ID: 1034576727

View in Genome Browser
Species Human (GRCh38)
Location 7:152006171-152006193
Sequence GCCACTGTGTTGGATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 268}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034576727_1034576733 30 Left 1034576727 7:152006171-152006193 CCAGCAGCATCCAACACAGTGGC 0: 1
1: 0
2: 1
3: 29
4: 268
Right 1034576733 7:152006224-152006246 CATTGGACTAAACCATGAGAAGG 0: 1
1: 0
2: 2
3: 11
4: 103
1034576727_1034576732 13 Left 1034576727 7:152006171-152006193 CCAGCAGCATCCAACACAGTGGC 0: 1
1: 0
2: 1
3: 29
4: 268
Right 1034576732 7:152006207-152006229 GAAGGACTGGAAATGAGCATTGG No data
1034576727_1034576731 0 Left 1034576727 7:152006171-152006193 CCAGCAGCATCCAACACAGTGGC 0: 1
1: 0
2: 1
3: 29
4: 268
Right 1034576731 7:152006194-152006216 TGGATCAGCGAGAGAAGGACTGG 0: 1
1: 0
2: 0
3: 12
4: 167
1034576727_1034576730 -5 Left 1034576727 7:152006171-152006193 CCAGCAGCATCCAACACAGTGGC 0: 1
1: 0
2: 1
3: 29
4: 268
Right 1034576730 7:152006189-152006211 GTGGCTGGATCAGCGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034576727 Original CRISPR GCCACTGTGTTGGATGCTGC TGG (reversed) Intronic
901152609 1:7113951-7113973 GCCACTGTTTCGGATTCTTCAGG + Intronic
902149834 1:14434340-14434362 ACAACTCTGCTGGATGCTGCTGG - Intergenic
902697952 1:18153111-18153133 GACCCTGTGGTGGCTGCTGCTGG - Intronic
902711616 1:18243765-18243787 GCCCTTGTGTTGGGTGCTGCTGG + Intronic
903364434 1:22797355-22797377 GTCACTTTGTCAGATGCTGCTGG - Intronic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
904400926 1:30256250-30256272 TCTACTGCGTAGGATGCTGCGGG - Intergenic
904557499 1:31374734-31374756 GCTCCTGTGTTGGCTCCTGCAGG - Intronic
908755442 1:67465171-67465193 GACACTGTGCTAGATGCTGGGGG - Intergenic
913493980 1:119410522-119410544 TCCACTATGATGGATGCTGCTGG - Intergenic
914490775 1:148148979-148149001 GCCACGGTGTTGGGGGCTGGGGG + Intronic
916935215 1:169620838-169620860 GCCACAGTGATGGATGATGTAGG + Intronic
917540549 1:175909093-175909115 ATCCCTGTTTTGGATGCTGCAGG + Intergenic
919438054 1:197588122-197588144 GGTACTGGGTTGGGTGCTGCAGG - Intronic
920353675 1:205354586-205354608 GCCAGTGGGATGGAAGCTGCTGG + Intronic
920828529 1:209445227-209445249 GCTGCTGTGGTGGGTGCTGCTGG - Intergenic
921265196 1:213416144-213416166 GGCACTCTGCTGGATGCTGAGGG + Intergenic
921704540 1:218306951-218306973 GCTCCTGTATTGGATGCTGCAGG + Intronic
923288801 1:232524167-232524189 GGCACTGTACTGGATGCTGTGGG + Intronic
923801341 1:237212526-237212548 GCCCAGGTGTTGGAGGCTGCAGG + Intronic
924380864 1:243463127-243463149 GACACTGTGCTGGATGCTATGGG + Intronic
924645898 1:245877093-245877115 GCCACGCTGTTGGGTGCTTCTGG + Intronic
924954278 1:248911850-248911872 GCCACTGTTCTGGGTGCAGCAGG + Intronic
