ID: 1034564775

View in Genome Browser
Species Human (GRCh38)
Location 7:151904390-151904412
Sequence TTCCCACAGGGCCCCGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034564775_1034564785 12 Left 1034564775 7:151904390-151904412 CCTGACCCGGGGCCCTGTGGGAA No data
Right 1034564785 7:151904425-151904447 GCACACACCACCCATGTAAGGGG No data
1034564775_1034564789 30 Left 1034564775 7:151904390-151904412 CCTGACCCGGGGCCCTGTGGGAA No data
Right 1034564789 7:151904443-151904465 AGGGGCTCCCTCTAGAGAGATGG No data
1034564775_1034564784 11 Left 1034564775 7:151904390-151904412 CCTGACCCGGGGCCCTGTGGGAA No data
Right 1034564784 7:151904424-151904446 GGCACACACCACCCATGTAAGGG No data
1034564775_1034564780 -10 Left 1034564775 7:151904390-151904412 CCTGACCCGGGGCCCTGTGGGAA No data
Right 1034564780 7:151904403-151904425 CCTGTGGGAATCCTGCCATTTGG No data
1034564775_1034564783 10 Left 1034564775 7:151904390-151904412 CCTGACCCGGGGCCCTGTGGGAA No data
Right 1034564783 7:151904423-151904445 TGGCACACACCACCCATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034564775 Original CRISPR TTCCCACAGGGCCCCGGGTC AGG (reversed) Intergenic
No off target data available for this crispr