ID: 1034585441

View in Genome Browser
Species Human (GRCh38)
Location 7:152087526-152087548
Sequence CTTTGTAGGGAGCAGATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 306}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034585435_1034585441 2 Left 1034585435 7:152087501-152087523 CCAGATTACGTAGGGACTTGCAG 0: 1
1: 0
2: 0
3: 13
4: 118
Right 1034585441 7:152087526-152087548 CTTTGTAGGGAGCAGATGGGTGG 0: 1
1: 0
2: 1
3: 28
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034585441 Original CRISPR CTTTGTAGGGAGCAGATGGG TGG Intronic
900383037 1:2394779-2394801 CTGCCGAGGGAGCAGATGGGGGG + Intronic
900742168 1:4337297-4337319 CTTGGGAGAGAGCAGATGTGGGG + Intergenic
900775856 1:4585113-4585135 CATTTTAGGGAGAAGAAGGGGGG + Intergenic
900783372 1:4632147-4632169 CTTTGTAAGAGGCAGACGGGAGG - Intergenic
901253106 1:7796667-7796689 CTTTGGAGGGGGAAGAAGGGAGG + Intronic
901445994 1:9308402-9308424 GTTTCTAGAAAGCAGATGGGTGG + Intronic
902270532 1:15301182-15301204 CTGGGTAGAGATCAGATGGGAGG - Intronic
902776703 1:18679414-18679436 CTTTGTGGGGCGCGGATGGGTGG + Intronic
903562802 1:24241282-24241304 CATTGGAGGGAGCCGGTGGGGGG - Intergenic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904417145 1:30370120-30370142 CTTTGTGGGGTTCAGGTGGGAGG + Intergenic
904749525 1:32732833-32732855 CTTTGTGGGGCGGAGGTGGGTGG - Intergenic
907101498 1:51841548-51841570 CTTTGTGGGGCCAAGATGGGTGG - Intronic
907707575 1:56845981-56846003 CTTTGAAGGAAGCAGAAGGAAGG - Intergenic
907874969 1:58476894-58476916 CTTTGGAGTCAGAAGATGGGAGG + Intronic
908229235 1:62087362-62087384 CTTTGTAGGCATAGGATGGGGGG + Intronic
908670416 1:66540940-66540962 CCTTGGAGGGAGTAGATGTGAGG - Intronic
908687490 1:66738390-66738412 CATTGCAGGGATCAGATGAGTGG - Intronic
911717777 1:101154251-101154273 CTTTGCAGGCAGCACATTGGAGG + Intergenic
913451755 1:118997554-118997576 CTTTGCTGGGGGCAGGTGGGAGG - Intergenic
913520570 1:119641652-119641674 CATGGAAGGGACCAGATGGGAGG + Intronic
914376399 1:147077352-147077374 CATCGTAGGGGGCAGGTGGGAGG - Intergenic
915114795 1:153590472-153590494 CTTTGGAGGGCCAAGATGGGTGG + Intergenic
915499831 1:156307925-156307947 CTTTGCAAGGATGAGATGGGTGG + Intergenic
917136577 1:171793976-171793998 GGTAGTAGGGGGCAGATGGGAGG - Intronic
920104069 1:203538115-203538137 AACTGTAGAGAGCAGATGGGTGG + Intergenic
921682532 1:218051364-218051386 CTTTGTGGGGTGGAGGTGGGAGG - Intergenic
922466087 1:225846198-225846220 CCTTGGAGGGAGCAGACGGAGGG + Exonic
922540435 1:226414838-226414860 CTTTGTAGTGACAAGATGGTGGG - Intergenic
923719161 1:236452381-236452403 CTTAGGAGGGAGCTGGTGGGAGG + Intronic
1063918016 10:10904011-10904033 CTCTGTAGAGAGAAGATGGCAGG - Intergenic
1064453898 10:15469047-15469069 CTTTGCAGGAGGCAGATGGAGGG - Intergenic
1065323767 10:24532736-24532758 CATTGGAGGGATCAGGTGGGAGG - Intronic
