ID: 1034581152

View in Genome Browser
Species Human (GRCh38)
Location 7:152043687-152043709
Sequence TCTGGAAAAGAAAGATCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 2, 1: 56, 2: 34, 3: 83, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034581152 Original CRISPR TCTGGAAAAGAAAGATCCGG AGG Intronic
900086053 1:897828-897850 TCTGGAAAAGAAATACCTGGAGG + Intergenic
901385801 1:8908289-8908311 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
902391195 1:16107933-16107955 TCTGGAAAAGAAAGATCAGGAGG + Intergenic
902904164 1:19542251-19542273 TCCAAAAAAGAAAGATCTGGAGG - Intergenic
902965516 1:19998269-19998291 TCCGGAAAAGAAAGATCTGGAGG - Intergenic
905051199 1:35052598-35052620 TCTTGGAAAGAAAGATTCTGTGG + Intergenic
905197443 1:36291352-36291374 TCTGAAAAAGAAATATGGGGAGG - Exonic
905652921 1:39668499-39668521 TCTGGAAAAGAGAGAAGCAGAGG - Intronic
906543308 1:46604444-46604466 TTCGGAAAAGAAAGCGCCGGAGG - Intronic
906774772 1:48519384-48519406 TCCAGAAAAGAATGATCTGGAGG + Intergenic
907455569 1:54573145-54573167 TCTGGTTAAGGAAGAGCCGGTGG + Intronic
907809453 1:57853908-57853930 TCTGGTAAAAACAGATGCGGAGG - Intronic
908448926 1:64230588-64230610 TCTGGAAAAAAAAAATAAGGGGG - Intronic
910855702 1:91693115-91693137 TCTGGAAAAGAACTATCATGTGG + Intronic
911136430 1:94445634-94445656 TCTGGAAAAGAAAGATCTGGAGG - Intronic
914982062 1:152423788-152423810 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
915179776 1:154048206-154048228 TCTGGAAAAGAAAGATCTGGAGG - Intronic
916478430 1:165192587-165192609 TCTGGAAAAGCAGGATGCTGGGG - Intergenic
918742469 1:188151939-188151961 TCTGGAGAAAAAAGACCCTGTGG + Intergenic
920097791 1:203497853-203497875 TCAGGATAAGAAAGATGCTGGGG + Intronic
920427731 1:205891555-205891577 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
920748780 1:208654368-208654390 TCTGGAAAGGAAGGTTCAGGAGG + Intergenic
921227130 1:213031563-213031585 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
922663793 1:227452073-227452095 ACTGGAAAAACAAGATCTGGAGG + Intergenic
924404735 1:243730791-243730813 TCTGGAAAAGGGGGATGCGGTGG - Intronic
924688358 1:246320311-246320333 TTTGGAAAAGCAAGCTCCGGAGG + Intronic
924765171 1:247025498-247025520 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1065308930 10:24395548-24395570 CCTGGAAAAGAAAGTTCCCTTGG + Intronic
1066988281 10:42487607-42487629 TCCAGAAAAGAAAGATTCGGAGG - Intergenic
1066990621 10:42509881-42509903 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
1068166660 10:53340145-53340167 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1069056324 10:63848291-63848313 TCTGGAAAAGAAAGATCCGGAGG - Intergenic
1069491820 10:68867518-68867540 TCTGGAAAAGAAAGATCCAGAGG + Intronic
1071310236 10:84336557-84336579 ACTGGAATACAAAGATCCTGTGG + Intronic
1074980367 10:118614863-118614885 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
1075621484 10:123931130-123931152 TCTGGCAAAGAGACTTCCGGTGG + Intronic
1076416262 10:130291654-130291676 TCCGGAAAAGAAAGATCTGGAGG - Intergenic
1076852861 10:133101617-133101639 TCCTGAAAAGAAAGAACCCGAGG + Intronic
1082301265 11:50509298-50509320 TCTAGAAAAGAAAGATCTGGAGG - Intergenic
1085840464 11:80005842-80005864 TCTGGAAAAGAAAAACCTGAAGG + Intergenic
1088491956 11:110397074-110397096 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1090954070 11:131499010-131499032 GCTGGAAAAGAATGTCCCGGGGG - Intronic
