ID: 1034582126

View in Genome Browser
Species Human (GRCh38)
Location 7:152053295-152053317
Sequence TAATGAATACAGATGGATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034582126_1034582129 12 Left 1034582126 7:152053295-152053317 CCGTGATCCATCTGTATTCATTA 0: 1
1: 0
2: 2
3: 20
4: 218
Right 1034582129 7:152053330-152053352 ATTCTACTTGCTTTTCTCTTTGG 0: 1
1: 0
2: 4
3: 47
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034582126 Original CRISPR TAATGAATACAGATGGATCA CGG (reversed) Intronic
900931084 1:5738124-5738146 TGATGGAGACAGATGGATAATGG + Intergenic
904596610 1:31650292-31650314 AAATGAAGACAGAAGGATAATGG + Intergenic
908865827 1:68547894-68547916 TAATGAAGAGGAATGGATCAGGG - Intergenic
909833585 1:80225227-80225249 TGATGAATCCAAAGGGATCAGGG + Intergenic
910465699 1:87496907-87496929 TAGGGAGTACAGATGGCTCAGGG - Intergenic
911794835 1:102062351-102062373 TAATGAATCCAATTTGATCATGG - Intergenic
912201412 1:107462042-107462064 TAATGAAAATAGATGGATTTGGG + Intronic
912803384 1:112736150-112736172 TGCAGAATACAGATGGATCTTGG + Intergenic
915013418 1:152711153-152711175 TAATGACTACATATGGTTGATGG + Intergenic
917788262 1:178482805-178482827 TAATGATTATGGATGGCTCACGG - Intergenic
919378802 1:196828710-196828732 TAATAAATAGAGATGGAGTAAGG + Intronic
920770348 1:208878879-208878901 GAATGACTACAGAGGGAGCATGG - Intergenic
920775352 1:208931332-208931354 TAATGAGCACAGAGGGATTAAGG + Intergenic
920970277 1:210737485-210737507 AAATGAATACAGATAGACAAGGG - Intronic
921009113 1:211123561-211123583 TGATGAAGACAGATGGAAGACGG + Intronic
921030428 1:211331204-211331226 AATTGAATACAGATGGACCTGGG - Intronic
923359705 1:233198896-233198918 TAATGAATCGAGAAGGATGAGGG + Intronic
923747753 1:236718471-236718493 TTATGAAGACAGATGGATCAGGG - Intronic
1063620835 10:7647127-7647149 AAATGATTACAAATGGATGATGG - Intronic
1067130047 10:43555774-43555796 AAATGAATACATAAGGAGCAGGG - Intergenic
1068027905 10:51671401-51671423 TAGAGATTACAGAGGGATCATGG - Intronic
1070135785 10:73692398-73692420 TAGAGAATACTAATGGATCATGG - Intronic
1071417954 10:85458603-85458625 TAATGAAGACTGATGGGTAATGG - Intergenic
1071950913 10:90701808-90701830 TAAAGAAGACAGATGGATCTTGG - Intergenic
1074235806 10:111583372-111583394 TACAGAAGACAGATGGATCTTGG - Intergenic
1074250274 10:111738291-111738313 AAATGAATGTAGATGAATCAAGG + Intergenic
1078193845 11:9117984-9118006 AAATCAATCCAGGTGGATCATGG + Intronic
1078918866 11:15808140-15808162 TAATGAAAACAAATGGAGCTGGG - Intergenic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1080063785 11:27985745-27985767 TGATGATAACAGATAGATCAGGG - Intergenic
1082681399 11:56176023-56176045 TAATGAAGTAAGGTGGATCAGGG - Intergenic
1082920161 11:58484201-58484223 TGCAGAATACAGATGGATCTTGG + Intergenic
1084109585 11:67005079-67005101 TAATGACTCAAGATGGCTCAAGG + Intergenic
1084550457 11:69838525-69838547 CACTGAATACAGATTGATTATGG + Intergenic
