ID: 1034571655

View in Genome Browser
Species Human (GRCh38)
Location 7:151960947-151960969
Sequence CCACGCTGCTTGACAGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034571655_1034571659 20 Left 1034571655 7:151960947-151960969 CCAAGTTCTGTCAAGCAGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1034571659 7:151960990-151961012 TGTATATGCAAGCCAGTTCCTGG No data
1034571655_1034571660 21 Left 1034571655 7:151960947-151960969 CCAAGTTCTGTCAAGCAGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1034571660 7:151960991-151961013 GTATATGCAAGCCAGTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034571655 Original CRISPR CCACGCTGCTTGACAGAACT TGG (reversed) Intronic
903148825 1:21390743-21390765 CAAGGATGCTTGACCGAACTTGG + Intergenic
904608274 1:31710701-31710723 CCCTCCTGCTTTACAGAACTTGG - Intergenic
909479535 1:76116571-76116593 TTAGGCTGCTTGACAGAACTTGG - Intronic
910230945 1:84985911-84985933 CCACCATTCTTCACAGAACTAGG + Intronic
915137931 1:153746749-153746771 CCACTCTGTGTGACAGAACAAGG + Intronic
922295791 1:224248882-224248904 CCAGGGAGCTGGACAGAACTGGG + Intronic
923007160 1:230059355-230059377 CCACGGTGCTGAACAGTACTAGG + Intronic
923329951 1:232913915-232913937 CCAAGCTGTTTGACAAAACAAGG - Intergenic
1063935538 10:11073819-11073841 TCACTCTGCTTCACAGCACTAGG - Intronic
1067823225 10:49549326-49549348 CAAGGATGCTTGACTGAACTTGG - Intergenic
1068025840 10:51642358-51642380 CCAGGCTGGTTGACAGAGCAAGG + Intronic
1071549858 10:86558306-86558328 CCATGCTGCCTGACAAAAATGGG + Intergenic
1074194926 10:111175286-111175308 CCAAGCTGCTGGACATAAGTGGG + Intergenic
1074517414 10:114183008-114183030 CCATGGTGCTTTATAGAACTAGG - Intronic
1076721297 10:132394528-132394550 CCAGGGTGCTTCCCAGAACTGGG + Intergenic
1083492354 11:63022324-63022346 CCATGCTTCATGACAGAATTTGG - Intergenic
1084334183 11:68447225-68447247 CCACGTTGCCTGACACCACTGGG - Intronic
1091584874 12:1810407-1810429 CCACGCTGCCTTCCAGAGCTGGG - Intronic
1099326642 12:81224125-81224147 TCACTCTGCTTGGCAGAATTGGG + Intronic
1101100544 12:101387587-101387609 CCACCATGCTTGCCAGCACTTGG - Intergenic
1106666011 13:31851683-31851705 CCACACTGCTTCACCGTACTTGG - Intergenic
1116207056 14:41882154-41882176 CCACCCTGCTTTACAGCTCTGGG + Intronic
1116936695 14:50747873-50747895 CCAAGCTAGTTGACAGAACTTGG + Intronic
1119426888 14:74541531-74541553 CCCCGCTGGTGGACAGAGCTGGG + Intronic
1119542195 14:75447231-75447253 CCTCGCTCCTTCAAAGAACTGGG - Intronic
1119893033 14:78197362-78197384 CCATGCAGCCTTACAGAACTGGG - Intergenic
1120740498 14:88103980-88104002 GCACACTGCTGGACAGATCTAGG - Intergenic
1121462685 14:94094088-94094110 CAACGATGCTTGACCAAACTTGG + Intronic
1123833013 15:24160969-24160991 ACACGCTGCTGGACAGCACCAGG + Intergenic
1123839736 15:24236031-24236053 ACACGCTGCTGGACAGCACCAGG + Intergenic
1123849599 15:24341653-24341675 ACACGCTGCTGGACAGCACCAGG + Intergenic
1123852800 15:24377734-24377756 ACACGCTGCTGGACAGCACCAGG + Intergenic
1123868653 15:24549152-24549174 ACACGCTGCTGGACAGCACCAGG + Intergenic
1129422282 15:75438333-75438355 CCAGCCTGGTTGACAGAACAAGG + Intronic
1134246251 16:12542363-12542385 CCACCCTGGGTGATAGAACTTGG - Intronic
1140239408 16:73187820-73187842 CCACGTTGCATAACAGAGCTGGG + Intergenic
1150016828 17:61565565-61565587 CCCCACTGCCTGACAGGACTTGG - Intergenic
1152356275 17:79809215-79809237 CCAGGCTGCGTGAGAGAACTGGG + Intergenic
1154210193 18:12373348-12373370 CCCCACTGCTTGACAGCACCTGG - Intronic
1154272120 18:12929344-12929366 CCAGGCAGCTTCCCAGAACTGGG - Intronic
1157386327 18:47261992-47262014 CCACGCTGTTTTACCGAACTCGG - Intergenic
1158315459 18:56207474-56207496 CCCCGTTGCTTGAGAGAATTAGG + Intergenic
1164006298 19:21152630-21152652 CAAGGATGCTTGACTGAACTTGG - Intronic