1091697241 12:2636146-2636168 TCTGGAAAGGAAACCTCCTGAGG - Intronic
1092108425 12:5941315-5941337 TATGGAAAAGAAAAATCCATTGG + Intronic
1093462788 12:19421458-19421480 TCTGGAAAAGAAAAATTAGCTGG + Intronic
1095912996 12:47447875-47447897 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1096308241 12:50497958-50497980 TCCGGAAAAGAAGGATCCGGAGG + Intergenic
1096450782 12:51739387-51739409 TCCGGAAAAGAAAGATCCGGGGG + Intronic
1098007872 12:66018551-66018573 TCTGTAAAACAAAGATCAGGAGG - Intergenic
1100414366 12:94356421-94356443 TCTGGAAAAGAAAGATCTGGGGG - Intronic
1101223771 12:102667307-102667329 TCTGGTAAAGAAAAATCTGGAGG + Intergenic
1101501487 12:105308370-105308392 TCCAGAAAAGAAAGATCTGGAGG + Intronic
1101598347 12:106187628-106187650 TCTGGGAAAGAAAGGTCCGGAGG - Intergenic
1102065866 12:109975077-109975099 TCAGGAAAAGAAAGCTAGGGTGG - Intronic
1105028794 12:132868725-132868747 TCTAGAACAGAAAAATCCAGAGG + Intronic
1105352353 13:19627186-19627208 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1105499677 13:20960782-20960804 TCTAGAAAAAAAAGAGCGGGGGG + Intergenic
1105666270 13:22560257-22560279 TCTGTAAAAGAAAGGGACGGAGG + Intergenic
1105710769 13:23006963-23006985 TCTGGAAAAGAGAGATCTGCAGG - Intergenic
1108865650 13:54919517-54919539 TCAGGAAAAGAAAGATCTGGAGG + Intergenic
1108970406 13:56368374-56368396 TGTGGAAAACAAACATCTGGTGG - Intergenic
1111780711 13:92720129-92720151 TCTGGCAAAGAAAAATAGGGTGG + Intronic
1113239919 13:108326117-108326139 TATGGATAAGAAAGCTCAGGGGG - Intergenic
1116238688 14:42313311-42313333 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1116999483 14:51357555-51357577 TCATAAAAAGAAAGATCTGGAGG - Intergenic
1117082357 14:52165446-52165468 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1117378736 14:55138943-55138965 TCTGGAAAGGAAGGATCCTGTGG - Intronic
1118434386 14:65756207-65756229 CCTGGAAAAGAAGGATCCCTGGG + Intergenic
1118755749 14:68842645-68842667 GCTGGAAAAGAAAGAACTCGTGG - Intergenic
1120558401 14:85958965-85958987 TTTGGAAATGAAATATCGGGGGG - Intergenic
1120691786 14:87601056-87601078 TCTGGAAAAGTAAGTTTCTGGGG - Intergenic
1122652795 14:103234860-103234882 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1122783991 14:104155591-104155613 TCTGGCAAAGCGAGAGCCGGGGG - Intronic
1123009797 14:105343104-105343126 TCTGGAAAAGGCAGAGCTGGGGG - Intronic
1202843810 14_GL000009v2_random:148552-148574 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
1202913213 14_GL000194v1_random:138796-138818 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
1202879442 14_KI270722v1_random:43889-43911 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1123789021 15:23701096-23701118 TCCGGAAAAGAAAGATCTGGAGG + Intergenic
1123984971 15:25637155-25637177 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1124350589 15:28952988-28953010 TCAGGAAAAGGAAGAACAGGCGG + Intronic
1130302818 15:82692964-82692986 TCTGGAAAAAAAAAATCAGTAGG + Intronic
1131038189 15:89239422-89239444 TCTAGAAAAGAAAGATCTGGAGG + Intergenic
1131654329 15:94439954-94439976 TCTGGAATAGACAGATACAGTGG - Intronic
1131919812 15:97312824-97312846 TCTGGAAAAGAAAGACACTGTGG - Intergenic
1132204253 15:99975704-99975726 TCTAGAAATGAAAGCTCCAGGGG - Intronic
1133040969 16:3059515-3059537 CCTGGAAAAGGAAGGTCCTGCGG - Exonic
1133044601 16:3080699-3080721 TCCGGAAAAGAAAGATCTGGAGG + Intronic
1133796131 16:9047916-9047938 TCTGGGAGAGCAAGAGCCGGAGG + Intergenic
