ID: 1034584422

View in Genome Browser
Species Human (GRCh38)
Location 7:152076552-152076574
Sequence CTGGGGGTTTGGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034584412_1034584422 16 Left 1034584412 7:152076513-152076535 CCAGTGTAGCATACGTATGTCAG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034584422 Original CRISPR CTGGGGGTTTGGAGGGAGGC TGG Intronic
No off target data available for this crispr