1063233596 10:4089915-4089937 GCCTCTCAGTAGGATGCTGCAGG + Intergenic
1066976697 10:42375338-42375360 ACCTCTTTTTTGGATGCTGCGGG + Intergenic
1069841184 10:71340382-71340404 GCCACTGTGTATGATGGTGGAGG - Intronic
1069967256 10:72130680-72130702 GCCACTGTTTTGGGCGTTGCAGG - Intronic
1070280548 10:75045036-75045058 GGCACTGTGCTGGGTGCTGATGG + Intronic
1073750941 10:106526513-106526535 GCCACAGTGTTGGAAGATGTGGG + Intergenic
1075087605 10:119423945-119423967 GGCACTGTGCTGGGTGCTGGGGG + Intronic
1075805994 10:125189249-125189271 CCCGCTGTGCTGGATGCTGAGGG - Intergenic
1076228691 10:128802139-128802161 GCCACTGTGTTTTATCTTGCCGG + Intergenic
1076405100 10:130206462-130206484 GCCGCTGTGCTGGACGCTCCAGG + Intergenic
1077290197 11:1785829-1785851 GGCACTGTGCTGAATCCTGCAGG - Intergenic
1077425266 11:2473128-2473150 TCCCCTGTGCTGGAAGCTGCAGG + Intronic
1078242052 11:9538728-9538750 AGCACTGTGTGGGAAGCTGCTGG + Intergenic
1080054031 11:27886756-27886778 GGCACTGTGTTAAATGCTGCAGG - Intergenic
1080912467 11:36616749-36616771 GCTACTGTGTTGGACAGTGCAGG - Intronic
1081808235 11:45901384-45901406 GCCACTGTGGTGGGGGGTGCAGG + Intronic
1083068781 11:59954070-59954092 GTTACTGTGCTGGATACTGCAGG + Intergenic
1083295141 11:61711265-61711287 GCCTCTGTGATGGGTGCGGCCGG - Intronic
1084091346 11:66881061-66881083 GCCACTGTCTTGCTTGCTCCTGG + Intronic
1084462908 11:69306275-69306297 GGCACAGAGTTGGGTGCTGCGGG + Intronic
1085000768 11:73031874-73031896 GGCACTGTATTAGATGCTGGGGG + Intronic
1088358457 11:108967330-108967352 GCCACTGTGCTGGATGCTTTTGG + Intergenic
1089582622 11:119490873-119490895 GCCACTCTCTGGGCTGCTGCAGG + Intergenic
1089707746 11:120292705-120292727 CCCACTGGGGAGGATGCTGCAGG + Intronic
1091283062 11:134392959-134392981 AGCACTGTGTTGGATTCTGTGGG + Intronic
1091721625 12:2818163-2818185 GCCAAGGTGTTGGATGCTTCTGG + Exonic
1092164719 12:6335950-6335972 GGCACGGTGTTGGCTGGTGCGGG - Intronic
1092893746 12:12993567-12993589 GCCACTGTGTTAGATACTTTGGG + Intronic
1092901041 12:13059527-13059549 TCCACTGTAGTGGAGGCTGCAGG - Intronic
1095407684 12:41885783-41885805 GCCACAGTGATTGATGGTGCAGG - Intergenic
1096918108 12:55055173-55055195 GCCTCTGTGTTAGATGCAGAGGG - Intergenic
1097141689 12:56908079-56908101 GCCACTGTGCTGGCTACAGCGGG + Intergenic
1099385028 12:82003687-82003709 GCCACTGTATAGAAGGCTGCTGG - Intergenic
1100597062 12:96080976-96080998 GGCACTGGGTTAGATGCTGAGGG - Intergenic
1101491007 12:105209472-105209494 GCCACTGTCATTAATGCTGCTGG + Intronic
1101989246 12:109470911-109470933 TGCTCTGTGTTGGATGCTGCTGG - Intronic
1101998806 12:109543997-109544019 GCCTCTGTCTTGGAGGGTGCTGG + Intergenic
1102017124 12:109655459-109655481 GCCACAGGGTAGGATGCTGGTGG - Intergenic
1102870266 12:116408713-116408735 GCCAGTGGGGTGGAGGCTGCTGG + Intergenic