1136638396 16:31540575-31540597 GCCCGAAAAGAAAGATCTGGGGG - Intergenic
1136982923 16:35074634-35074656 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
1137423338 16:48354738-48354760 TCCAGAAAAGAAAGATCTGGAGG + Exonic
1141339442 16:83189397-83189419 TCAGAAAAAGAAAGAACCAGAGG - Intronic
1143179069 17:4973099-4973121 CCTTGAAAAGGAAGATCCTGAGG - Intronic
1143430638 17:6880663-6880685 TCCGGAAAAGAAAGATCTGGAGG + Intronic
1143483452 17:7239635-7239657 TCTGGGAATCAAAGTTCCGGAGG - Intronic
1144703714 17:17354094-17354116 CCTGGAAAGGAAAAATCCAGGGG + Intergenic
1145219857 17:21079461-21079483 TCTGGAAAAGAAAGATCTGAGGG + Intergenic
1145744782 17:27308727-27308749 TCTGGAAAAAAAAGAGAAGGGGG + Intronic
1145801083 17:27685324-27685346 TCCAGAAAAGAAAGATCAGGAGG - Intergenic
1146101865 17:29990880-29990902 TCCAGAAAAGAAAGATCTGGAGG + Intronic
1146293993 17:31633951-31633973 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1147883956 17:43672032-43672054 TATGGAAGAAAAAGATCTGGAGG + Intergenic
1147944064 17:44070503-44070525 GCTGGAGAAGAGAGGTCCGGTGG + Intergenic
1148639497 17:49175826-49175848 TCTGGAAAAGAAAGATCTGTAGG + Intergenic
1150460451 17:65345949-65345971 TATTGAAAAGAAAGCTCCAGGGG + Intergenic
1152297263 17:79475342-79475364 TCTGGAAAAGAACCATCCCTTGG - Intronic
1153970771 18:10225104-10225126 TCCGGAAAAGAAAGATCTGGAGG + Intergenic
1154004903 18:10518879-10518901 TCTGGAAAATAAGGGTCCTGTGG + Intergenic
1159998238 18:74989239-74989261 TCTGGAAAAGACAGATCTCTAGG + Intronic
1160072194 18:75638812-75638834 TCTGGAGAACAAAGAGCGGGAGG + Intergenic
1162031959 19:7921401-7921423 TCTAGAAAGGAAAGAGGCGGCGG - Exonic
1162252191 19:9454986-9455008 TCCAGAAAAGAAAGATCCAGAGG - Intergenic
1162283211 19:9717085-9717107 TCCGGAAAAGAAAGATCTGGAGG + Intergenic
1162642523 19:12022851-12022873 TCCAGAAAAGAAAGATCTGGTGG - Intronic
1162652757 19:12103407-12103429 TCCAGAAAAGAAAGATCTGGAGG + Intronic
1164025070 19:21344418-21344440 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1164032238 19:21418152-21418174 TCTGGAAAAGAAAGATCTGGAGG + Intronic
1164060867 19:21672522-21672544 TCTGGAAAAGAAAGATCTGAAGG + Intergenic
1164256850 19:23534661-23534683 TCGGGAAAAGAAAGATCTGGAGG - Intronic
1164262030 19:23576438-23576460 TCCAGAAAAGAAAGATCTGGAGG + Intronic
1165724108 19:38100693-38100715 TCTGCAAAAGCAAAATCTGGAGG - Intronic
1165866212 19:38940952-38940974 TCTGGAAAAGAAAGATCTGGAGG + Intronic
1166659167 19:44634618-44634640 TCCAGAAAAGAAAGAACTGGAGG + Intronic
1167045085 19:47045169-47045191 TCTGGAAGAGGAAGATGCTGAGG - Exonic
1167344109 19:48934835-48934857 CCTGGGAAAGAGAGATCTGGGGG - Intronic
1167863708 19:52306888-52306910 TCTGGAAAAGAAAGACCTGGAGG + Intronic
1167951404 19:53030638-53030660 TCTGGACTTGAAAGATCCAGGGG + Intergenic
1202655060 1_KI270708v1_random:12898-12920 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
924992728 2:327861-327883 TCTGGAAATGAAAGACACAGAGG - Intergenic
926369831 2:12168629-12168651 TCTGGGAAAGTCAGATCCGAAGG + Intergenic
927117943 2:19923606-19923628 TCTGGAAAAGAAAGATCTGGAGG - Intronic
928611965 2:32999809-32999831 TCTAAAAAAAAAAGATCCAGAGG + Intronic
928703058 2:33918632-33918654 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
929631570 2:43468360-43468382 TATGGAAAAGTGAAATCCGGTGG + Intronic
930183206 2:48385383-48385405 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
930918177 2:56719859-56719881 TCCGGAAAAGAAAGATCTGGGGG - Intergenic