1084915658 11:72427082-72427104 TAATGAATACAGATGGCAGAGGG + Intronic
1085924724 11:81002809-81002831 CAATGAATGCAGTTGGTTCAAGG - Intergenic
1087998099 11:104837440-104837462 TAATGAACACTGATAGATTATGG + Intergenic
1089903503 11:122012708-122012730 TACAGAATACAGATGGATCTTGG + Intergenic
1090209610 11:124908935-124908957 TACAGAAGACAGATGGATCTTGG - Intergenic
1093049032 12:14485854-14485876 TGCAGAAGACAGATGGATCATGG - Intronic
1093049779 12:14491863-14491885 TGCAGAAGACAGATGGATCATGG - Intronic
1093786929 12:23203459-23203481 ATATGAATATAGATGGCTCAGGG - Intergenic
1093936003 12:25001460-25001482 AAATGAAAACAGATGGTTAAAGG + Intergenic
1094793682 12:33945278-33945300 GAGTGATAACAGATGGATCAGGG + Intergenic
1095819716 12:46464327-46464349 TAATGAAGACAGAATGATCTGGG - Intergenic
1096296650 12:50389799-50389821 TAAAGAATACAGATGGATTTTGG - Intronic
1097316604 12:58178001-58178023 TAATGAACACAGATGAAGTAGGG - Intergenic
1097700575 12:62816154-62816176 TAATGGATACAGAGGCAGCATGG + Intronic
1098667247 12:73179889-73179911 TAGTGAATACAGGTGGAGCCAGG - Intergenic
1098672929 12:73253343-73253365 TGAAGAAGACAGATGGATCTTGG + Intergenic
1098733200 12:74064737-74064759 TGAAGAAGACAGATGGATCTTGG + Intergenic
1099055302 12:77833057-77833079 TTATGAATAAAGTTGGATCTGGG - Intronic
1100083207 12:90877330-90877352 TACAGAAGACAGATGGATCTTGG + Intergenic
1101064461 12:101004901-101004923 CAATGAAAACAGGGGGATCATGG + Intronic
1101273791 12:103176998-103177020 TAATGAATTAAAATGGAGCAAGG - Intergenic
1101341297 12:103843743-103843765 TAAAGAATAAAAATGTATCATGG - Intronic
1101581209 12:106042515-106042537 TAATGTAGACTGAAGGATCAAGG + Intergenic
1102093345 12:110212909-110212931 TAATGATTAGAGTTGGATGATGG - Intronic
1106609168 13:31262245-31262267 TAAAGCATATAGATGGCTCATGG - Intronic
1107085920 13:36427943-36427965 TAAGGAATACAGATGTATAAAGG - Intergenic
1107164240 13:37266377-37266399 AAATGAATACAGATGGCTACAGG + Intergenic
1107980005 13:45725813-45725835 TAATGCCTACAGATGCATCCAGG + Intergenic
1108258317 13:48631744-48631766 TCAGGCATCCAGATGGATCACGG + Intergenic
1108914404 13:55589787-55589809 TGCTGAAGACAGATGGATCTTGG - Intergenic
1109111603 13:58327687-58327709 TAATAAATACCTATAGATCAAGG + Intergenic
1110476807 13:75925315-75925337 TAATGTATAAAGATTGGTCATGG + Intergenic
1110563858 13:76938146-76938168 GAATGAATAAATATGGATCCTGG - Intergenic
1110695953 13:78489261-78489283 TAATGGTTAAAGATGGATAATGG + Intergenic
1111419096 13:87986240-87986262 TAATGAAAACAGCTAGATCTTGG + Intergenic
1111440968 13:88282235-88282257 TGGAGAAGACAGATGGATCATGG + Intergenic
1111840076 13:93438944-93438966 TGATGACTGCTGATGGATCAGGG - Intronic
1112962643 13:105145587-105145609 TAATGAACACAGCTTGATCTAGG + Intergenic
1115888626 14:38002399-38002421 TATTGCATTCAGATGGATCTAGG + Intronic
1116531557 14:45979104-45979126 TGCAGAAGACAGATGGATCATGG - Intergenic
1116657279 14:47668370-47668392 TAATGAATACAACTGGACCCTGG + Intronic