1065438881 10:25728833-25728855 CTTTGTGGGGCCAAGATGGGTGG - Intergenic
1065910190 10:30296510-30296532 CTTGGTAGGGAGAAGGTTGGGGG - Intergenic
1066981504 10:42420395-42420417 CTTTGTAAGGAGCACATGTGTGG - Intergenic
1067659555 10:48224201-48224223 CTGTGAAGAGAGCAGAGGGGTGG - Intronic
1068736728 10:60421639-60421661 CTTTTTAGGGTGAGGATGGGAGG - Intronic
1069011697 10:63381260-63381282 CTTTGGGAGGAGGAGATGGGAGG + Intronic
1069397464 10:68005447-68005469 CTTTGCAGGGAGCAGATCACTGG + Intronic
1069542625 10:69306835-69306857 CTATGTAGGGACAAAATGGGAGG + Intronic
1070214951 10:74368350-74368372 CTTTGTGGGGCCAAGATGGGAGG - Intronic
1070699843 10:78593742-78593764 CTTTGGAAGGCCCAGATGGGGGG - Intergenic
1072620376 10:97075402-97075424 CTCTGTAGGGAGGAGGAGGGAGG + Intronic
1075347160 10:121691572-121691594 CTTTGGAGGGCTAAGATGGGAGG - Intergenic
1077937985 11:6810661-6810683 TTTTGTAGGCAGCAGATAGTTGG + Intergenic
1078088565 11:8249394-8249416 CTCTGTGGAGAGCAAATGGGAGG - Intronic
1080373726 11:31683071-31683093 CTTTGTGGGGAGGAGAGGGAAGG - Intronic
1081943403 11:46964980-46965002 GTTAGTAGGAAGCAGATGGTTGG + Intronic
1082661162 11:55913091-55913113 CTTTGTGGGGCCAAGATGGGTGG + Intergenic
1083031304 11:59595131-59595153 TTTTTTAGGGAGTAGAAGGGTGG - Intronic
1083936721 11:65873224-65873246 TTTTGCAGGGAGCAGATTGAGGG - Intronic
1084396344 11:68913255-68913277 ATTGGAAGGGAGCAGATTGGTGG + Intronic
1084662444 11:70554079-70554101 CTTTGTGGGGAGCAGATGGTAGG + Intronic
1084777346 11:71386326-71386348 CTTTGGAGTGAGAAGGTGGGAGG + Intergenic
1084793543 11:71489898-71489920 CCTGGTATGGAGGAGATGGGTGG + Intronic
1085055957 11:73403944-73403966 CTGTGTGGGGATCAGATGGAGGG + Intronic
1087071424 11:94085063-94085085 CTTAGTAGAGAGCAGGAGGGGGG + Intronic
1089908030 11:122065603-122065625 CTTGGTAGGGACCTGGTGGGAGG + Intergenic
1090815801 11:130294163-130294185 CTTTGTGGGGCCGAGATGGGTGG + Intronic
1091000858 11:131910132-131910154 CTTTGTGGGGGGCTGCTGGGCGG + Intronic
1091397528 12:163170-163192 CTGTGGAGGGAGGAGAGGGGAGG - Intronic
1091397594 12:163327-163349 CTGTGGAGGGAGGAGAGGGGAGG - Intronic
1091397606 12:163359-163381 CTGTGGAGGGAGGAGAGGGGAGG - Intronic
1091519492 12:1222456-1222478 CTTTGGGGGGACAAGATGGGTGG - Intronic
1091714107 12:2764770-2764792 CCTTGGAGGGAGCAGAGAGGAGG + Intergenic
1091957310 12:4657437-4657459 CTTAGTAAGGAGTAGTTGGGTGG + Intronic
1092063353 12:5568769-5568791 CTTTGGAGGTAGCAGGTGAGGGG + Intronic
1092070141 12:5625446-5625468 CTTTGAAGTGAGCATTTGGGTGG + Intronic
1092463017 12:8703040-8703062 CTTTGTGGGGCCAAGATGGGTGG + Intronic
1093720766 12:22439189-22439211 TTTTGAAGGCAGCAGATGGTTGG - Intergenic
1094253239 12:28391054-28391076 CTTTTTAAGGAGAAGATGTGTGG + Intronic
1095250026 12:39968359-39968381 CTTGGGAGGGACCTGATGGGAGG - Intronic
1095485482 12:42680115-42680137 CTCAGTAGGAGGCAGATGGGTGG + Intergenic
