ID: 1034560699

View in Genome Browser
Species Human (GRCh38)
Location 7:151877611-151877633
Sequence CTACGGCAGGGCGGGCGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034560699_1034560713 10 Left 1034560699 7:151877611-151877633 CCCCCGCGCCCGCCCTGCCGTAG No data
Right 1034560713 7:151877644-151877666 GAGGAAGCCCACAGTCTCCGGGG No data
1034560699_1034560708 -9 Left 1034560699 7:151877611-151877633 CCCCCGCGCCCGCCCTGCCGTAG No data
Right 1034560708 7:151877625-151877647 CTGCCGTAGACCAGGCAGCGAGG No data
1034560699_1034560711 8 Left 1034560699 7:151877611-151877633 CCCCCGCGCCCGCCCTGCCGTAG No data
Right 1034560711 7:151877642-151877664 GCGAGGAAGCCCACAGTCTCCGG No data
1034560699_1034560712 9 Left 1034560699 7:151877611-151877633 CCCCCGCGCCCGCCCTGCCGTAG No data
Right 1034560712 7:151877643-151877665 CGAGGAAGCCCACAGTCTCCGGG No data
1034560699_1034560714 11 Left 1034560699 7:151877611-151877633 CCCCCGCGCCCGCCCTGCCGTAG No data
Right 1034560714 7:151877645-151877667 AGGAAGCCCACAGTCTCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034560699 Original CRISPR CTACGGCAGGGCGGGCGCGG GGG (reversed) Intergenic
No off target data available for this crispr