1117596383 14:57330780-57330802 TACAGAAGACAGATGGATCTTGG - Intergenic
1118119041 14:62816454-62816476 AAATGAAAACATATCGATCAGGG - Intronic
1118453159 14:65922433-65922455 TAATGAAATCAGATAGATCTGGG + Intergenic
1120175722 14:81291364-81291386 TCATGAATACACTTTGATCAAGG + Intronic
1122454521 14:101839654-101839676 TTATGATTACAGATGGAGGATGG - Intronic
1122841500 14:104466385-104466407 TAAGGAACACAGATGGATCTTGG - Intergenic
1124486015 15:30117367-30117389 AAATTAATACACAGGGATCAGGG - Intergenic
1124517560 15:30379902-30379924 AAATTAATACACAGGGATCAGGG + Intronic
1124541090 15:30586353-30586375 AAATTAATACACAGGGATCAGGG - Intergenic
1124547801 15:30648139-30648161 AAATTAATACACAGGGATCAGGG - Intronic
1124757568 15:32421231-32421253 AAATTAATACACAGGGATCAGGG + Intergenic
1125007791 15:34837575-34837597 TAATAAATACAAAAGGATCAAGG + Intergenic
1126380631 15:48043165-48043187 TAGTGAATATAGAAGGAGCAGGG - Intergenic
1126646161 15:50876784-50876806 TTATGAATTCTGATGGATGAGGG + Intergenic
1128615817 15:69108619-69108641 TAATGAAAACAAATAGAGCAGGG + Intergenic
1128847550 15:70914638-70914660 TAGTGAATACAGAGGAATCTAGG + Intronic
1129979918 15:79859330-79859352 TGATGAATATAGATGTATAATGG - Intronic
1130186100 15:81684253-81684275 TAATGGATGAAAATGGATCATGG - Intergenic
1131559636 15:93428276-93428298 TGACTAATACAGATGCATCACGG + Intergenic
1135595581 16:23740168-23740190 TAATGAATACCCTTGGCTCAAGG - Intergenic
1137993922 16:53187581-53187603 TAATGAATAAAGAAGAACCAAGG + Intronic
1141800917 16:86308700-86308722 TAATCAACGCAAATGGATCATGG + Intergenic
1143936688 17:10493481-10493503 TTATTAATCCAGATGAATCATGG + Intronic
1144157387 17:12519385-12519407 TAAAGAAGACAGATGGACAAAGG - Intergenic
1146915632 17:36676655-36676677 TAAGGAATGCAGATGGAACCAGG + Intergenic
1151257832 17:72893160-72893182 GAATGAAAACATATGGACCAGGG + Intronic
1151508339 17:74543559-74543581 TGGTGAATACAGCTGGATAAGGG + Intronic
1155682566 18:28506900-28506922 TAATGAATAGAATTGTATCAAGG - Intergenic
1156572773 18:38277975-38277997 TAATGAAAACAACAGGATCAGGG - Intergenic
1158199893 18:54928434-54928456 TAATAAACACAGAAGCATCAGGG + Intronic
1159097906 18:63925705-63925727 TAATGAATACAGAAGAATGATGG + Intronic
1159655367 18:71025964-71025986 TTGTGAAAACAGATGGTTCAAGG + Intergenic
1159726227 18:71963306-71963328 TAGTGTATACAGCTAGATCAAGG + Intergenic
1159784305 18:72695818-72695840 TAATGTAAACATCTGGATCAAGG + Intergenic
1159872011 18:73768926-73768948 TAATAAATACAAATGCAGCATGG - Intergenic
1162226363 19:9225932-9225954 TAATGAATACAGATGGCTCTGGG - Intergenic
1165604501 19:37089568-37089590 GACTGAATACAGAGAGATCAGGG + Intronic
1167517520 19:49931805-49931827 TAATGAGTAAAGATGAAACAAGG + Intronic
1167781883 19:51603745-51603767 AAATAAATACAAATAGATCATGG + Intergenic
1167948570 19:53008885-53008907 TAATGCATACAGATGGTTAGAGG - Intergenic
1202644445 1_KI270706v1_random:127614-127636 CAAGTAATACAGATGGATCCAGG - Intergenic
