ID: 1034568183

View in Genome Browser
Species Human (GRCh38)
Location 7:151932587-151932609
Sequence TTCTGGCCACCTTTGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034568183_1034568192 8 Left 1034568183 7:151932587-151932609 CCAGTCTCCAAAGGTGGCCAGAA No data
Right 1034568192 7:151932618-151932640 CCTCTCTGTGGGCATTAGCCTGG No data
1034568183_1034568194 27 Left 1034568183 7:151932587-151932609 CCAGTCTCCAAAGGTGGCCAGAA No data
Right 1034568194 7:151932637-151932659 CTGGATAAAAGCCAGCTCTGAGG No data
1034568183_1034568188 -3 Left 1034568183 7:151932587-151932609 CCAGTCTCCAAAGGTGGCCAGAA No data
Right 1034568188 7:151932607-151932629 GAACACGGTCCCCTCTCTGTGGG No data
1034568183_1034568187 -4 Left 1034568183 7:151932587-151932609 CCAGTCTCCAAAGGTGGCCAGAA No data
Right 1034568187 7:151932606-151932628 AGAACACGGTCCCCTCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034568183 Original CRISPR TTCTGGCCACCTTTGGAGAC TGG (reversed) Intergenic
No off target data available for this crispr