ID: 1034578833

View in Genome Browser
Species Human (GRCh38)
Location 7:152025584-152025606
Sequence TCTCGCTGCCCTGACGTCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034578833_1034578837 -1 Left 1034578833 7:152025584-152025606 CCGGTGACGTCAGGGCAGCGAGA No data
Right 1034578837 7:152025606-152025628 AGGTTTCGTCACCGCGGCGCGGG No data
1034578833_1034578845 27 Left 1034578833 7:152025584-152025606 CCGGTGACGTCAGGGCAGCGAGA No data
Right 1034578845 7:152025634-152025656 GGCCGCCTGTCACGCGGCGCCGG No data
1034578833_1034578841 5 Left 1034578833 7:152025584-152025606 CCGGTGACGTCAGGGCAGCGAGA No data
Right 1034578841 7:152025612-152025634 CGTCACCGCGGCGCGGGGGCGGG No data
1034578833_1034578836 -2 Left 1034578833 7:152025584-152025606 CCGGTGACGTCAGGGCAGCGAGA No data
Right 1034578836 7:152025605-152025627 GAGGTTTCGTCACCGCGGCGCGG No data
1034578833_1034578842 6 Left 1034578833 7:152025584-152025606 CCGGTGACGTCAGGGCAGCGAGA No data
Right 1034578842 7:152025613-152025635 GTCACCGCGGCGCGGGGGCGGGG No data
1034578833_1034578835 -7 Left 1034578833 7:152025584-152025606 CCGGTGACGTCAGGGCAGCGAGA No data
Right 1034578835 7:152025600-152025622 AGCGAGAGGTTTCGTCACCGCGG No data
1034578833_1034578840 4 Left 1034578833 7:152025584-152025606 CCGGTGACGTCAGGGCAGCGAGA No data
Right 1034578840 7:152025611-152025633 TCGTCACCGCGGCGCGGGGGCGG No data
1034578833_1034578839 1 Left 1034578833 7:152025584-152025606 CCGGTGACGTCAGGGCAGCGAGA No data
Right 1034578839 7:152025608-152025630 GTTTCGTCACCGCGGCGCGGGGG No data
1034578833_1034578838 0 Left 1034578833 7:152025584-152025606 CCGGTGACGTCAGGGCAGCGAGA No data
Right 1034578838 7:152025607-152025629 GGTTTCGTCACCGCGGCGCGGGG No data
1034578833_1034578847 30 Left 1034578833 7:152025584-152025606 CCGGTGACGTCAGGGCAGCGAGA No data
Right 1034578847 7:152025637-152025659 CGCCTGTCACGCGGCGCCGGCGG No data
1034578833_1034578844 21 Left 1034578833 7:152025584-152025606 CCGGTGACGTCAGGGCAGCGAGA No data
Right 1034578844 7:152025628-152025650 GGGCGGGGCCGCCTGTCACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034578833 Original CRISPR TCTCGCTGCCCTGACGTCAC CGG (reversed) Intergenic
No off target data available for this crispr