925299672 2:2802035-2802057 TTATGACTGCTGATGGATCAGGG + Intergenic
928851050 2:35747438-35747460 TAATAAACACATATGGATCTGGG - Intergenic
928935770 2:36676415-36676437 TAATGAATAAAGATTGAAGATGG - Intergenic
930852289 2:55974038-55974060 TACAGAAGACAGATGGATCCTGG - Intergenic
933481412 2:82861726-82861748 TAATTAATACAGTTGATTCAAGG + Intergenic
935484083 2:103631289-103631311 TGATGGCTACTGATGGATCAGGG + Intergenic
936674415 2:114698526-114698548 TAATCAATACAGGAGGGTCAAGG + Intronic
937266713 2:120620855-120620877 TAAAGAAGACAGGTGGATCTTGG - Intergenic
941421550 2:165288120-165288142 AAATCAATACAAATGCATCAGGG - Intronic
941479209 2:165985055-165985077 CAGTGAATAAAGATGCATCAGGG + Intergenic
941663020 2:168215025-168215047 TGTTGAAAACACATGGATCATGG - Intronic
941743224 2:169058747-169058769 CAATGAAAACAGATGGACCCAGG + Intergenic
942987790 2:182163109-182163131 TACAGAAGACAGATGGATCCTGG + Intronic
943813865 2:192226078-192226100 TAATTAAGAAACATGGATCAAGG + Intergenic
944347118 2:198682747-198682769 TAATGTATACACATATATCATGG - Intergenic
944783325 2:203042327-203042349 TAATGAATACACATAGGACAAGG + Intronic
946469931 2:219949671-219949693 TCATCAATACTGATGGCTCATGG - Intergenic
1169792233 20:9423606-9423628 TGGGGAATGCAGATGGATCATGG + Intronic
1169864717 20:10187520-10187542 TCATGAATAAATATGGATGATGG + Intergenic
1171227100 20:23451091-23451113 GAATGAATGGAGATGGATGAGGG - Intronic
1176728351 21:10463722-10463744 TAATAAAAACAGACTGATCATGG - Intergenic
1177059619 21:16354507-16354529 AAATGAAAACAGATGGTACAGGG - Intergenic
1177791503 21:25727219-25727241 TACTGGTTACAGATGGATGATGG + Intronic
1178060864 21:28852041-28852063 TACAGAAGACAGATGGATCTTGG - Intergenic
1179707330 21:43189179-43189201 TAATGAGTACAGAAAGTTCAGGG - Intergenic
1180561509 22:16618971-16618993 TAATGAGAACACATGGACCAAGG - Intergenic
1182216779 22:28725215-28725237 TAATGAATACCCATGTATCTAGG - Intronic
1182592767 22:31394820-31394842 AAATGACTAGACATGGATCAAGG + Intergenic
1183143104 22:35962757-35962779 TAATGACTAAATATGGACCAGGG + Intronic
1183815042 22:40292719-40292741 CAAAGAATACAGAAGGACCAGGG - Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1185031749 22:48447299-48447321 TAATGAAACAATATGGATCAAGG + Intergenic
949491304 3:4592021-4592043 TACTGAAGAAACATGGATCAAGG - Intronic
952281171 3:31924647-31924669 TATTGAATTCAGTTGGATGAGGG + Intronic
952660787 3:35844271-35844293 TAAAGACTACAAATGAATCATGG + Intergenic
953312709 3:41895065-41895087 AAATTAATACACAGGGATCAGGG + Intronic
956965932 3:74460109-74460131 TAGAGAAGACACATGGATCAAGG - Intronic
958580892 3:96020774-96020796 TCATGTATACAGTTGCATCATGG + Intergenic
958993582 3:100875668-100875690 TAATTAATAAAGTTAGATCAAGG - Intronic
962695773 3:137945743-137945765 TAATTGATACAGATGGATCCTGG + Intergenic
963044932 3:141095372-141095394 GAATGAATACAAATGCATAATGG + Intronic
963355773 3:144207739-144207761 TGAGGAAAACAGATGGATCTTGG - Intergenic
