ID: 1034584516

View in Genome Browser
Species Human (GRCh38)
Location 7:152077338-152077360
Sequence CAAAAGCGGCCCTGGGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034584516_1034584524 7 Left 1034584516 7:152077338-152077360 CCTCTGACCCAGGGCCGCTTTTG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1034584524 7:152077368-152077390 ATTTGCTGTTCTGGAAGAGCAGG 0: 1
1: 0
2: 0
3: 19
4: 185
1034584516_1034584525 14 Left 1034584516 7:152077338-152077360 CCTCTGACCCAGGGCCGCTTTTG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1034584525 7:152077375-152077397 GTTCTGGAAGAGCAGGTGAGAGG No data
1034584516_1034584521 -2 Left 1034584516 7:152077338-152077360 CCTCTGACCCAGGGCCGCTTTTG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1034584521 7:152077359-152077381 TGCCCGGCTATTTGCTGTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034584516 Original CRISPR CAAAAGCGGCCCTGGGTCAG AGG (reversed) Intronic
900225921 1:1533633-1533655 CGGAAGCTGCCCTGGGTCGGCGG + Intronic
900267200 1:1763833-1763855 TGACAGCAGCCCTGGGTCAGAGG - Intronic
900479707 1:2892055-2892077 CACCAGCTGCCCTGGCTCAGAGG + Intergenic
900705117 1:4075751-4075773 ATAAAGCTGCCCTGGGTGAGAGG + Intergenic
903662188 1:24984916-24984938 CAAAGCAGGCCCTGGGCCAGGGG + Intergenic
905522097 1:38608254-38608276 GGAAAGCGGACCTGGGGCAGAGG + Intergenic
906235169 1:44202371-44202393 CAAAAGCAGCTCTGGGTCTTAGG + Intergenic
907301012 1:53486284-53486306 CAAATGCAGCCCTGGTGCAGGGG + Intergenic
908124138 1:61013471-61013493 CCAAAGTGACCCTGGCTCAGAGG + Intronic
911392097 1:97258297-97258319 CAGGAGAGGCCCTGGGACAGGGG - Intronic
912948180 1:114102040-114102062 CAAAAGCTGCTCTGAATCAGAGG - Intronic
913971680 1:143421887-143421909 GAAAGGCGCCCCTCGGTCAGCGG + Intergenic
914066057 1:144247500-144247522 GAAAGGCGCCCCTCGGTCAGCGG + Intergenic
914113094 1:144718854-144718876 GAAAGGCGCCCCTCGGTCAGCGG - Intergenic
915520144 1:156437097-156437119 CAGAAGCGGCCCTGGATCCGGGG - Intergenic
916544262 1:165787062-165787084 CAAAAGTGGCAATTGGTCAGAGG - Intronic
920200546 1:204257433-204257455 CAAAACGGGCACTGGGTGAGCGG + Exonic
920941711 1:210489574-210489596 CAAAAGAGGCCCTGGTCAAGGGG - Intronic
923654170 1:235901003-235901025 CAGGATCTGCCCTGGGTCAGTGG + Intergenic
1063161048 10:3419092-3419114 CAAAACCAGCCCTGCCTCAGTGG - Intergenic
1064406627 10:15069882-15069904 CAAAAGAGGCTGTGAGTCAGTGG + Intronic
1068909234 10:62360417-62360439 CATAAGCGTCCCTGGTTCTGAGG + Intergenic
1069581328 10:69569023-69569045 CAAAAGCGTCCCGGGGCCATTGG - Intergenic
1071121585 10:82285240-82285262 TAAAAGAGCACCTGGGTCAGGGG + Intronic
1075768285 10:124912273-124912295 CAAGAGAGGAACTGGGTCAGAGG - Intergenic
1076763164 10:132615769-132615791 CAGAGTGGGCCCTGGGTCAGTGG + Intronic
1077359991 11:2136595-2136617 CAAAAACTCCCCTGGGTCTGCGG - Intronic
1077435770 11:2538464-2538486 CAACCGCGGTCCTGGGACAGGGG - Intronic
1079002203 11:16767393-16767415 CAAAAGGGGCCCTGAGCTAGAGG + Intergenic
1081049192 11:38316109-38316131 CTAGACCTGCCCTGGGTCAGAGG + Intergenic