1095570430 12:43677915-43677937 CCTTGTAGGCAGCAGATAGTTGG - Intergenic
1096249027 12:50015121-50015143 CTTTGCAGGGCTGAGATGGGTGG - Intronic
1098423816 12:70336019-70336041 CTTTGTAGAGAGGAGATGTGGGG + Intronic
1099664841 12:85614756-85614778 CTTTGTGGGGAGCACATAGTAGG - Intergenic
1099717383 12:86312837-86312859 CATTGTAGGGAAGAGATGAGTGG + Intronic
1101220563 12:102634861-102634883 ATGTGTATGGGGCAGATGGGAGG + Intergenic
1102666729 12:114580708-114580730 GTCTATAGGGAGCAGGTGGGTGG - Intergenic
1103442787 12:120975910-120975932 CTTTGTGGGGCTGAGATGGGAGG + Intergenic
1103566445 12:121818264-121818286 CTTTGTAACGAGCAGTTGGCCGG + Intronic
1103847375 12:123910960-123910982 CTTTGGAAGGCCCAGATGGGAGG + Intronic
1103949510 12:124543266-124543288 CCTTGTTGGGAGCAGACAGGTGG - Intronic
1107666600 13:42697207-42697229 CGAGGAAGGGAGCAGATGGGAGG - Intergenic
1108524223 13:51272260-51272282 TTTGGTAGGGAGCAGAGGGGAGG - Intronic
1108867839 13:54942675-54942697 TTGTGTAGGGAGCAGAAGAGTGG + Intergenic
1109548690 13:63862814-63862836 CATTGTAGGCAGCATATGGTTGG - Intergenic
1110759093 13:79210315-79210337 CTTTGGAGGGTCGAGATGGGAGG + Intergenic
1110916148 13:81023283-81023305 CTTTGAGGGCAGCAGATGGTTGG - Intergenic
1110931678 13:81226410-81226432 CTTCAGAAGGAGCAGATGGGAGG + Intergenic
1111647054 13:91044591-91044613 CTTTACAGTGGGCAGATGGGCGG - Intergenic
1115875629 14:37858135-37858157 GTATGTAGTGAGCACATGGGAGG - Intronic
1119263232 14:73250504-73250526 CTTTCTAGGGAGCAGAAGGTCGG - Intronic
1119592110 14:75899656-75899678 CTTTGATGGGAGTTGATGGGAGG + Intronic
1119947547 14:78710804-78710826 CTTTGCAGAGGGCAGATGGGTGG + Intronic
1120018232 14:79498496-79498518 CTCTGTAAGGAGCAGGTTGGGGG - Intronic
1120283615 14:82469688-82469710 TTTTGCAGGGAGGACATGGGTGG + Intergenic
1120748112 14:88170652-88170674 TCTTGTAGGCAGCAGATGGTTGG - Intergenic
1120912277 14:89678032-89678054 CATGGGAGGGACCAGATGGGAGG + Intergenic
1121963451 14:98282697-98282719 CTTGGGATGGACCAGATGGGAGG - Intergenic
1122701945 14:103595603-103595625 GTTTGAAGGGAGGAGATGTGGGG + Intronic
1124075855 15:26443623-26443645 CTCTGTAGGGAGGATTTGGGAGG - Intergenic
1125316576 15:38438807-38438829 TCTTGTAGGGAGCAGATGGCTGG + Intergenic
1125426472 15:39554161-39554183 CTTACTGGGAAGCAGATGGGTGG + Intergenic
1126269302 15:46794719-46794741 TTTTGTAGGCAGCATATGGTTGG - Intergenic
1127784191 15:62341869-62341891 CTTTGAAGGAAGCAGAGGTGGGG + Intergenic
1129302909 15:74636574-74636596 CAATGTAGGGAGGAGATGGACGG + Intronic
1135413322 16:22250982-22251004 CTTTGAAGGATGCAGAGGGGTGG + Intronic
1136289806 16:29264759-29264781 CATGGTAGGGAACAGAAGGGAGG + Intergenic
1136481518 16:30545026-30545048 CTGTGCAGGGAGCAGAAGAGTGG + Intronic
1136520340 16:30791660-30791682 CTTTGCGGGGTGAAGATGGGAGG - Intergenic