965211199 3:165791367-165791389 GAATAACTACAGATGGTTCAAGG + Intronic
971610142 4:28713689-28713711 TAAAGTATACAGAGGTATCATGG + Intergenic
972438739 4:39062437-39062459 TAATGAATAAAGATGAAACACGG - Exonic
973041317 4:45473091-45473113 TGATTATTACAGATTGATCAAGG + Intergenic
973291324 4:48473794-48473816 AAATGGATACAGATGAATAAAGG - Intergenic
976034299 4:80796662-80796684 TACAGAAGACAGATGGATCTTGG - Intronic
976458198 4:85275089-85275111 TAATGGATACTGATTGATCAGGG - Intergenic
977490184 4:97700967-97700989 TGAGGAAGACAGATGGATCTTGG - Intronic
978435315 4:108677705-108677727 TGATAAATATAGTTGGATCATGG + Intergenic
980805501 4:137807749-137807771 ATATGAATACACATGGTTCAAGG + Intergenic
981268043 4:142810452-142810474 TAAATAATGCTGATGGATCAAGG - Intronic
981365546 4:143898021-143898043 TAATGAATTCATATGGATTATGG + Intronic
981375551 4:144011025-144011047 TAATGAATGCATATGGATTATGG + Intronic
981386166 4:144133212-144133234 TAATGAATGCATATGGATTGTGG + Intronic
983574679 4:169248434-169248456 TAATGAAAACACATGGATACAGG + Intronic
983731162 4:170995382-170995404 AAAAGGAAACAGATGGATCATGG - Intergenic
983963507 4:173782681-173782703 TAATGGATAAAGGTGGATTATGG - Intergenic
984061190 4:174990703-174990725 TACAGAAGACAGATGGATCTTGG - Intergenic
984078302 4:175211337-175211359 AAATGAATAAAAATGGGTCAAGG + Intergenic
984930480 4:184842777-184842799 GAAAAAAAACAGATGGATCATGG + Intergenic
987289456 5:16494868-16494890 AAAAGAAGACAGATGGATGAAGG + Intronic
987369061 5:17176508-17176530 TCGTGAATTCAGAAGGATCAGGG + Intronic
987753118 5:22066826-22066848 TAACTAACACAGATGGATCTTGG + Intronic
987787962 5:22526641-22526663 TGCTGAAGACAGATGGATCTTGG - Intronic
988178758 5:27762690-27762712 TAATGACTACAGAAACATCATGG + Intergenic
988308763 5:29529611-29529633 AAATGGATCAAGATGGATCATGG + Intergenic
989284376 5:39682445-39682467 TAATGAATACCCTTGGCTCAAGG + Intergenic
993012306 5:82496925-82496947 TAAAGAATTCACATGGATAAAGG + Intergenic
996039059 5:118790322-118790344 TAAGTAATACTGATGGATCAAGG + Intergenic
997020775 5:129999063-129999085 AAATAATTCCAGATGGATCAGGG - Intronic
998290444 5:140909447-140909469 TGAAGAAGACAGATGGATCTTGG - Intronic
1000403696 5:160862739-160862761 TAAAGAATAAAGATTGATAAAGG - Intergenic
1000811700 5:165871024-165871046 AAATGAATACAAATGGGTGATGG - Intergenic
1007863945 6:44946993-44947015 TAATGGCTACTGATTGATCAGGG - Intronic
1008245265 6:49163424-49163446 TAATAACTCCAGATGGATCAAGG + Intergenic
1009558054 6:65200644-65200666 TAATGAAGAAATATGGGTCATGG - Intronic
1010010085 6:71038980-71039002 TATTCAATACGGATGAATCATGG + Intergenic
1011372736 6:86655735-86655757 AAATTAATACAAATAGATCATGG + Intergenic
1012087563 6:94850027-94850049 TAATGAATACTGATATATTATGG + Intergenic
1013121421 6:107144578-107144600 AAAAGAAAAAAGATGGATCATGG + Intergenic
1013638807 6:112053677-112053699 GAAAAAATACAGATGGAGCAGGG - Intergenic
1018549738 6:164981964-164981986 TGATGAAAACAGGTGGATCCTGG + Intergenic
