ID: 1034581146

View in Genome Browser
Species Human (GRCh38)
Location 7:152043640-152043662
Sequence GTGCAGCTTGAACAGTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034581143_1034581146 7 Left 1034581143 7:152043610-152043632 CCTGAATAGAACTGAGAGCTGTT 0: 1
1: 5
2: 35
3: 85
4: 212
Right 1034581146 7:152043640-152043662 GTGCAGCTTGAACAGTCAGTGGG No data
1034581142_1034581146 11 Left 1034581142 7:152043606-152043628 CCTGCCTGAATAGAACTGAGAGC 0: 21
1: 88
2: 58
3: 27
4: 123
Right 1034581146 7:152043640-152043662 GTGCAGCTTGAACAGTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034581146 Original CRISPR GTGCAGCTTGAACAGTCAGT GGG Intronic