1137468139 16:48729783-48729805 GGCTGTTGGGAGCAGATGGGGGG + Intergenic
1137616832 16:49853787-49853809 GTTTGCAGTGAACAGATGGGTGG - Intronic
1138664454 16:58553027-58553049 CTTTGCAGGGCGGAGGTGGGCGG + Intronic
1138903539 16:61302867-61302889 CTTTGTGGGGTGGAGATGGGTGG - Intergenic
1139313722 16:66049969-66049991 CTTTGAAGCAAGCAGATGGAGGG - Intergenic
1139404077 16:66704536-66704558 CTTTGCAGGGCTGAGATGGGAGG + Intergenic
1140316793 16:73906152-73906174 CTTTGTGGGGCTGAGATGGGAGG - Intergenic
1142095690 16:88238235-88238257 CATGGTAGGGAACAGAAGGGAGG + Intergenic
1143037835 17:4009886-4009908 CTTTGTGGGGAGCATAGGTGAGG - Intronic
1143207312 17:5153183-5153205 ATTTGGAGGAAGCAAATGGGAGG + Intronic
1143854045 17:9835289-9835311 CCTAATAGGGAGCAGATGGTGGG + Intronic
1145056041 17:19704693-19704715 CTCTGTGGGGAGTAGAGGGGAGG + Intronic
1145781605 17:27567482-27567504 CTTAGAAGGTGGCAGATGGGCGG - Intronic
1147178979 17:38673417-38673439 CTGTGGAGGTGGCAGATGGGGGG - Exonic
1149873039 17:60200660-60200682 ATTTGGAGGAAGCAAATGGGAGG - Intronic
1150040424 17:61854461-61854483 CTTTGTGAGGCACAGATGGGTGG + Intronic
1150086819 17:62277937-62277959 ATTTGGAGGAAGCAAATGGGAGG - Intronic
1150436386 17:65157477-65157499 CCTTGAGGGGAGCAGGTGGGTGG + Intronic
1150897605 17:69232148-69232170 TTTTGTAGGCAGCAGATAGTTGG + Intronic
1151687820 17:75659595-75659617 CTTTGGGAGGACCAGATGGGAGG - Intronic
1152207759 17:78984175-78984197 CTTTGTGGGGCGGAGGTGGGTGG - Intergenic
1152732415 17:81978758-81978780 CTTTTTATGGAGAAGAGGGGCGG + Intronic
1153108659 18:1558880-1558902 TTTTGAAGGCAGCAGATGGTTGG + Intergenic
1153172043 18:2327620-2327642 CTTTGGGAGGAGGAGATGGGTGG - Intergenic
1154092531 18:11378771-11378793 CTTTGAGGGGACAAGATGGGAGG - Intergenic
1154172012 18:12059425-12059447 CTTTGCAGGGAGCAGGTTGGGGG - Intergenic
1156380935 18:36560485-36560507 CTTTGAAGGGAAGACATGGGAGG - Intronic
1156535375 18:37859201-37859223 TTTTGTAGGCAACAGATTGGTGG + Intergenic
1158413597 18:57230394-57230416 CTTTGCAGGGCTGAGATGGGAGG + Intergenic
1161755621 19:6131423-6131445 CTTATTAGGAAGCAGATGAGAGG + Intronic
1161894560 19:7070349-7070371 CATTTTAGGGACCAGATGGCTGG + Intronic
1163365227 19:16872331-16872353 ATTTGAAGGGGGCAGATGGATGG + Intronic
1163450399 19:17373622-17373644 CATTGTGGGGAGCAGGTGTGGGG - Intronic
1164592396 19:29513817-29513839 ATGTGTAGGAAGGAGATGGGGGG + Intergenic
1165139474 19:33690125-33690147 CTTTGGAGGGAGAGGAGGGGAGG + Intronic
1166000759 19:39876107-39876129 CTTTGGAAGGACGAGATGGGAGG + Intronic
1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG + Intergenic
1166792995 19:45408930-45408952 CTTCGTAGGGGGCAGAGGGATGG - Exonic
925112985 2:1352292-1352314 ATTTGAAAGGAGCAGAGGGGAGG - Intronic
925452336 2:3980309-3980331 TTTTCTTGGGAGCAGATGTGAGG + Intergenic
925848318 2:8054165-8054187 ATTTGTAGGGAGTAGATTTGGGG - Intergenic