1083720091 11:64599664-64599686 CAAAGGCGAACCTGGGGCAGGGG - Exonic
1088821368 11:113460458-113460480 CAAAAGCTTCCTGGGGTCAGAGG + Intronic
1088927396 11:114316172-114316194 AAAAACCGGAGCTGGGTCAGCGG - Intergenic
1090310526 11:125732736-125732758 CAAAAGAGGAAATGGGTCAGAGG + Intergenic
1091239114 11:134040643-134040665 CAAAAGCGGCAATGGGAGAGGGG - Intergenic
1092252769 12:6910061-6910083 CAAAAGCTGCACCTGGTCAGGGG - Intronic
1095446552 12:42288160-42288182 CAAGATCGCCCCTGCGTCAGCGG + Intronic
1095986370 12:48002227-48002249 CGAAAGTGCCCCTGGCTCAGGGG - Intronic
1100408514 12:94291900-94291922 CAAAAGCGGGGATGGGTCTGGGG - Intronic
1102016044 12:109648642-109648664 CAGATGTGGCCCAGGGTCAGAGG + Intergenic
1102390334 12:112544460-112544482 CGAAATTTGCCCTGGGTCAGTGG + Intergenic
1102583594 12:113907959-113907981 CCAGAGAGGCCCTAGGTCAGGGG - Intronic
1104493189 12:129212473-129212495 CAAAAGAGACCCTTGTTCAGTGG + Intronic
1104994177 12:132643666-132643688 CAAAAGTGGCCTTTGGGCAGTGG - Intronic
1107287768 13:38814973-38814995 CAAAACCTTCCCTGGGCCAGAGG - Intronic
1110376750 13:74802808-74802830 CTAGACCTGCCCTGGGTCAGAGG + Intergenic
1113156785 13:107332475-107332497 TGGAGGCGGCCCTGGGTCAGTGG + Intronic
1113586491 13:111469552-111469574 CAGCAGCAGCCCTGGCTCAGAGG - Intergenic
1118921415 14:70152944-70152966 CAAAGGCAGCCCAGGCTCAGAGG + Intronic
1119395964 14:74326659-74326681 CAAAAGGCGCCCTGAGTCTGGGG + Intronic
1120869972 14:89328412-89328434 CAACAGCAGCCCTGGGTGAATGG + Intronic
1120869987 14:89328488-89328510 CAACAGCAGCCCTGGGTGAATGG + Intronic
1122775365 14:104114563-104114585 CCAGAGGGGCCCTGGGTAAGGGG + Exonic
1122807699 14:104268868-104268890 CAGACGCGGCCCTGAGGCAGGGG - Intergenic
1122900497 14:104780374-104780396 CAGAAACGGCCCTGGGTCAACGG + Intronic
1122976352 14:105172447-105172469 CCAAAGCTGCCCTGTGTCGGGGG - Intergenic
1202851613 14_GL000225v1_random:23649-23671 CAAAAGCGGACCGCCGTCAGCGG + Intergenic
1127190185 15:56521763-56521785 CAAAAAAAGCCCTGGGCCAGAGG + Intergenic
1128565418 15:68697835-68697857 CACAAGAGGCCTGGGGTCAGTGG + Intronic
1129321992 15:74780625-74780647 CTAAGGGTGCCCTGGGTCAGAGG + Intergenic
1129525756 15:76213093-76213115 CAAAAGCTGTGGTGGGTCAGTGG + Intronic
1130884278 15:88080593-88080615 CAAAAGCCACCCTGGGCCTGAGG + Intronic
1133324905 16:4936654-4936676 CAAGAGCGACCCTGGGACACGGG + Intronic
1135137367 16:19895083-19895105 CATAAGGGCCCCTGGGACAGGGG + Intergenic
1139903093 16:70343433-70343455 CAGAAGTGGGCCTGGCTCAGTGG + Intronic
1142004006 16:87680454-87680476 CACAAGCCGCTCTGAGTCAGAGG - Intronic
1142420012 16:89964316-89964338 GAAGAGCGGCCCTCGGGCAGAGG - Intronic
1143576915 17:7799075-7799097 CAGAAGCCACCCAGGGTCAGAGG - Intronic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1146261895 17:31427454-31427476 CAAAAGCCTACCTGGGACAGAGG - Intronic
1147169450 17:38609453-38609475 CAGAAGCAGGCCTGGGGCAGCGG - Intergenic
1148091115 17:45022966-45022988 CACAAGCGGCTCTGGGAAAGGGG + Intergenic
1155283984 18:24270552-24270574 CAAAAGTAGCACTGGGACAGAGG + Intronic
1155674582 18:28414566-28414588 CAAAAGCAAACCTGGGACAGAGG - Intergenic
