ID: 1034578835

View in Genome Browser
Species Human (GRCh38)
Location 7:152025600-152025622
Sequence AGCGAGAGGTTTCGTCACCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034578833_1034578835 -7 Left 1034578833 7:152025584-152025606 CCGGTGACGTCAGGGCAGCGAGA No data
Right 1034578835 7:152025600-152025622 AGCGAGAGGTTTCGTCACCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034578835 Original CRISPR AGCGAGAGGTTTCGTCACCG CGG Intergenic
No off target data available for this crispr