931441663 2:62294387-62294409 TCTGAAAAAGAAAGGTCGAGGGG + Intergenic
933880171 2:86661665-86661687 TCTGGAAAATAAGGATATGGAGG - Intronic
935026010 2:99277715-99277737 TCTGGAAAAGAAAGATCTGGAGG + Intronic
935915766 2:107947779-107947801 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
936594468 2:113834800-113834822 TCTGTAAAACAAAGAACCAGAGG + Intergenic
936799678 2:116252213-116252235 TCTGGAAAAGAAAGATCTGGCGG - Intergenic
937130829 2:119511603-119511625 TCTGAGACAGAAATATCCGGAGG - Intronic
939362198 2:141186872-141186894 TCTTAAAAACAAAGATCCAGAGG - Intronic
940159317 2:150694068-150694090 CCTGGAAAAGAAGACTCCGGGGG + Intergenic
940301515 2:152180564-152180586 TCCAGGAAAGAAAGATCTGGAGG + Intergenic
940310980 2:152278882-152278904 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
940774392 2:157871656-157871678 TCTGGAAAACAAAGCTCTGATGG + Intronic
940890833 2:159033740-159033762 GCTGGATAAGAAAGAACCTGGGG - Intronic
941903425 2:170698873-170698895 CCTGGTAAAGAAAGAGACGGTGG + Intergenic
942043969 2:172088327-172088349 TCCGGAAAAGAAGGACCCAGAGG + Exonic
943062458 2:183052876-183052898 TCTGGAAAAGAAGCATCTGGAGG + Intergenic
946362039 2:219224722-219224744 TCTGGAAACGGAGGATGCGGTGG + Exonic
946518809 2:220443646-220443668 TCTGGAAAAGGAAGAGTCAGAGG - Intergenic
947584490 2:231345262-231345284 TCTGGAATAAAAAAATCCTGGGG - Intronic
947731627 2:232434606-232434628 ACTGGAAAAGATAGATCCAGGGG + Intergenic
1169403552 20:5304094-5304116 TCCAGAAAAGAAAGATCTGGAGG - Intronic
1170371950 20:15658698-15658720 TCTGGAAAAGAAAGTTTCTTTGG - Intronic
1170715153 20:18824799-18824821 TCTGGAAAAGAAAGTTGGGGTGG + Intronic
1170973869 20:21141999-21142021 TCTGGAGAAGACAGATTTGGGGG - Intronic
1171229076 20:23467775-23467797 TCCAGAAAAGAAAGATCTGGGGG - Intergenic
1171302956 20:24079835-24079857 CAAGGAAAAGAAAGATCCGTGGG + Intergenic
1171320909 20:24243422-24243444 TCTGTGAATGAAAGATCCTGAGG + Intergenic
1173066910 20:39721879-39721901 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1176632562 21:9153466-9153488 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
1176640748 21:9301353-9301375 TCCAGAAAAGAAATATCTGGAGG - Intergenic
1178690456 21:34745903-34745925 TTTGAAAATGAAAGTTCCGGTGG + Intergenic
1179626321 21:42651491-42651513 TCTAAAAAAGAAAAATCCTGCGG - Intergenic
1180142808 21:45902504-45902526 TCAGCAACAGAAAGATCCAGAGG - Intronic
1180349772 22:11790736-11790758 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1180374054 22:12074186-12074208 TCCAGAGAAGAAAGATCTGGAGG - Intergenic
1180388432 22:12201503-12201525 TCCAGAAAAGAAAGATCTAGAGG + Intergenic
949606360 3:5658568-5658590 CTAGGAAAAGAAAGATCCTGTGG - Intergenic
951007474 3:17635190-17635212 TTTGGAAGAGAAAGAACAGGAGG + Intronic
951162837 3:19446768-19446790 TCAGGAAAAGAAAGAGAAGGGGG + Intronic
951270660 3:20619605-20619627 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
951291846 3:20880569-20880591 CATGGAAAAGAAAGATATGGGGG - Intergenic
952938577 3:38421843-38421865 TCTGGAAAAGAAAGATTCGGAGG - Intergenic
954199237 3:49014377-49014399 CCTGCAAAAGAAAGAGCCTGGGG - Exonic
954231327 3:49220003-49220025 TCCGGAAAAGAAAGATCTGGAGG - Intronic
955387213 3:58489281-58489303 CCTGGAAAAGAAAGGTGCAGAGG + Intergenic
955976361 3:64484237-64484259 TGTGGACAAGAAAGAGCCGCTGG + Intergenic
956518179 3:70073681-70073703 TTTGGAAAATAAAGATCAAGAGG - Intergenic
956561294 3:70578306-70578328 TCTGTAACAGACAGATCTGGTGG - Intergenic