1105442942 13:20430352-20430374 GTCTCTGTGTTGGCTGCTGTGGG - Intronic
1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG + Intergenic
1106383053 13:29258494-29258516 TCCACAGTCTTGGATTCTGCAGG + Intronic
1106880365 13:34122586-34122608 GCCATTGTGTTGGTGGCTGAAGG + Intergenic
1107277510 13:38692840-38692862 TCCTCTGTGTTGTATGCTGCAGG + Intronic
1108534761 13:51363358-51363380 GCCACTGTGTTGTGTGATGTAGG - Intronic
1108703564 13:52964694-52964716 GTCACTGTGTTGGATTTTGGTGG - Intergenic
1113356590 13:109586964-109586986 GGCACTGTGAGGCATGCTGCTGG + Intergenic
1113784508 13:112995465-112995487 GCCGCTGTGTGAGCTGCTGCTGG + Intronic
1114718374 14:24852846-24852868 GCCACTGAGTGGCATGCTCCAGG - Intronic
1116114385 14:40629340-40629362 GCCATTGTGGTGGATGGTGGTGG + Intergenic
1116491268 14:45506373-45506395 GGCATTGTTTTGGATGCTGTTGG + Intergenic
1116797219 14:49404579-49404601 GCCAGTGCTTTGCATGCTGCTGG - Intergenic
1117078396 14:52127054-52127076 AACACTGTGTAGGTTGCTGCCGG + Intergenic
1118689555 14:68324964-68324986 GGCACTGTGTTAGTTGCTGTGGG - Intronic
1120399423 14:84009887-84009909 CCCTCTGTGTTCGATGGTGCTGG - Intergenic
1120529177 14:85611255-85611277 GCCACTGTGTCTGATGAAGCAGG - Intronic
1122248429 14:100420901-100420923 CCCACTGTCCTGGATGTTGCTGG + Intronic
1122689052 14:103522955-103522977 GCCAGGGTGTTGGGGGCTGCGGG - Exonic
1122719312 14:103713318-103713340 GCCAGTGTCTGGGATGCGGCAGG - Intronic
1124423087 15:29539219-29539241 GACACTCTGGTGGATGCTGGTGG - Intronic
1124868661 15:33519092-33519114 CCCACTGGTGTGGATGCTGCAGG - Intronic
1125356419 15:38821264-38821286 GGCACTGTGCTGGGTGCTGGAGG + Intergenic
1126075376 15:44904043-44904065 GGCACTGTGCTGGGTGCTGTGGG + Intergenic
1126082994 15:44983744-44983766 GGCACTGTGCTGGGTGCTGTGGG - Intergenic
1126694884 15:51317507-51317529 GCCCCTGTGCAAGATGCTGCAGG + Intronic
1127187459 15:56494123-56494145 GCCACTGTGCTGGGTGCTGTAGG - Intergenic
1127750013 15:62028133-62028155 ATCACTGTGCTGGATGATGCTGG - Intronic
1128602249 15:69006303-69006325 ATCTCTTTGTTGGATGCTGCGGG + Intronic
1128887651 15:71303250-71303272 GCCACTGTCCTGGATGAAGCAGG - Intronic
1129796927 15:78384864-78384886 GCCACAGTCTCGGCTGCTGCAGG - Intergenic
1130223014 15:82037194-82037216 GGCTCTGTGTTGGATGGTGTTGG + Intergenic
1130681345 15:85999598-85999620 GGCACAGTGTTGGAGGCTGAGGG + Intergenic
1133973935 16:10586742-10586764 TCCACTGTGCTGGTTGCTGAAGG - Intergenic
1134643990 16:15851841-15851863 GCCCCTGTGAAGGATGCTTCTGG + Intronic
1134890288 16:17835596-17835618 CTCACTGTTTTGGATGATGCAGG - Intergenic
1135285297 16:21187967-21187989 GTGCCTGTGTTGGGTGCTGCTGG + Intergenic
1138370269 16:56520961-56520983 ACAACTGTGTCAGATGCTGCGGG + Intergenic
1138593530 16:58016679-58016701 TCCACTGTGTGAGATACTGCTGG + Intronic
