ID: 1034582699

View in Genome Browser
Species Human (GRCh38)
Location 7:152059396-152059418
Sequence CTGGCTATAAATGTTCTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034582692_1034582699 20 Left 1034582692 7:152059353-152059375 CCACCTCCAAAAGAGTTGGGATT 0: 1
1: 10
2: 383
3: 4619
4: 4658
Right 1034582699 7:152059396-152059418 CTGGCTATAAATGTTCTTAATGG No data
1034582693_1034582699 17 Left 1034582693 7:152059356-152059378 CCTCCAAAAGAGTTGGGATTACA 0: 5
1: 441
2: 27853
3: 342109
4: 343243
Right 1034582699 7:152059396-152059418 CTGGCTATAAATGTTCTTAATGG No data
1034582687_1034582699 27 Left 1034582687 7:152059346-152059368 CCCACCTCCACCTCCAAAAGAGT 0: 1
1: 0
2: 49
3: 1038
4: 14494
Right 1034582699 7:152059396-152059418 CTGGCTATAAATGTTCTTAATGG No data
1034582688_1034582699 26 Left 1034582688 7:152059347-152059369 CCACCTCCACCTCCAAAAGAGTT 0: 1
1: 1
2: 92
3: 1682
4: 21958
Right 1034582699 7:152059396-152059418 CTGGCTATAAATGTTCTTAATGG No data
1034582686_1034582699 30 Left 1034582686 7:152059343-152059365 CCTCCCACCTCCACCTCCAAAAG 0: 2
1: 287
2: 3603
3: 62850
4: 151191
Right 1034582699 7:152059396-152059418 CTGGCTATAAATGTTCTTAATGG No data
1034582695_1034582699 14 Left 1034582695 7:152059359-152059381 CCAAAAGAGTTGGGATTACAGGC 0: 106
1: 18516
2: 250441
3: 327167
4: 354091
Right 1034582699 7:152059396-152059418 CTGGCTATAAATGTTCTTAATGG No data
1034582690_1034582699 23 Left 1034582690 7:152059350-152059372 CCTCCACCTCCAAAAGAGTTGGG 0: 1
1: 1
2: 131
3: 2422
4: 31111
Right 1034582699 7:152059396-152059418 CTGGCTATAAATGTTCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034582699 Original CRISPR CTGGCTATAAATGTTCTTAA TGG Intronic
No off target data available for this crispr