957099412 3:75809262-75809284 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
959211147 3:103382605-103382627 GCTGGAAAGGAAAGATACAGTGG + Intergenic
959252616 3:103966774-103966796 TCTGGACAAGAGAAATGCGGTGG - Intergenic
960384388 3:117003947-117003969 TCTGGAAAAGGAAGTTTAGGAGG - Intronic
960788335 3:121398989-121399011 TCCGGAAAAGAAAGATCTGGAGG + Intronic
961323242 3:126092958-126092980 TGCAGAAAAGAAAGATCTGGAGG - Intronic
961859331 3:129902103-129902125 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
961948111 3:130715098-130715120 TCGGGAAAAAATAGATCCTGGGG - Intronic
962246569 3:133800196-133800218 TCTGGGAAGGAAACACCCGGAGG - Intronic
964326817 3:155555812-155555834 TAAGGAAAAGAGAGATCCTGTGG - Intronic
965315292 3:167183046-167183068 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
966009373 3:175056124-175056146 TCCGGAAAAGAAAGATCTGGAGG + Intronic
966968404 3:185018914-185018936 TCTGGAAAAGAAAGATCTGGAGG + Intronic
966978314 3:185106056-185106078 TCTGGAAAAGAAAGATATGGAGG - Intronic
1202746145 3_GL000221v1_random:103671-103693 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
969895677 4:10302376-10302398 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
970290427 4:14565220-14565242 GATGGGAAAGAAAGACCCGGAGG - Intergenic
970329483 4:14964894-14964916 TCTGAAAAAAAAAGATGGGGTGG - Intergenic
970466896 4:16333212-16333234 TCTGGAAAGAAAACATCCTGGGG - Intergenic
972080222 4:35140602-35140624 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
972659018 4:41095769-41095791 TCTGGAAAAGAGAAAACTGGAGG - Intronic
973008449 4:45042921-45042943 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
974344172 4:60657303-60657325 TCAGGAAAAGAAACAGCTGGAGG - Intergenic
975352079 4:73358007-73358029 TCCGGAAAAGAAAGATCTGGAGG - Intergenic
976324459 4:83755078-83755100 TCTGAGTAAGAAAGATCCAGGGG - Intergenic
976557037 4:86461769-86461791 TCCAGAAAAGAAAGATCTGGAGG - Intronic
976977864 4:91186150-91186172 TCCAGAAAAGAAAGATCTGGAGG + Intronic
977016790 4:91701118-91701140 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
977443703 4:97101749-97101771 TCCAGAAAAAAAAGATCTGGAGG + Intergenic
977642012 4:99367917-99367939 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
977653016 4:99491423-99491445 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
977856979 4:101906487-101906509 TCTGGAAAATAAAGATCTGGAGG + Intronic
979776550 4:124595803-124595825 ACTGGAAAATAAAGAACCTGTGG + Intergenic
979858199 4:125661210-125661232 TCTGGAAGAGAAAGAGGAGGAGG + Intergenic
979893599 4:126131607-126131629 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
979982748 4:127276599-127276621 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
980402012 4:132302865-132302887 TCTGGAAAAGAAATATTAGCAGG - Intergenic
980667668 4:135960158-135960180 TCCGGAAAAGGAAGATCTGGAGG + Intergenic
982282046 4:153693543-153693565 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
984061051 4:174989499-174989521 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
984169660 4:176344602-176344624 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
984956487 4:185050828-185050850 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1202755637 4_GL000008v2_random:59625-59647 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
985500727 5:243004-243026 TCTGGAAAAGAAAGATCTGGAGG - Intronic
985736132 5:1584514-1584536 TCTGGAAATGAAAGATCTGGAGG + Intergenic