1157649548 18:49313829-49313851 CAAAGTTAGCCCTGGGTCAGGGG - Intronic
1164270304 19:23666813-23666835 AAAAAGTGGCCCTGGGTTGGGGG - Intronic
1165983461 19:39746736-39746758 CAAAAACAGCCCTGAATCAGGGG + Intergenic
926204946 2:10829226-10829248 CAAAAGAGACCCTGGGAGAGAGG - Intronic
927506161 2:23616107-23616129 CAGAAGCAGACCTGGCTCAGTGG - Intronic
928889998 2:36193604-36193626 CAACAGCAGCCCTGGGACAAGGG + Intergenic
932370785 2:71185722-71185744 CAAATGCAGCCCTGGGTCTTTGG - Exonic
933749690 2:85595361-85595383 CAAAGGCGGCGCTGGCCCAGGGG - Intergenic
933920458 2:87040357-87040379 CAAAAGGGGGCCTGGATAAGGGG - Intergenic
933931166 2:87153429-87153451 CAAAAGGGGGCCTGGATAAGGGG + Intergenic
934002539 2:87729541-87729563 CAAAAGGGGGCCTGGATAAGGGG + Intergenic
935333246 2:101992957-101992979 CAAAAGAGGGGCTGGATCAGGGG + Intronic
935437843 2:103056005-103056027 CTAGATCTGCCCTGGGTCAGAGG - Intergenic
936361957 2:111812003-111812025 CAAAAGGGGGCCTGGATAAGGGG - Intronic
936436919 2:112516324-112516346 GACAAGTGGCCCTGGGTCAATGG - Intronic
937194049 2:120134068-120134090 CAAAAGAATCCTTGGGTCAGTGG + Intronic
938998232 2:136703372-136703394 GAACAGAGGCCCTGGGGCAGAGG - Intergenic
939126447 2:138183291-138183313 AAAAAGCTACCCTGGCTCAGAGG + Intergenic
940414923 2:153408527-153408549 CAAAAGGGACCCTGGCTCACTGG + Intergenic
943778780 2:191797869-191797891 CCAAAGCGGCCTTGGTGCAGCGG - Intergenic
947766783 2:232642984-232643006 CAAGGGTGGCCCTGGGGCAGTGG + Intronic
948946872 2:241224879-241224901 CAAGAGGGGCCCTGGGCCAGGGG - Exonic
1168945133 20:1748114-1748136 CAAATGCCTCCCTGGGGCAGAGG + Intergenic
1169269219 20:4186633-4186655 GAAAAGAGGCCCAGTGTCAGGGG - Intronic
1169351494 20:4871679-4871701 CAGAGGCGGCCCTTGGTCAGGGG + Intronic
1171726129 20:28622578-28622600 CACAGGCAGCCCTGGGTCAAAGG - Intergenic
1172551966 20:35808038-35808060 CAAAAGCGGCCATGTGTAATGGG + Intronic
1174510451 20:51047546-51047568 CATAAGAAGCCCTGGGTCTGGGG - Intergenic
1176046780 20:63097002-63097024 CAACAGGGGCCCTGGGCCTGGGG - Intergenic
1177049178 21:16210036-16210058 CACAAGTTGCCCTGTGTCAGAGG - Intergenic
1178755462 21:35345392-35345414 CCCAAGCGGCCCTGGTTCATGGG - Intronic
1179804223 21:43826812-43826834 CAAATGCAGCCCTGTGCCAGGGG - Intergenic
1180211489 21:46297602-46297624 CCGAAGAGGCCCCGGGTCAGGGG - Exonic
1182079454 22:27518696-27518718 CAAAAGCAGCCCTGGAGTAGGGG - Intergenic
1183526365 22:38325636-38325658 CAGAAGCAGCCCTGAGTAAGAGG + Intronic
1183950097 22:41347943-41347965 CAAGCCCTGCCCTGGGTCAGAGG - Intronic
1185192392 22:49446997-49447019 CAACAAGGGCCCTGAGTCAGGGG + Intronic
1185286336 22:50001440-50001462 CAGGAGTGGGCCTGGGTCAGGGG + Intronic
952960793 3:38587984-38588006 GGACAGAGGCCCTGGGTCAGGGG - Intronic
953392408 3:42541123-42541145 TAAAATAGGCCCTGGGTGAGTGG - Intergenic
954991172 3:54841893-54841915 CCAAAGGGGCCCTGGACCAGAGG - Intronic
955293868 3:57717698-57717720 CAGAAGGTGCCCTGAGTCAGTGG - Intergenic
962143980 3:132820781-132820803 AAAAAGATGACCTGGGTCAGAGG + Intergenic
