenic
1019293371 7:261158-261180 GGGGCTGCAGAGATGGGGCTGGG + Intergenic
1021711479 7:23420286-23420308 ATTTTTGTAGAGATGGGGTTTGG - Intronic
1024966002 7:55022309-55022331 ACGTCTCCAGAAGTGGGGCTGGG - Intronic
1029140085 7:98403009-98403031 TTTTTTGCAGAGATGGGGGTGGG - Intergenic
1031887287 7:127254891-127254913 ATTTATGCGGAGATGGGGCTGGG + Intergenic
1033216877 7:139499829-139499851 AAGTGTTCAGAGATGGGGCCGGG - Intergenic
1034559468 7:151870840-151870862 ACGTTTGCAGAGATGGGGCTGGG - Intronic
1034948573 7:155280773-155280795 GCGTCACCAGAGATGGGGCTGGG - Intergenic
1035124156 7:156595715-156595737 AAGTTTGCATACATTGGGCTTGG + Intergenic
1035548634 8:502958-502980 ACGTGTGCTGAGATGGGCATTGG - Intronic
1037671340 8:21017685-21017707 ACGTTTGCAGTCAGAGGGCTGGG + Intergenic
1038136989 8:24796969-24796991 ATGTTTGCAGAGATGGAGTGTGG - Intergenic
1038591509 8:28842633-28842655 ACGTTTCAAGATATGGAGCTTGG - Intronic
1044067594 8:87718303-87718325 TCTTTTGCTGTGATGGGGCTGGG + Intergenic
1044802586 8:95972401-95972423 ACGCATGCTGGGATGGGGCTGGG + Intergenic
1045660765 8:104435400-104435422 ACTTTTGCAGAGATGAGGCAAGG - Intronic
1046978392 8:120309823-120309845 TCGTCTGCAGCGCTGGGGCTGGG + Intronic
1048169256 8:132089841-132089863 ATGTTAGCAGAGAAGGGGTTGGG - Intronic
1048562808 8:135560036-135560058 ATTTTTGCAGAGATGGGGTCTGG - Intronic
1050173502 9:2846569-2846591 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1055837028 9:80455739-80455761 ACATAAGCAGAGATGGGGATAGG + Intergenic
1059430997 9:114250306-114250328 ACGTTTGGAGAGCTGGGGTTGGG - Intronic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1061423600 9:130485481-130485503 ACATTTGCAGGGCTGGAGCTGGG - Intronic
1186023612 X:5284270-5284292 CCATTTGCAGGGCTGGGGCTTGG - Intergenic
1189114848 X:38331757-38331779 ATTTTTGTAGAGATGGGGTTTGG + Intronic
1190431271 X:50379790-50379812 ACATTTACAGAGATGGGGAAAGG + Intronic
1191686118 X:63892558-63892580 ATGTTTGCACTGATGGGGGTAGG - Intergenic
1199850715 X:151723368-151723390 AACTTTGCAAAGCTGGGGCTGGG - Intergenic
1199969991 X:152852675-152852697 AGGTTTGTGGAGATGGTGCTTGG - Intronic
1201799620 Y:17940878-17940900 ACGATTTGGGAGATGGGGCTGGG + Intergenic
1201801933 Y:17965078-17965100 ACGATTTGGGAGATGGGGCTGGG - Intergenic