986467132 5:8037132-8037154 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
987574069 5:19703547-19703569 TCCACAAAAGAAAGATCTGGAGG - Intronic
988811140 5:34786369-34786391 TCTGGAAAAGAAAGATCTGGAGG + Intronic
989758716 5:44987100-44987122 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
990109421 5:52305352-52305374 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
990307117 5:54504548-54504570 TCCGGAAAAGAAAGATCTGGGGG + Intergenic
993295851 5:86138761-86138783 GCTGGGAAAGAAAGTTCAGGAGG - Intergenic
993405851 5:87511189-87511211 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
993564912 5:89461848-89461870 GCTGGAAAGGAAATATCCAGAGG + Intergenic
994488827 5:100415698-100415720 ACTAGAAGAGAAAGATCCTGTGG + Intergenic
995203310 5:109450560-109450582 TCTGGAAACAAAAGATACGGAGG - Intergenic
995592359 5:113712782-113712804 TCCAGAAAAGAAAGACCTGGAGG - Intergenic
995711596 5:115041449-115041471 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
996049580 5:118916881-118916903 TCTGGATCAGAAAGATCCAGAGG + Intronic
996291779 5:121860083-121860105 TCCAGAAAAGAAAGATCTGGGGG + Intergenic
1001118783 5:168961745-168961767 TCTGGAAAAGAAAGAGCCACGGG + Intronic
1003471868 6:6443722-6443744 TCTGCAAACTAAAGATCCAGGGG - Intergenic
1004155669 6:13165835-13165857 TATTGAAAAGAAACATCCCGGGG - Intronic
1005858282 6:29880948-29880970 TCCAGAAAAGAAAGATGTGGGGG + Intergenic
1006038678 6:31235203-31235225 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
1007886557 6:45236577-45236599 TCCAGAAAAGAAAGATCTGGAGG - Intronic
1008093534 6:47315894-47315916 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1008901277 6:56619743-56619765 GCTGGAAAGGAAGGATCAGGCGG - Intronic
1009062920 6:58418828-58418850 TCTGGGAAATAAAGATCTGTAGG + Intergenic
1009708894 6:67291876-67291898 TCTGGAAGAGAAAATTCCTGAGG + Intergenic
1009765736 6:68072973-68072995 TCTGGAAAAGTAAGATGCAGTGG + Intergenic
1009955521 6:70448176-70448198 TCTGGAAAGGAAAGATCTGGAGG + Intronic
1010123493 6:72406815-72406837 TCTGGAACAGAAAGATTGTGAGG - Intergenic
1010348545 6:74842451-74842473 TCTAGAAAAGAAAATACCGGAGG - Intergenic
1013475145 6:110500037-110500059 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1013519265 6:110917606-110917628 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1013580464 6:111529138-111529160 TCTGGAAAAGATAGGTTTGGGGG + Intergenic
1013739646 6:113267605-113267627 TCTGGGAAAGAAAGATCTGGAGG + Intergenic
1014863970 6:126505703-126505725 TCCGGAAAAGAAAGCTCTGGAGG - Intergenic
1017397185 6:154015144-154015166 TCTAGAAAAGAAAAACCTGGTGG - Intronic
1017635935 6:156443123-156443145 CCTGGAAAATAAAGATACAGTGG - Intergenic
1018371944 6:163176535-163176557 GCTGGAAAAGAAAGAAAGGGGGG + Intronic
1018824972 6:167402044-167402066 TCTGGAGAAGGAGGAACCGGAGG + Intergenic
1019140754 6:169940771-169940793 TCTGGAAAAGACATCTGCGGCGG - Intergenic
1020374029 7:7465075-7465097 TCTTGAAAAGATACAACCGGGGG + Intronic
1021311212 7:19100465-19100487 TCTGGAAAAGCAAGGTCCACAGG + Intronic
1021368947 7:19817518-19817540 TCCTGAAAAGAAAGAGCTGGAGG - Intergenic
1023118922 7:36889926-36889948 TTTGAAAAAGAAAGAGCTGGTGG - Intronic
1023574411 7:41610611-41610633 TCTGGGACAGACAGATCTGGGGG - Intergenic
1023676552 7:42636076-42636098 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1023804672 7:43864115-43864137 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1024102253 7:46044284-46044306 TCCAGGAAAGAAAGATCTGGTGG + Intergenic