1139395803 16:66637978-66638000 GCCCGTGCCTTGGATGCTGCTGG - Intronic
1141606082 16:85154138-85154160 GCCCCTGCCATGGATGCTGCAGG - Intergenic
1141908994 16:87045727-87045749 TCCCCTGTGTCGGATGCCGCGGG + Intergenic
1142313065 16:89325296-89325318 GGCACTGTGGTGCATGCTGGCGG + Intronic
1143058304 17:4179004-4179026 GACACCGTGTTGGCTGCTGATGG + Exonic
1143092562 17:4457682-4457704 GCCACTGTCTTGGTTGGTTCTGG + Intronic
1143687399 17:8529070-8529092 GGCTCTGGGCTGGATGCTGCTGG + Intronic
1144582659 17:16468264-16468286 GCTACTGTGAATGATGCTGCTGG - Intronic
1146514824 17:33480849-33480871 GCATGGGTGTTGGATGCTGCAGG - Intronic
1146516223 17:33491657-33491679 GCCCCTGTGTTAGAAGCTGTTGG + Intronic
1147250066 17:39147823-39147845 GGCACTGTGCTGGGTGCTGGGGG + Intronic
1147923596 17:43933294-43933316 GGCACTGTGCTAGATGCTGGAGG + Intergenic
1150412440 17:64956570-64956592 GCCACTGTGTTGGCTGGAGAGGG + Intergenic
1150799455 17:68269053-68269075 GCCACTGTGTTGGCTGGAGAGGG - Exonic
1153759781 18:8319538-8319560 GGAACTGTGCTGGTTGCTGCTGG + Intronic
1155440272 18:25854946-25854968 GCCTCTTTCTTAGATGCTGCAGG + Intergenic
1155507156 18:26545666-26545688 GACACTGTGTTCTATTCTGCAGG - Intronic
1156290385 18:35744386-35744408 GCCACTGTGCTCGAGCCTGCGGG - Intergenic
1157713583 18:49866719-49866741 GGCACTGTGCTAGGTGCTGCAGG + Intronic
1158755177 18:60315589-60315611 GCCACCCTGTGGGATGCTGGTGG - Intergenic
1159376521 18:67600328-67600350 GACTCTGTGTGGAATGCTGCAGG - Intergenic
1160940941 19:1620187-1620209 GCCACTTTCTTGCCTGCTGCTGG - Intronic
1160994844 19:1877847-1877869 GCCACGGTGTTGGGGGCTGGGGG - Intronic
1161675674 19:5647227-5647249 GCCACTGAGCTGGATACTGAGGG + Intronic
1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG + Intronic
1162503006 19:11065229-11065251 GCCTCACTGTTGGAAGCTGCAGG - Intronic
1162890658 19:13730809-13730831 GCCACTGTGTACGATTGTGCAGG - Intergenic
1164714130 19:30379271-30379293 GCCTCTGTGTTGGGAGCTCCCGG + Intronic
1164720794 19:30430369-30430391 GGCTCTGTGTTGGGTGCTGGGGG + Intronic
925516936 2:4693057-4693079 GCCACTGTGGTGGAGGCTTCAGG + Intergenic
925591608 2:5515403-5515425 CAGACTGTGTTGAATGCTGCTGG + Intergenic
925968828 2:9092727-9092749 GGCACTGTGTTGGATGTTGGAGG + Intergenic
926116055 2:10214307-10214329 GCCCCTGTGTGGGATGGAGCGGG - Intergenic
926270909 2:11365317-11365339 GCCTCTGTATTGGCTGGTGCAGG + Intergenic
926693768 2:15756014-15756036 GCAACTGTGTTGGTTCCTTCTGG - Intergenic
926697942 2:15783873-15783895 GCCACTGTGATGCTTCCTGCAGG + Intergenic
928450051 2:31370675-31370697 GCCACTATGCTGAATGTTGCTGG + Intronic
933701628 2:85259125-85259147 GCCACTGTGTGTGGTGCTGTGGG - Intronic
933735819 2:85493330-85493352 GTCTCTCTTTTGGATGCTGCAGG - Intergenic
933779339 2:85790699-85790721 GGGACTGTGTTGGGAGCTGCAGG + Intergenic