962465540 3:135654804-135654826 CTAAAGCTGTCCTGGGCCAGAGG + Intergenic
964397757 3:156265429-156265451 CCAAAGAGGCCCTGATTCAGTGG + Intronic
968684563 4:1948813-1948835 ACAAAGCAGTCCTGGGTCAGAGG - Intronic
969651183 4:8469259-8469281 CGAGAGTGGCCCTGGCTCAGTGG + Intronic
980442301 4:132865188-132865210 CAAAAGCTGGCCTGGCGCAGTGG - Intergenic
994264650 5:97700401-97700423 CTGAACCTGCCCTGGGTCAGAGG + Intergenic
997400994 5:133602234-133602256 CAAAAGCTACCCTGGAGCAGGGG + Intronic
997823271 5:137084799-137084821 TAAAGGCAGCCCTGGGTCAGTGG - Intronic
1001021187 5:168183709-168183731 CAAAAACGACCCTGAGTCACGGG + Intronic
1001668626 5:173454894-173454916 CACAAGAGGCCTTGAGTCAGAGG + Intergenic
1003458097 6:6302599-6302621 CAGAAGTAGCCCTGGGTGAGTGG + Intronic
1007832682 6:44650845-44650867 CAAAAGCACCCCTGGCTGAGAGG - Intergenic
1008089817 6:47282450-47282472 CCAAAGCTGTCCTGGGTCATGGG + Intronic
1008530163 6:52449445-52449467 CAAAAAAGGCCCAGGGCCAGAGG - Intronic
1010221393 6:73451872-73451894 CACCAGCGCCCCTGGGGCAGAGG - Exonic
1017457478 6:154614892-154614914 GAAACGTGGCCCTCGGTCAGGGG - Intergenic
1019314707 7:379139-379161 CAGAGGCGGCCTTGGGACAGGGG - Intergenic
1019521497 7:1462501-1462523 TAAAAGTGGCTCTGGGCCAGGGG + Intergenic
1019641806 7:2107294-2107316 CCACAGCAGCCCTGGGGCAGAGG + Intronic
1024942287 7:54775440-54775462 CAAAAGCAGCCCTAGGAGAGAGG - Intergenic
1027211236 7:76150428-76150450 CAAAAGGGGCCCTGAGCCAGCGG + Intergenic
1029662612 7:101972905-101972927 AAAACTCTGCCCTGGGTCAGTGG - Intronic
1031442580 7:121812221-121812243 CTAGACCTGCCCTGGGTCAGAGG + Intergenic
1032087536 7:128891688-128891710 CACAGGGGGCCCTGGGGCAGGGG + Exonic
1033166239 7:139040896-139040918 CAAAAGCAGGCTGGGGTCAGAGG + Intergenic
1033727355 7:144132954-144132976 CAAAAGCAGCCCTGGGGCAATGG + Intergenic
1034584516 7:152077338-152077360 CAAAAGCGGCCCTGGGTCAGAGG - Intronic
1035693740 8:1577708-1577730 CAAGAGCAGCCCGGGGCCAGGGG + Intronic
1047504613 8:125469304-125469326 CAGGAGCTGCACTGGGTCAGTGG - Intergenic
1049612709 8:143562827-143562849 CACATGCGGCCCTGGGCCTGCGG - Exonic
1049707715 8:144050607-144050629 CAAAAGCAGCCCTGGGCCCTGGG + Intergenic
1055481549 9:76713223-76713245 CCAAACCGGTCCTGGGACAGGGG + Intronic
1056694968 9:88840131-88840153 CAAAAGCAGTCCTGTGTCTGGGG + Intergenic
1056984375 9:91347502-91347524 AAAAAGCAGCCATGGGTTAGAGG - Intronic
1057150828 9:92794422-92794444 CCAAAGTGGCCGTGGGGCAGTGG + Intergenic
1060396151 9:123318412-123318434 AAACAGCAGGCCTGGGTCAGCGG + Intergenic
1060418522 9:123450326-123450348 TACAACCGGCCCTGGGGCAGAGG + Intronic
1061597667 9:131642626-131642648 CAAAAGCGGCGCTGGTCCATAGG + Intronic
1061941945 9:133888506-133888528 CACCACCGGCCCTGGGTCATGGG + Intronic
1186537270 X:10363229-10363251 CACCAGCGGCCCATGGTCAGAGG - Intergenic
1195160987 X:102171152-102171174 CAAAAGAAGCCCGGGATCAGAGG - Intergenic
1196856806 X:119991826-119991848 CAAGAGCGGCCCTGAGCCAGTGG - Intergenic
1199135403 X:144244179-144244201 CTAGACCTGCCCTGGGTCAGAGG + Intergenic
1201368654 Y:13236132-13236154 CAAAAGGGGCTGTGGGTGAGAGG + Intergenic