ID: 1034578847

View in Genome Browser
Species Human (GRCh38)
Location 7:152025637-152025659
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034578833_1034578847 30 Left 1034578833 7:152025584-152025606 CCGGTGACGTCAGGGCAGCGAGA No data
Right 1034578847 7:152025637-152025659 CGCCTGTCACGCGGCGCCGGCGG No data
1034578843_1034578847 -3 Left 1034578843 7:152025617-152025639 CCGCGGCGCGGGGGCGGGGCCGC No data
Right 1034578847 7:152025637-152025659 CGCCTGTCACGCGGCGCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034578847 Original CRISPR CGCCTGTCACGCGGCGCCGG CGG Intergenic
No off target data available for this crispr