935500407 2:103831450-103831472 GCCAGTGTGCTGGAAGCTGGGGG + Intergenic
935930440 2:108118365-108118387 GGCTCTGGGTTGGATGTTGCAGG - Intergenic
938277398 2:130038268-130038290 GCCACTGGGATGGAAGCAGCTGG + Intergenic
938328370 2:130429071-130429093 GCCACTGGGATGGAAGCAGCTGG + Intergenic
938361578 2:130692423-130692445 GCCACTGGGATGGAAGCAGCTGG - Intergenic
938437986 2:131299112-131299134 GCCACTGGGATGGAAGCAGCTGG - Intronic
938664792 2:133523754-133523776 GCTGGTGCGTTGGATGCTGCAGG - Intronic
938930661 2:136083969-136083991 TCAGCTGTGTTGGATGCTGTTGG + Intergenic
940004056 2:148995231-148995253 GCCACTGTGTGGCATCCTGAGGG + Intronic
941047338 2:160691268-160691290 GCAACGGTGTTAAATGCTGCGGG + Intergenic
943372924 2:187038292-187038314 ATCTCTGTTTTGGATGCTGCTGG + Intergenic
945297092 2:208181555-208181577 GCCACTGTGGTGGATGTTGATGG + Intronic
946537494 2:220647387-220647409 GGTACTGTGCTGGATGCTGGTGG + Intergenic
947820899 2:233068835-233068857 GCCCCTGTGACGGAGGCTGCTGG + Intronic
948373353 2:237504635-237504657 TCCACTCTGTTGGAGGCCGCCGG + Intronic
1169012200 20:2260060-2260082 ACCACTGTCTTGGAGGATGCTGG + Intergenic
1170202723 20:13761457-13761479 GCCACTGTGCTGGATAGTGGAGG - Intronic
1170869049 20:20187949-20187971 GCCACTCTCTTGGATACTCCTGG + Exonic
1174550124 20:51356169-51356191 AGCACTGTGTTGGATCCAGCCGG + Intergenic
1175344237 20:58260275-58260297 GGCACTGTGCTGGGTGCTGATGG + Intergenic
1176368383 21:6047363-6047385 GCCACTGTGATGAGGGCTGCAGG + Intergenic
1178549393 21:33523363-33523385 GCCACAGTGTTAGTTGCTACTGG - Intronic
1178878271 21:36429198-36429220 CCCACTGGGTTGGCTGCTTCTGG - Intergenic
1178983786 21:37286096-37286118 GCCTCTGTGCTGGCTTCTGCTGG + Intergenic
1179717983 21:43299786-43299808 GCCACTGTGATGGCAGCTGGGGG + Intergenic
1179755136 21:43491179-43491201 GCCACTGTGATGAGGGCTGCAGG - Intergenic
1180988524 22:19919709-19919731 GCCACTGTGTGGGCAGCCGCAGG - Intronic
1181386799 22:22551994-22552016 GCCACTGTGCTGGAGGGTGGAGG - Intronic
1183078875 22:35443700-35443722 CCCACTGTGCAGGAGGCTGCAGG - Intergenic
1183214636 22:36471463-36471485 GGCACAGTGCTGGGTGCTGCGGG + Intronic
1183442915 22:37833432-37833454 GCCACAGTGCTGAGTGCTGCTGG + Intronic
1184586797 22:45453423-45453445 CCCACTGTGATGCATGGTGCTGG + Intergenic
1184809883 22:46824238-46824260 GCTCCTGTGTTGGACGGTGCAGG + Intronic
950432364 3:12958224-12958246 GCCCCTGTGCTGGGTGCTGTGGG - Intronic
950520203 3:13493593-13493615 GCCACTGGATTGGATGGTGCTGG + Intronic
951222230 3:20080670-20080692 GCTACTGTGTTGGACACAGCAGG - Intronic
951574780 3:24102479-24102501 GGCACTGTGTTAGGTGCTGTAGG - Intergenic
952150256 3:30581393-30581415 GCAGCTGTATGGGATGCTGCGGG + Intergenic
953417253 3:42730119-42730141 GGCACTGTGCTTGGTGCTGCTGG - Intronic