1024785388 7:52901573-52901595 TCATGAATCCACAGGGATCAAGG + Intergenic
1028498817 7:91494592-91494614 TAATGACTACTAATGGATAATGG - Intergenic
1028951421 7:96640114-96640136 TAATGAATACAAATGCAAAATGG + Intronic
1033015831 7:137670634-137670656 TAATGAATCAAGATGACTCATGG - Intronic
1033460116 7:141539276-141539298 TAATTTAAACAGATGGCTCAGGG + Intergenic
1034143150 7:148842543-148842565 TAATCAATACATATAGGTCAAGG - Intronic
1034582126 7:152053295-152053317 TAATGAATACAGATGGATCACGG - Intronic
1034601745 7:152264248-152264270 TAATAAAAACAGACTGATCATGG + Intronic
1037228285 8:16622268-16622290 TACTTAAGACAGATGGATCCTGG - Intergenic
1039155402 8:34550373-34550395 AACTTAATACAGATGAATCATGG - Intergenic
1039594363 8:38777975-38777997 TGATGGATACAGATGGATACAGG + Intronic
1040571003 8:48610026-48610048 TCATGCATACAGAGGGATAAAGG + Intergenic
1041159534 8:55025339-55025361 TAATGGAGACAGATGGATCGAGG + Intergenic
1041379767 8:57242532-57242554 TAAATAATACAGTTGGATCATGG - Intergenic
1043999540 8:86862719-86862741 TAATCAATACAGATGGAGTAAGG - Intergenic
1047460267 8:125057154-125057176 TAATAAATTCTGATGGAGCATGG - Intronic
1050195590 9:3079910-3079932 TAATGAAAACAAAAGGCTCAAGG + Intergenic
1050308664 9:4331031-4331053 AAACAAATACAGATGGCTCAGGG - Intronic
1052130294 9:24837228-24837250 TAATGAATAGAAATTGAACAAGG - Intergenic
1052783151 9:32801792-32801814 TAAGGAAAATAGATGAATCAGGG + Intergenic
1054285007 9:63160061-63160083 CAATGAATAGGGATGGATCCAGG + Intergenic
1054389812 9:64604962-64604984 CAATGAATAGGGATGGATCCAGG - Intergenic
1054974823 9:71130317-71130339 TCATGAATAATGATAGATCATGG - Intronic
1056709723 9:88981229-88981251 TAAAGAAGACACATGGATAAAGG - Intergenic
1058469314 9:105260942-105260964 TATTGAATACATATGGAACAGGG + Intronic
1060115988 9:120941259-120941281 TAATGAATGCAGAGGAGTCAAGG - Intergenic
1060130723 9:121095885-121095907 TAATGAATTCTGATTGATGAAGG - Intronic
1060285960 9:122252744-122252766 TAAAGAATACAGATGGTCAAGGG + Intronic
1062241139 9:135539524-135539546 TAATGAGCTCAGCTGGATCATGG - Intergenic
1186573619 X:10742114-10742136 TAATGAATACAGAAGGCATAAGG - Intronic
1188108638 X:26171515-26171537 TAATAAATATAGACAGATCAAGG + Intergenic
1188306754 X:28568599-28568621 CAGTGAAGACAGATGAATCAGGG - Intergenic
1189052094 X:37656477-37656499 TAATTATTACAGATAGATAAAGG - Intronic
1193471820 X:81914063-81914085 TAATGAATGCAGATGCATGTAGG - Intergenic
1193741842 X:85226391-85226413 TAAGGAAGACAGAAGGATAATGG - Intergenic
1193832836 X:86309207-86309229 TACAGAAGACAGATGGATCTTGG + Intronic
1193938749 X:87654340-87654362 TAATGCATACACATGGATATAGG - Intronic
1196055594 X:111351708-111351730 TAGTAAATACAGAAGGCTCAAGG + Intronic
1196436808 X:115682082-115682104 TAATGAATACAATTAAATCAGGG - Intergenic
1196618926 X:117799559-117799581 TAATGAATACACATGGAAACAGG + Intergenic
1201291485 Y:12424772-12424794 TAATGACGATAGATGGATGATGG + Intergenic