ID: 1034578837

View in Genome Browser
Species Human (GRCh38)
Location 7:152025606-152025628
Sequence AGGTTTCGTCACCGCGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034578833_1034578837 -1 Left 1034578833 7:152025584-152025606 CCGGTGACGTCAGGGCAGCGAGA No data
Right 1034578837 7:152025606-152025628 AGGTTTCGTCACCGCGGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034578837 Original CRISPR AGGTTTCGTCACCGCGGCGC GGG Intergenic
No off target data available for this crispr