926072349 2:9907905-9907927 CTTGGAAGGGAGCAGAGGGTGGG - Intronic
926580734 2:14631569-14631591 CTTTGTAGGGAAGAGGTGGGGGG + Intergenic
927048208 2:19301522-19301544 CTTAGTAGAGAGGAGATGAGTGG + Intergenic
927144919 2:20157272-20157294 CTTTGAAAGGAGCAGGAGGGAGG + Intergenic
930088773 2:47516968-47516990 CTTTGTAGGGTGGAGAGGGAGGG - Exonic
930341332 2:50119323-50119345 CTTTGTGGGGAGCATTTGGCAGG - Intronic
931364558 2:61607864-61607886 CTTTGTGGGGCAGAGATGGGAGG + Intergenic
933372382 2:81431782-81431804 CTTTGTGGGGAGCAGGGGTGGGG + Intergenic
936617267 2:114061007-114061029 CTTTGTTGGGAATAGAAGGGAGG - Intergenic
936933191 2:117811427-117811449 CATTGTAGAAAGCAGATGGCTGG - Intergenic
937344394 2:121115567-121115589 CTTTGGGAAGAGCAGATGGGAGG + Intergenic
937498093 2:122446618-122446640 TTCTGTAGGGAGCACATGGTTGG + Intergenic
937876869 2:126832619-126832641 CTCAGCAGGGAGCAGATGAGGGG + Intergenic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938378923 2:130825849-130825871 TTTTGTGTGCAGCAGATGGGGGG - Intergenic
939948880 2:148444805-148444827 CTGTCTGGGGAGCAGAGGGGTGG - Intronic
940484626 2:154281829-154281851 CTTTTGAGGGAGCAGCTGGTGGG - Intronic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
942584927 2:177465628-177465650 CCTTGTAGGGAGCTGATGCCTGG - Intronic
942663124 2:178287695-178287717 TTTTGTGGGGGGTAGATGGGGGG - Intronic
942771120 2:179521642-179521664 CTTTTTAGAGAGCAGATGGATGG - Intronic
943184133 2:184584461-184584483 ATTTGTAGGAAGCATATGAGTGG - Intergenic
945988051 2:216370947-216370969 CTTTTAAGAGAGCAGTTGGGTGG + Exonic
946363551 2:219234493-219234515 CTTTGTGTGGAGCAGATGCGTGG + Intronic
947441572 2:230126624-230126646 CTGAGTAGGGACCAGATTGGGGG - Intergenic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
947978969 2:234392588-234392610 CTTTGTGGGGTTGAGATGGGTGG + Intergenic
1170259259 20:14384990-14385012 CTTTGAACAGAGCAGAGGGGTGG - Intronic
1171298851 20:24041949-24041971 CCTGGGTGGGAGCAGATGGGGGG - Intergenic
1172368665 20:34369858-34369880 CTTTGTGGGGCGAAGGTGGGAGG + Intronic
1172792723 20:37517263-37517285 CTTTCTGGAGAGCAGATGGTGGG - Intronic
1173351457 20:42249302-42249324 CTTTATAGGGAACAAATGGTAGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174048329 20:47749572-47749594 CTCTGTAGGGGCCAGATGGCTGG - Intronic
1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG + Intergenic
1174530219 20:51206156-51206178 CTTTGGAAGGCCCAGATGGGTGG - Intergenic
1174917799 20:54671585-54671607 CTTTTTAGGGAGGAGAGGGGTGG - Intergenic
1175423030 20:58847656-58847678 CTTTGCAGGGAGGAGGTGGGTGG - Intronic
1176923127 21:14713364-14713386 CTTTGTAGACAGCAGATAGGTGG - Intergenic
1178798638 21:35770299-35770321 CTTTGGAGGGTGGAGTTGGGAGG + Intronic
1178882579 21:36461041-36461063 CTTTGTAGGCAGCTGGTGGCTGG + Exonic
1180191489 21:46166511-46166533 TCTTGTAGGCAGCAGATGGTTGG - Intronic