1025102309 7:56145720-56145742 TCCAGAAAAGAAAGATCTTGAGG - Intergenic
1025122590 7:56317794-56317816 TCCGGAAAAGAAAGATCTGGAGG - Intergenic
1025595621 7:62921239-62921261 TCTGGAAAAGAAAGATTTCTGGG + Intergenic
1025949188 7:66130031-66130053 TCTGGAAAAGAAAAATTTTGAGG - Intronic
1027438494 7:78192973-78192995 ACTGAAAAAGAAAGCTCTGGAGG + Intronic
1028201708 7:87969496-87969518 TCTGGGAAAGAAAGATGAGTTGG - Intronic
1028362148 7:89981554-89981576 TTTGGAAAATACAGATACGGTGG - Intergenic
1028780327 7:94728425-94728447 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1028806801 7:95037111-95037133 TCTGGAAAAAAAAGAGGGGGAGG + Intronic
1030620423 7:111783952-111783974 ACTGGAAAAGAAAGAACCCGGGG + Exonic
1034246808 7:149651116-149651138 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1034276848 7:149827618-149827640 GGTGGATAAGAAAGATCAGGAGG + Intergenic
1034302005 7:150024405-150024427 TCTGGCACAGAGAGAGCCGGGGG - Intergenic
1034581152 7:152043687-152043709 TCTGGAAAAGAAAGATCCGGAGG + Intronic
1034738322 7:153449798-153449820 TCTGGAAAAGAGAAATGCAGGGG + Intergenic
1034804049 7:154072910-154072932 TCTGGCACAGAGAGAGCCGGGGG + Intronic
1034942884 7:155243309-155243331 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
1036618102 8:10404293-10404315 TCAGGAAAAGAAAGATTCCAGGG - Intronic
1038733776 8:30151010-30151032 TCCAGAAAAGAAAGATCTGGAGG + Intronic
1039691691 8:39871254-39871276 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1040318794 8:46278901-46278923 TCCAGAAAAGAAAGATATGGAGG - Intergenic
1040381487 8:46877391-46877413 TCCAGAAAAGAAATATCTGGAGG - Intergenic
1040391729 8:46955778-46955800 TCTGGAGAAGAGAGATCCAACGG + Intergenic
1040528922 8:48249572-48249594 TCTGGAAAAAAAAGATCTGTAGG + Intergenic
1040608921 8:48963147-48963169 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1040946944 8:52894074-52894096 ACTGGAAAGGAAAGACCCAGGGG - Intergenic
1041018856 8:53617934-53617956 TCTGGAAAAGGAAGATCTGGAGG - Intergenic
1041948329 8:63472364-63472386 TCTGGAAAAAAAAAATGCTGTGG - Intergenic
1042446335 8:68889509-68889531 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1043024102 8:75044921-75044943 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1043445797 8:80318153-80318175 TCTGGAACAGAAAGAATGGGAGG - Intergenic
1043675306 8:82944327-82944349 TGTGGAAAAGAAATATTAGGTGG - Intergenic
1044442373 8:92237404-92237426 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1047562895 8:126008580-126008602 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1048686662 8:136911975-136911997 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1049785863 8:144450390-144450412 TCTGGAACAGGAAGAGCCGCAGG + Exonic
1049857481 8:144871914-144871936 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1050667812 9:7961064-7961086 TCTGGAAAAGGAATTTCCTGGGG + Intergenic
1053126213 9:35582824-35582846 TCCGTAAAAGAAAGATCTGGAGG - Intergenic
1053298136 9:36929726-36929748 TCTCAAAAAGAAAGATTCTGTGG - Intronic
1056800614 9:89688168-89688190 CCTGGAAAAGAGATATCCAGGGG + Intergenic
1057191698 9:93091949-93091971 TCAGGCAAAGAAAGAGGCGGAGG - Intergenic
1057286012 9:93754931-93754953 TCCAGAAAAGAAAGAACTGGAGG + Intergenic
1058592034 9:106575726-106575748 TATGGAAAATAAAGATTCGCAGG - Intergenic
1058818771 9:108709900-108709922 TCTGTAAAAGAAAGAAACGCTGG - Intergenic
1060024256 9:120157517-120157539 TCTGGAAGAGAATGACCTGGTGG + Intergenic
