ID: 1034584412

View in Genome Browser
Species Human (GRCh38)
Location 7:152076513-152076535
Sequence CTGACATACGTATGCTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034584412_1034584423 24 Left 1034584412 7:152076513-152076535 CCAGTGTAGCATACGTATGTCAG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1034584423 7:152076560-152076582 TTGGAGGGAGGCTGGATTTAAGG 0: 1
1: 1
2: 1
3: 19
4: 281
1034584412_1034584417 5 Left 1034584412 7:152076513-152076535 CCAGTGTAGCATACGTATGTCAG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1034584417 7:152076541-152076563 TGATTTTTCCACTGGGGGTTTGG 0: 1
1: 0
2: 1
3: 27
4: 230
1034584412_1034584413 -3 Left 1034584412 7:152076513-152076535 CCAGTGTAGCATACGTATGTCAG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1034584413 7:152076533-152076555 CAGAGTTGTGATTTTTCCACTGG No data
1034584412_1034584419 9 Left 1034584412 7:152076513-152076535 CCAGTGTAGCATACGTATGTCAG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1034584419 7:152076545-152076567 TTTTCCACTGGGGGTTTGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 238
1034584412_1034584422 16 Left 1034584412 7:152076513-152076535 CCAGTGTAGCATACGTATGTCAG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG No data
1034584412_1034584420 12 Left 1034584412 7:152076513-152076535 CCAGTGTAGCATACGTATGTCAG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1034584420 7:152076548-152076570 TCCACTGGGGGTTTGGAGGGAGG 0: 1
1: 0
2: 2
3: 20
4: 283
1034584412_1034584415 -1 Left 1034584412 7:152076513-152076535 CCAGTGTAGCATACGTATGTCAG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1034584415 7:152076535-152076557 GAGTTGTGATTTTTCCACTGGGG No data
1034584412_1034584416 0 Left 1034584412 7:152076513-152076535 CCAGTGTAGCATACGTATGTCAG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1034584416 7:152076536-152076558 AGTTGTGATTTTTCCACTGGGGG No data
1034584412_1034584418 8 Left 1034584412 7:152076513-152076535 CCAGTGTAGCATACGTATGTCAG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1034584418 7:152076544-152076566 TTTTTCCACTGGGGGTTTGGAGG No data
1034584412_1034584414 -2 Left 1034584412 7:152076513-152076535 CCAGTGTAGCATACGTATGTCAG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1034584414 7:152076534-152076556 AGAGTTGTGATTTTTCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034584412 Original CRISPR CTGACATACGTATGCTACAC TGG (reversed) Intronic
903523986 1:23978956-23978978 CAGACATATGTATGGTACAAGGG + Intronic
909470042 1:76017350-76017372 CTGAATTACGTATTCTAAACTGG - Intergenic
917386699 1:174484178-174484200 ATGACATACGAATGACACACAGG - Intronic
924493864 1:244567822-244567844 CTGACATAAGTAGGCTTCAGAGG - Intronic
1079226805 11:18613984-18614006 CTTACATATGTATGCTGCAATGG - Intronic
1085796021 11:79540713-79540735 CTGACATACCTTTCCCACACAGG - Intergenic
1086194471 11:84120775-84120797 CTAACATAGTCATGCTACACAGG + Intronic
1091326998 11:134699001-134699023 ATGACATACCTTTGCTTCACGGG + Intergenic
1092576482 12:9789317-9789339 TTGACATAGATATGCTACAAAGG - Intergenic
1100905733 12:99296496-99296518 CTGAAATACGAATGATACAAAGG - Intronic
1102622189 12:114204885-114204907 CTGACATATGTGTTCTACACTGG + Intergenic
1120477522 14:85007114-85007136 CTGAGATACGTGAGGTACACAGG - Intergenic
1164587347 19:29484300-29484322 CTGACATGCGCATGCTGCAAAGG - Intergenic
934931824 2:98432483-98432505 CTGACATTTGGATGCTACAGAGG + Intergenic
938655425 2:133426756-133426778 CTTACATTAGTATGGTACACTGG - Intronic
945489438 2:210437804-210437826 CTGGCAGACGTAGTCTACACTGG + Exonic
947918438 2:233849544-233849566 CTGACATATGAATGGTACTCAGG - Intronic
951400358 3:22225547-22225569 CTGAAGTATGTATTCTACACTGG + Intronic
951594997 3:24308948-24308970 CTGCCATACCCATGCTACTCAGG + Intronic
953276439 3:41504261-41504283 CTGACATACTTTTACCACACAGG + Intronic
959827638 3:110818265-110818287 AAGACATACGTATGGCACACAGG - Intergenic
962811385 3:138961805-138961827 CTGACACACCTCTCCTACACTGG - Intergenic
975856294 4:78628366-78628388 GTGACATACGTCAGCTACTCAGG + Intergenic
978062480 4:104354581-104354603 CTGATATAAGTATGCTACTGTGG - Intergenic
984134995 4:175924869-175924891 CTGAAATACTTGTGCTACAGTGG + Intronic
1007977306 6:46114573-46114595 CTGAAACACACATGCTACACAGG - Intergenic
1013054875 6:106573914-106573936 ATGACAGATGTGTGCTACACGGG + Intronic
1013832263 6:114288052-114288074 CTGACTTTCTTAAGCTACACAGG - Intronic
1014482167 6:121952242-121952264 ATGAGATAGGTATGCAACACAGG + Intergenic
1015491642 6:133833361-133833383 CCCATATACGTATACTACACTGG - Intergenic
1026359787 7:69592192-69592214 CTGACATCAGTATTATACACAGG + Intergenic
1027997527 7:85444298-85444320 ATGACAGAGGTATGCTAAACTGG + Intergenic
1031205058 7:118746008-118746030 CTGACATATTTTTGCTTCACAGG - Intergenic
1034584412 7:152076513-152076535 CTGACATACGTATGCTACACTGG - Intronic
1052251060 9:26397911-26397933 CTTACATACTGGTGCTACACAGG + Intergenic