1180717969 22:17884903-17884925 CTTCCTATGGACCAGATGGGTGG - Intronic
1182710329 22:32318678-32318700 CTGTGTTGAGAGCAGATGGAAGG - Intergenic
1182975605 22:34621423-34621445 CTTTGTTGTGAGCAAATGGCTGG - Intergenic
1183132187 22:35849181-35849203 CTTTGTTTTGAGCAGATGAGAGG - Intronic
1183204822 22:36411568-36411590 CTTTGTGGGGCTCAGGTGGGAGG - Intergenic
1184274541 22:43402749-43402771 CTCTGCAGGCAGCAGAGGGGAGG - Intergenic
1184341655 22:43889544-43889566 ATTTGTGGGGAGCAGGTGGGTGG + Intronic
1184397899 22:44255643-44255665 CTGTGTTGAGAGCAGATGGAAGG - Intronic
1184463496 22:44654856-44654878 CTTTGGAAGGATGAGATGGGAGG + Intergenic
1184825811 22:46950059-46950081 GGTTGTAGGGAGAAGCTGGGTGG + Intronic
952341288 3:32449680-32449702 CTTTGGAGAGAGCTGATGGCTGG - Intronic
955984812 3:64561497-64561519 CTTTATAGGGAACAGATGTGAGG + Intronic
956341480 3:68229023-68229045 ATTTGGAGGGGGCAGATGGTGGG - Intronic
956974723 3:74566313-74566335 CTTTGAAGGGAGCAAAGGGAAGG + Intergenic
957696959 3:83650925-83650947 CATGGGAGGGACCAGATGGGAGG - Intergenic
957772256 3:84708873-84708895 TTTTGTAGGAAGCAGATGGTTGG - Intergenic
963112746 3:141700599-141700621 GTGTGCAGGGAGCAGAAGGGTGG + Intergenic
963176277 3:142300769-142300791 TTTTGAAGGCAGCAGATGGTTGG - Intergenic
964487413 3:157200101-157200123 TTTTGTAGGGAGCAGATTTCTGG + Intergenic
965812148 3:172602488-172602510 CTTTGTAGTGTGCAGAGGGGCGG - Intergenic
966200383 3:177355404-177355426 CTTTGTAAGGCTGAGATGGGTGG + Intergenic
966987839 3:185198462-185198484 CTTTGTAGGGCCAAGGTGGGTGG - Intronic
967944693 3:194794726-194794748 CCTTGTAGGAAGCATATGGTTGG + Intergenic
968123672 3:196143368-196143390 CTTTGAAGGGCGAGGATGGGCGG + Intergenic
971341687 4:25775035-25775057 GTTTGTAGGGAGCAGAGGGTGGG + Intronic
973070662 4:45854555-45854577 CCTTGAAGGCAGCAGATGGTTGG + Intergenic
973759917 4:54106126-54106148 CTGTGTTTGGAGAAGATGGGAGG - Intronic
975664245 4:76719102-76719124 CTTTTTAGGGAGAAGATGTCTGG - Intronic
975757633 4:77586898-77586920 GTTTGTAGGCAGGAGATGTGGGG - Intronic
976040860 4:80883511-80883533 GTTTGTAGGCAGCATATGGTTGG - Intronic
976377174 4:84358833-84358855 TTTAGTAGGGAGCAGATGGCTGG + Intergenic
978367477 4:107997330-107997352 CTGTTGAGGGAGGAGATGGGAGG + Intronic
978805251 4:112792955-112792977 GTTTTGAGGTAGCAGATGGGAGG - Intergenic
978927508 4:114266491-114266513 CTTTGTGAGGCCCAGATGGGAGG - Intergenic
981908314 4:149949588-149949610 GTTTGGAGGGAGCAGGCGGGAGG - Intergenic
984556662 4:181222178-181222200 TTTTGTAGGAGGCATATGGGTGG - Intergenic
985968229 5:3353767-3353789 CTTTGCAGGGGGCAAATGGATGG + Intergenic
986407094 5:7437042-7437064 CTTTGTAGGCACCAGCTGTGGGG + Intronic
987886607 5:23821428-23821450 TTCTGTAGGGGGCAGATGTGTGG + Intergenic
989534427 5:42547671-42547693 CTTTGAAGGGATGAGATGAGGGG + Intronic