953449545 3:42994786-42994808 TACACTGTGGTGGATGCTGTCGG - Intronic
953451122 3:43007235-43007257 GCCATTGTGTTGGATACTTGGGG + Intronic
953756025 3:45646498-45646520 GCTGCTGTGTTAGATGGTGCAGG - Intronic
953774803 3:45807312-45807334 GGCACTGGGTTGGCAGCTGCAGG + Intergenic
953789983 3:45939938-45939960 GCCACTGTGTTGGGCAGTGCAGG + Intronic
954322980 3:49844486-49844508 GCCCCTGACTTGGATGCTGGAGG - Intronic
957036453 3:75297887-75297909 GACACTGTGCTGGGTGCTGCAGG + Intergenic
958191818 3:90193795-90193817 GGCACTGTGTTAGATTCTGAGGG + Intergenic
959531951 3:107443014-107443036 GTCCCTGTATTGGATGCTGTTGG + Intergenic
960004899 3:112772042-112772064 GCCACTGTACTGGATGGCGCAGG + Intronic
960038985 3:113130064-113130086 GCCACCATCTTGAATGCTGCTGG + Intergenic
961047748 3:123721174-123721196 GCCACTGTCTGGGAGGCTGCAGG - Intronic
961080190 3:124020344-124020366 GGCACTGTGCTGGGGGCTGCAGG + Intergenic
961192622 3:124974862-124974884 GCCACTGTGTTGCTTCCTGGTGG + Intronic
961270206 3:125682390-125682412 GCCACTGTCTGGGAGGCTGCAGG + Intergenic
962961007 3:140310902-140310924 GCCTCTGTGTTAGGTGCTGCAGG + Intronic
965014029 3:163132303-163132325 GCCACTGCGCTGGCTGCGGCAGG - Intergenic
966090139 3:176124089-176124111 GCTACTGTGCTGAATGCTGTAGG - Intergenic
966658489 3:182386914-182386936 GGAACTGTGCAGGATGCTGCAGG - Intergenic
967041813 3:185700527-185700549 GCCACTGTATGGGATGGTGCTGG - Intronic
969258919 4:6021621-6021643 GCCACAGTCCTGGATGCTCCCGG + Intergenic
970493345 4:16599056-16599078 CACACTGTGTTAGAAGCTGCAGG + Intronic
970551084 4:17182002-17182024 GTCACTGTACTGAATGCTGCAGG - Intergenic
971130930 4:23809792-23809814 GCTACCATATTGGATGCTGCAGG + Intronic
971495563 4:27260663-27260685 TTCACAGTGTTGGATGCTGTTGG + Intergenic
972714905 4:41635714-41635736 AGCACTGTGCTGGATGCTGGGGG + Intronic
972720207 4:41688782-41688804 GGCACTGTACTGGGTGCTGCAGG + Intronic
972822823 4:42721720-42721742 CCCATTGTGTTGCTTGCTGCAGG + Intergenic
973717700 4:53693497-53693519 TGCACTGTGCTGGATGCTGGAGG - Intronic
975395731 4:73870911-73870933 GCCACTGTGATAGAGGCTGGCGG + Exonic
976834269 4:89352759-89352781 GCTGCTGTGTTGAATACTGCAGG + Intergenic
979201434 4:117984093-117984115 GCCACTGTGTTCTAAGCTACTGG + Intergenic
979551991 4:122001876-122001898 CCCACTGTGTGTGATGCTGGTGG + Intergenic
980646437 4:135648182-135648204 CCCAATGTAGTGGATGCTGCTGG + Intergenic
982667683 4:158286130-158286152 GCCACTGTGCTGAATACTGTAGG + Intergenic
985974283 5:3403235-3403257 GTCACTGTGCTGAATACTGCAGG - Intergenic
986706914 5:10460139-10460161 GCCAGGGTGTTGAAGGCTGCAGG + Intronic
986766719 5:10934991-10935013 GCCACTGTGTTTGTTTATGCTGG + Intergenic
987076523 5:14387368-14387390 GCCACTGTGTTTGAGGTTTCTGG + Intronic
988486211 5:31670255-31670277 GCCAGTGTTTTGGTTGCTGCTGG + Intronic
