ID: 1034566281

View in Genome Browser
Species Human (GRCh38)
Location 7:151918217-151918239
Sequence CTGGACTGCTTGGGCACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034566275_1034566281 2 Left 1034566275 7:151918192-151918214 CCCAATGCTGGTGGAGAAGGTGT No data
Right 1034566281 7:151918217-151918239 CTGGACTGCTTGGGCACAGCTGG No data
1034566276_1034566281 1 Left 1034566276 7:151918193-151918215 CCAATGCTGGTGGAGAAGGTGTG No data
Right 1034566281 7:151918217-151918239 CTGGACTGCTTGGGCACAGCTGG No data
1034566273_1034566281 7 Left 1034566273 7:151918187-151918209 CCATTCCCAATGCTGGTGGAGAA No data
Right 1034566281 7:151918217-151918239 CTGGACTGCTTGGGCACAGCTGG No data
1034566272_1034566281 8 Left 1034566272 7:151918186-151918208 CCCATTCCCAATGCTGGTGGAGA No data
Right 1034566281 7:151918217-151918239 CTGGACTGCTTGGGCACAGCTGG No data
1034566269_1034566281 25 Left 1034566269 7:151918169-151918191 CCTTTTGGGGTTCTACACCCATT No data
Right 1034566281 7:151918217-151918239 CTGGACTGCTTGGGCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034566281 Original CRISPR CTGGACTGCTTGGGCACAGC TGG Intergenic
No off target data available for this crispr