990899550 5:60735773-60735795 TTTTGAAGGCAGCAGATGGTTGG + Intergenic
991091329 5:62696494-62696516 CTTGTGAGGGAGCCGATGGGGGG - Intergenic
991519050 5:67474719-67474741 ATTTGTTGGGAGCAGAAGGTCGG + Intergenic
992901322 5:81300098-81300120 CTTTGGAGGGAAGAGGTGGGCGG + Intergenic
994559526 5:101349490-101349512 CTTTACAGGCAGCAGATGGGTGG - Intergenic
995735965 5:115299095-115299117 ATTTGGAGGGAGGAGATGGTTGG + Intergenic
996324393 5:122256278-122256300 TTTTATAGGCAGCAGATGGTTGG + Intergenic
998383776 5:141744204-141744226 CTCTGAAGGGAGCAGAAGAGAGG + Intergenic
1000198958 5:158988598-158988620 CTTTGAAGGGAGGAGTTGAGGGG + Intronic
1000550634 5:162658459-162658481 CAGTGGAGGGAGCAGGTGGGAGG + Intergenic
1001144626 5:169173016-169173038 CTTTGAAAGGCGCAGAGGGGTGG + Intronic
1001576144 5:172765273-172765295 CTTTCTGGAGAGCAGGTGGGAGG - Intergenic
1001778525 5:174347501-174347523 GTGTGTAGGTGGCAGATGGGAGG + Intergenic
1001860588 5:175051353-175051375 CATGGTAGGGAGCTGGTGGGAGG + Intergenic
1002038797 5:176495363-176495385 CTTTGCAGGGGGCAGAAGGGAGG + Intronic
1003035046 6:2634482-2634504 CTTTCTCGGAAGCAGCTGGGGGG + Intronic
1003583328 6:7362535-7362557 CTGTGAATGGAGCAGATGGCAGG + Intronic
1003665741 6:8109657-8109679 CTTTGTAGGGAGCAAATACAGGG - Intergenic
1004259819 6:14098046-14098068 CTTTGTAGAGACAATATGGGTGG + Intergenic
1005474188 6:26191247-26191269 CTTTGAAAGGCCCAGATGGGAGG + Intergenic
1007770993 6:44192334-44192356 CTCTGGAGGGAGTGGATGGGGGG - Intergenic
1009381302 6:63033977-63033999 ATTTGGAGGGAGCAGGTAGGGGG - Intergenic
1012765451 6:103361969-103361991 CGTGGGAGGGAGCTGATGGGAGG + Intergenic
1013199530 6:107879566-107879588 CTTTGTGGGGACGAGGTGGGTGG - Intronic
1013470897 6:110463356-110463378 TCTTGTAGGTAGCAGATGGTTGG - Intronic
1013501265 6:110754274-110754296 CTTTGTGAGGTGGAGATGGGAGG - Intronic
1013640562 6:112073981-112074003 CTTTGAAAGGATGAGATGGGAGG - Intronic
1014139764 6:117927819-117927841 CTTTGTAGGCAACAAATGGAGGG - Intronic
1014507143 6:122273365-122273387 CTTTGGAAGGCGGAGATGGGCGG + Intergenic
1015506490 6:133993999-133994021 CTGTGTAGAGAACTGATGGGAGG + Intronic
1015709952 6:136128877-136128899 CTTTGGGGGGAGCAGAAAGGTGG - Intronic
1015869671 6:137763103-137763125 CTCTGTAGGAAGCTGATGTGTGG - Intergenic
1016279687 6:142401222-142401244 CTTTGTAGGGAGCAAAGAAGGGG + Intronic
1016331114 6:142952717-142952739 CTTTTTAGGCAGAAGCTGGGTGG + Intergenic
1016549131 6:145257495-145257517 CTTGGTAGGGATCATAAGGGAGG - Intergenic
1017244778 6:152211417-152211439 CTTTTTAATGAGCAGATTGGAGG - Intronic
1018058008 6:160069028-160069050 CTTAGCAGGTAGAAGATGGGGGG + Intronic
1018214585 6:161514598-161514620 CTTAGGAGGGAGGTGATGGGTGG + Intronic
1018620814 6:165727639-165727661 ATTTGCAGGGAGTAGATAGGAGG + Intronic
1019035066 6:169047634-169047656 GTTTGGAGGGAGCAGTTGCGGGG + Intergenic