988839060 5:35065594-35065616 GCCACTCTGTTGAATGAAGCAGG - Exonic
989096717 5:37788593-37788615 GCCAGTCTGTTAGAGGCTGCAGG - Intergenic
989135515 5:38150662-38150684 GGCACCCTGTTGGATGCTGGAGG + Intergenic
992368339 5:76116081-76116103 CCTACTCTGTTGGATGGTGCAGG - Intronic
993914878 5:93731950-93731972 GTCATTTTGTTGGAAGCTGCAGG + Intronic
995325416 5:110884373-110884395 GCCTCTTTTTTGGATGCTTCAGG - Intergenic
997002012 5:129772711-129772733 GGCACAGTGCTGGATGGTGCTGG + Intergenic
997865751 5:137461335-137461357 GCCAGTGTCTTGGATGCAGATGG - Intronic
997997359 5:138597404-138597426 GTAGCTGTATTGGATGCTGCTGG + Intergenic
998018526 5:138751925-138751947 GGCAATGTGCTGGGTGCTGCAGG + Intronic
999650854 5:153766044-153766066 ACCACTGTGGGAGATGCTGCAGG + Intronic
1003377267 6:5591416-5591438 ACCACTCTGTTGGATTCTGTGGG + Intronic
1003488018 6:6596143-6596165 GCCACTTTGATGGATGATTCAGG - Intronic
1004247134 6:13989849-13989871 GCCAGTGTCTTGGAAGCTGAAGG + Intergenic
1004456618 6:15797450-15797472 TTCACCGTGTTGAATGCTGCTGG + Intergenic
1006512275 6:34528147-34528169 GGCACTGTGTTAGGTGGTGCAGG - Intronic
1006803050 6:36771612-36771634 GGCACTGTGTTGGGTGCTGTGGG - Intronic
1013076181 6:106773682-106773704 GCCTCTGCGGTGGATGCTGCTGG - Intergenic
1015511782 6:134044766-134044788 GGCACAGTGCTGGATGCTTCAGG - Intronic
1017875133 6:158517845-158517867 GTCACTGTGTTGAACACTGCAGG + Intergenic
1018366371 6:163123918-163123940 GCCACTGTGAAGGATGCTGCAGG + Intronic
1021328044 7:19298694-19298716 GCCATTGTGTTGGACATTGCTGG + Intergenic
1021777361 7:24067025-24067047 TCCTCTGAATTGGATGCTGCAGG - Intergenic
1023534514 7:41194213-41194235 GCCAGTGTGGTGGAGGCTGATGG - Intergenic
1024290618 7:47801079-47801101 GCCACAGTGTGGGAGGCTGGTGG - Intronic
1025235946 7:57234938-57234960 GCCACTGTCAAGGGTGCTGCCGG - Intergenic
1026933423 7:74237942-74237964 GCCACTGCGGAGAATGCTGCAGG - Intronic
1027465574 7:78510977-78510999 GCCACTGTGTTGGATGTGGTGGG + Intronic
1029635244 7:101779236-101779258 GCCCAGGAGTTGGATGCTGCAGG + Intergenic
1030654360 7:112149978-112150000 GACAGTGTGTTGGAAGCAGCTGG - Intronic
1033426967 7:141253313-141253335 CCCACTGTGTTGGGTCCTGATGG + Intronic
1034038800 7:147854613-147854635 ACCACTGTGCTGGATGATGCAGG - Intronic
1034141681 7:148824497-148824519 GCCACTGTACTGGATACTGGAGG - Intronic
1034353525 7:150432942-150432964 GCCACTGAGCTTGATCCTGCTGG + Intergenic
1034576727 7:152006171-152006193 GCCACTGTGTTGGATGCTGCTGG - Intronic
1034854289 7:154526462-154526484 GGTACTGTGTTGGATGCTGTGGG - Intronic
1035443028 7:158919807-158919829 GCCAATGTGTTGAATGATACAGG - Intronic
1035606413 8:933098-933120 GCCACTGTGCAGGGTTCTGCAGG - Intergenic
1036506360 8:9360053-9360075 CACCCTGTGCTGGATGCTGCAGG - Intergenic
1037256392 8:16960222-16960244 TCAACTGTGTTGTATGCTACTGG - Intergenic