1060326416 9:122620540-122620562 TCCAGAAAAGAAAGATCTAGAGG + Intergenic
1060451062 9:123740685-123740707 TCTGTAAAAGAAAGATAATGAGG - Intronic
1060712376 9:125880542-125880564 TCTTGTAAAGAAAGTTCTGGAGG + Intronic
1060943966 9:127559094-127559116 TCTGGGAAACAAAGATCCACGGG + Intronic
1061428988 9:130519292-130519314 TCTGGAAATCAAAGAGCCTGGGG + Intergenic
1061602597 9:131681234-131681256 TCCGGAAAAGAAAGATCTGGAGG - Intronic
1062656811 9:137607845-137607867 GCTGGAGAAGAAAGTTCCAGTGG + Intronic
1203779929 EBV:95722-95744 TCTGGACCAGAAGGCTCCGGCGG + Intergenic
1203687242 Un_GL000214v1:6668-6690 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1203755394 Un_GL000218v1:121090-121112 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
1203714765 Un_KI270742v1:133630-133652 TCCAGAAAAGAAAGATCTGGTGG + Intergenic
1203536440 Un_KI270743v1:44461-44483 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1203649033 Un_KI270751v1:97385-97407 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
1186301197 X:8201575-8201597 ACTGGAAAAGAAAAGTCCGAGGG + Intergenic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1187116151 X:16353426-16353448 TGTGGGAAAGAAAGATGTGGTGG + Intergenic
1187362990 X:18645264-18645286 TCTGGAAAAGGAAGAGAAGGTGG - Intronic
1187418932 X:19118016-19118038 AATGGAAAAGAAACATCCTGAGG + Intronic
1189081471 X:37977467-37977489 TCTGGAAATGAATGGTCAGGGGG + Intronic
1191149721 X:57208167-57208189 TCCGGAAAAGAAAGATCTGGAGG + Intergenic
1191580812 X:62758851-62758873 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
1191833804 X:65442973-65442995 TCTGGAAAAGAAAGATTTGGGGG + Intronic
1192687689 X:73324256-73324278 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
1192884666 X:75324058-75324080 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1193048672 X:77078772-77078794 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1193314060 X:80043512-80043534 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1194536239 X:95108389-95108411 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1196471714 X:116036073-116036095 TCTGGAAAAGAAAAATCTGGAGG - Intergenic
1196659131 X:118251653-118251675 ACTGGAAAAGAAAGATGTTGGGG - Intergenic
1197461320 X:126745260-126745282 TCTGGAAAAGACAGAACCAACGG - Intergenic
1197847538 X:130819215-130819237 TCAGGAAACGAAAGATGCTGGGG + Intronic
1197881868 X:131175300-131175322 TTTTGAAGAGAAAGATCAGGAGG + Intergenic
1198453155 X:136788246-136788268 TCTTGAAATGAAAGATCCCCAGG + Intergenic
1200970794 Y:9150445-9150467 TCCAGAAAAGAAAGATATGGAGG + Intergenic
1200978463 Y:9238914-9238936 TCCAGAAAAGAAAGATCTGGAGG - Intergenic
1201169011 Y:11238699-11238721 TCCAGAAAAGAAAGATCTGGAGG + Intergenic
1201370039 Y:13253377-13253399 TCTGGAAAAGAAAGATCTGGAGG - Intronic
1201684045 Y:16681746-16681768 TCCAGAAAAGGAAGATCTGGAGG + Intergenic
1201926546 Y:19293925-19293947 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1201959107 Y:19659459-19659481 TCTGGAAAAGAATGATATGGAGG + Intergenic
1202140237 Y:21713868-21713890 TCCAGAAAAGAAAGATATGGAGG - Intergenic
1202164088 Y:21968589-21968611 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1202227268 Y:22617775-22617797 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1202315854 Y:23577879-23577901 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1202554911 Y:26092195-26092217 TCTGGAAAAGAAAGATCTGGAGG - Intergenic