1166478561 19:43150639-43150661 CCAGGCTGGGTGACAGAACGAGG + Intronic
926974127 2:18496130-18496152 CCATTCTGGTTGACAGAACTTGG - Intergenic
928393623 2:30927874-30927896 ACAGGCTGCTGAACAGAACTGGG - Intronic
929253776 2:39787190-39787212 TGACTCTGCTTGACATAACTGGG - Intergenic
929505129 2:42522456-42522478 GCAAACTGCTTGACAGAATTGGG + Intronic
930857346 2:56033129-56033151 CCACGCTGCCTCACTGAACAGGG - Intergenic
931321689 2:61178866-61178888 CGAGGCTGCTTGAGAGGACTTGG + Exonic
938085274 2:128395837-128395859 CCAGGCTGCTGGACAGGCCTTGG + Intergenic
942767076 2:179469708-179469730 CAAGGATGCTTGACCGAACTTGG + Intronic
1170795887 20:19546456-19546478 CAGAGCTGCTTGACAGAAGTGGG + Intronic
1173480287 20:43393216-43393238 CCAGGCTGCTTGCCATAATTAGG - Intergenic
1174072266 20:47907649-47907671 CCTCGCTGCCTCACATAACTTGG - Intergenic
1179168797 21:38956830-38956852 GCACGCTGATTTACAGAACAGGG - Intergenic
1179958315 21:44753463-44753485 CCATGCTGCTGGACAGAACCGGG - Intergenic
1180843391 22:18969610-18969632 CCACCCTGCATGACAGGACCAGG - Intergenic
1182600037 22:31455277-31455299 CCTCTCTCCTGGACAGAACTCGG - Exonic
1184915152 22:47563959-47563981 CCACGCTGCCTATCAGGACTCGG + Intergenic
949802832 3:7922192-7922214 CCACCCTGTCTGTCAGAACTGGG + Intergenic
951709528 3:25574472-25574494 CCACGCTAGTTTACAGAACCTGG - Intronic
953153242 3:40344304-40344326 CAAGGATGCTTGACCGAACTTGG + Intergenic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955599710 3:60631916-60631938 CCACACAGCTACACAGAACTGGG + Intronic
958661209 3:97069958-97069980 CCACACAGCTTGAAAGAGCTAGG - Intronic
962374251 3:134847088-134847110 TCACGCTGATTAACAGAACGTGG + Intronic
963868236 3:150385717-150385739 GCAGGCTGCCTGGCAGAACTAGG + Intergenic
965378340 3:167955122-167955144 CCATCCTTCTTTACAGAACTAGG - Intergenic
966721155 3:183063993-183064015 CAAGGATGCTTGACTGAACTTGG + Intronic
968896130 4:3404726-3404748 CCACCCTGGTGGACAGAGCTGGG - Intronic
978013990 4:103721322-103721344 CCAGCCTGGGTGACAGAACTAGG - Intergenic
982092546 4:151892903-151892925 CCTCGATGCTTGTCAGAACGTGG + Intergenic
989742977 5:44793790-44793812 CAAGGATGCTTGACTGAACTTGG - Intergenic
997735438 5:136209429-136209451 CCTAGCTGCTTGACGGCACTGGG + Intergenic
998954367 5:147423740-147423762 CCACCCTGGGTGACAGAGCTAGG - Intronic
999171084 5:149596003-149596025 ACAAGCTCCTTCACAGAACTGGG - Intronic
1005712185 6:28512972-28512994 ACACGCTGCCTTAAAGAACTGGG + Intronic
1006416743 6:33908862-33908884 CTACCCTTCTTGCCAGAACTTGG - Intergenic
1007252600 6:40506039-40506061 CCAGGCTCCTTGAAAGATCTAGG - Intronic
1008302310 6:49856207-49856229 CCAGGCTGTTTCCCAGAACTTGG + Intronic
1013625058 6:111928398-111928420 CAAAGCTGATTGACAGCACTGGG - Intergenic
1014787653 6:125636810-125636832 CCACTCTGTCTGAAAGAACTGGG - Intergenic
1015599980 6:134902543-134902565 GCACTCTGCTTGCCAGAATTTGG + Intergenic
1018815008 6:167324094-167324116 TCCCTGTGCTTGACAGAACTTGG + Intergenic
1022465435 7:30650077-30650099 CCACCCTGATTTACACAACTGGG - Intergenic
1034571655 7:151960947-151960969 CCACGCTGCTTGACAGAACTTGG - Intronic
1041460123 8:58102235-58102257 CAGCTCTGATTGACAGAACTTGG + Intronic
1041940149 8:63378176-63378198 CCACCCTGCGTGACAGAGCAAGG - Intergenic
1046789509 8:118305998-118306020 ACAGGCTGCCTGGCAGAACTTGG - Intronic
1047500326 8:125435524-125435546 CCACACTGCATTACAGAACACGG - Intronic
1051146872 9:14036047-14036069 CCACAATGCTTGATATAACTTGG - Intergenic
1059965661 9:119610979-119611001 CCAAGCTCCTTGCCAGAACCAGG - Intergenic
1060865043 9:126988892-126988914 TCACCCTGCTTGACTTAACTAGG - Intronic
1061572306 9:131485324-131485346 CCACGCTGGGAAACAGAACTGGG + Intronic
1188133959 X:26471392-26471414 CAAGGATGCTTGACTGAACTTGG - Intergenic
1189667913 X:43377179-43377201 CCAACCTCCTTGACACAACTTGG - Intergenic