ID: 1034564487

View in Genome Browser
Species Human (GRCh38)
Location 7:151902276-151902298
Sequence CTGGCTCCACGGATCTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034564487_1034564491 -5 Left 1034564487 7:151902276-151902298 CCAAGATAGATCCGTGGAGCCAG No data
Right 1034564491 7:151902294-151902316 GCCAGTGGCAGGACTACCCCTGG No data
1034564487_1034564496 14 Left 1034564487 7:151902276-151902298 CCAAGATAGATCCGTGGAGCCAG No data
Right 1034564496 7:151902313-151902335 CTGGCCAAATATTTCGCACATGG No data
1034564487_1034564497 15 Left 1034564487 7:151902276-151902298 CCAAGATAGATCCGTGGAGCCAG No data
Right 1034564497 7:151902314-151902336 TGGCCAAATATTTCGCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034564487 Original CRISPR CTGGCTCCACGGATCTATCT TGG (reversed) Intergenic
No off target data available for this crispr