1040879668 8:52191501-52191523 GCCACTGTGGTGGATGTCACAGG - Intronic
1042333218 8:67604623-67604645 GGCACTGTTCTGGATGCTGAGGG - Intronic
1044453042 8:92360396-92360418 GCCACTTTGTTGAAAGCTGTGGG + Intergenic
1044632573 8:94293458-94293480 GCCACTGTCATGGGTGCTGCAGG + Intergenic
1044781202 8:95745083-95745105 GCTACTGTGTTGGACTATGCAGG - Intergenic
1045382929 8:101644795-101644817 GCCTCAGTGTTGGCTGCAGCAGG - Intronic
1046183732 8:110686276-110686298 GCCACTGTGCTAGGTGCTGTGGG + Intergenic
1046237402 8:111443692-111443714 GCCATTCTGTTGGGTGATGCTGG + Intergenic
1046438012 8:114219354-114219376 GCCACTGGGTTTGCAGCTGCAGG - Intergenic
1047309000 8:123676625-123676647 GGCACTGTGCTAGATGCTGAGGG - Intergenic
1048884889 8:138902052-138902074 GACGCTGTGAAGGATGCTGCAGG + Intronic
1051095831 9:13464152-13464174 GCCACTGGGTTCCATCCTGCTGG - Intergenic
1051741245 9:20254458-20254480 GGCACTGTGTGGGGTGATGCAGG + Intergenic
1051968976 9:22863771-22863793 ACTACTGTGTTGCATGCTCCTGG - Intergenic
1053377828 9:37623134-37623156 GACACTGTGTTAGGTGCTGAGGG + Intronic
1054921411 9:70546423-70546445 ACCACTGGGTTGGATGTTTCTGG + Intronic
1055502488 9:76915476-76915498 GGCACTGTGCTGGAAGCAGCTGG - Intergenic
1055687237 9:78789802-78789824 GACACTGTGATAGTTGCTGCAGG + Intergenic
1057142347 9:92735103-92735125 CCCAGTGTGTTAGATCCTGCTGG - Intronic
1058455128 9:105131638-105131660 GGCTCTGTCCTGGATGCTGCAGG + Intergenic
1059767149 9:117394422-117394444 GCCACTATATTGGATTTTGCAGG + Intronic
1060192454 9:121601573-121601595 GCCTGTGTGTTGAATGCTGAAGG - Intronic
1061501143 9:131002992-131003014 GGCACTGTGCTGAATACTGCAGG + Intergenic
1061902101 9:133678205-133678227 GCCACTGTGGTGGAGGCTGGTGG - Intronic
1062663480 9:137653278-137653300 GTTACTGTGTTGAATACTGCAGG - Intronic
1062709845 9:137969118-137969140 GCATCTGTCTTGGGTGCTGCTGG + Intronic
1187107614 X:16260480-16260502 GGCACTGTGCTGGATGCTATGGG + Intergenic
1187744720 X:22396195-22396217 CACACTGTGCTGCATGCTGCTGG + Intergenic
1188341053 X:29002392-29002414 GCCAGTGTTTTGGATGAGGCAGG + Intronic
1189472238 X:41323067-41323089 TGCACTGGGTAGGATGCTGCTGG + Intergenic
1189815556 X:44821289-44821311 GGCACTGCGTTGGATGTTACAGG + Intergenic
1191633610 X:63351582-63351604 GCCACTGTGTAGGAGGCTGGCGG - Intergenic
1192182584 X:68925598-68925620 GCCATTGTGTTGGGTGCTGAGGG - Intergenic
1194828162 X:98589032-98589054 ACCTCTGTTTTGGATGCTTCAGG + Intergenic
1197138198 X:123087374-123087396 GTGACTGTGCTGAATGCTGCAGG - Intergenic
1198579442 X:138047793-138047815 GCCAGTGCGTTGGCAGCTGCTGG - Intergenic
1198985229 X:142444001-142444023 GACACTGTTTCGCATGCTGCAGG - Intergenic
1199704270 X:150410528-150410550 GCCACTGTGATGATAGCTGCTGG - Intronic
1202100212 Y:21299671-21299693 GCTACTGTAATGGATGGTGCAGG + Intergenic