ID: 1034572249

View in Genome Browser
Species Human (GRCh38)
Location 7:151965580-151965602
Sequence CAGCGTTAACAGTAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034572246_1034572249 8 Left 1034572246 7:151965549-151965571 CCACATTTTCTTCAGAGCTTAAT 0: 1
1: 0
2: 0
3: 35
4: 381
Right 1034572249 7:151965580-151965602 CAGCGTTAACAGTAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034572249 Original CRISPR CAGCGTTAACAGTAGGAGGC TGG Intronic
No off target data available for this crispr