1020358393 7:7301816-7301838 TTTTGGAGGCAGCAGATGGTTGG + Intergenic
1021123971 7:16828905-16828927 CTTTGTAGGCAACAGATTGTTGG - Intronic
1021411005 7:20330345-20330367 CTTTGTATGCAGCAGCTGCGGGG + Intergenic
1021930675 7:25578308-25578330 TATTGTACGGGGCAGATGGGAGG + Intergenic
1022183006 7:27940107-27940129 CTCTGTAGGGAGCAGGTGAGAGG - Intronic
1022852897 7:34283308-34283330 CTTGGGAGGGACCGGATGGGAGG - Intergenic
1022854073 7:34298368-34298390 CTTTGTGGGAAGAAGGTGGGAGG - Intergenic
1023424411 7:40020309-40020331 CTTTGCCGGGAGGAGGTGGGAGG - Intronic
1024046103 7:45586828-45586850 CTGTGCAGGGAGCAGTTGTGTGG + Intronic
1024559916 7:50634619-50634641 TCTTGTAGGCAGCAGATGGCTGG - Intronic
1026606862 7:71823995-71824017 CATGGGAGGGAGCTGATGGGAGG - Intronic
1028174421 7:87637096-87637118 CATGGGAGGGAGCAGATGGGAGG - Intronic
1028559188 7:92154839-92154861 GTTTGTAGGCATCAGCTGGGGGG - Intronic
1029230449 7:99063531-99063553 CTTTGTGGGGCGAAGTTGGGAGG - Intronic
1031512912 7:122671025-122671047 CTGAGTAGGGATCAGCTGGGTGG - Intronic
1031978786 7:128110851-128110873 CTGAGTGGGGAGCAGAGGGGTGG - Intergenic
1032282805 7:130518470-130518492 TTTGGTATGGAGCAGGTGGGTGG + Intronic
1034585441 7:152087526-152087548 CTTTGTAGGGAGCAGATGGGTGG + Intronic
1036621408 8:10426508-10426530 CTTTGCAGGGCGCAGCTGTGAGG - Intronic
1037010698 8:13838888-13838910 CTTTGTAAGGCCAAGATGGGAGG - Intergenic
1038902972 8:31864792-31864814 CAGTGTAGAGAGCAGATTGGTGG + Intronic
1040811684 8:51460999-51461021 CTTTTATGGGAGCAGCTGGGTGG - Intronic
1041190443 8:55348332-55348354 CTGTGTGGGGATTAGATGGGAGG - Intronic
1043889521 8:85641059-85641081 AGTTGTAGAGAGCAGACGGGTGG + Intergenic
1044368144 8:91375148-91375170 CTATGGAGGCAGCAGATGGTTGG + Intronic
1044907433 8:97019457-97019479 CTCTGAAGGCAGCAGATGGTTGG - Intronic
1045392262 8:101727182-101727204 CTTTAGAGAGAGCAGTTGGGTGG - Intronic
1045919440 8:107511962-107511984 CTTGGTAGGGACCTGATGGGAGG + Intergenic
1047151217 8:122265284-122265306 CTTGGGAGGGAGCTGGTGGGAGG - Intergenic
1049003688 8:139841704-139841726 CACAGTAGGGAGCCGATGGGAGG + Intronic
1049328935 8:142039416-142039438 CTTTGTAGAGACCAGTTAGGTGG + Intergenic
1051174861 9:14350811-14350833 GGTTGTTGGAAGCAGATGGGAGG - Intronic
1051258352 9:15236048-15236070 ACTTGTAGGCAGCAGATGGTTGG - Intronic
1055331009 9:75183872-75183894 CTTTTTAGGGTGCTGATAGGCGG - Intergenic
1056331808 9:85527453-85527475 CATTGGAGAGAGCAGATGGCTGG - Intergenic
1056384070 9:86081129-86081151 CTTTGAGGGGCCCAGATGGGAGG - Intronic
1058302709 9:103396518-103396540 TTTTGTAGACAGCAGATGGTTGG + Intergenic
1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG + Intronic
1059129585 9:111732338-111732360 CTTTGGGTGGACCAGATGGGAGG + Intronic
1059294890 9:113261353-113261375 CTTTGTAGTGTGCAGAGCGGTGG + Exonic
1059331386 9:113537789-113537811 CTATGCAGGGGGCAGTTGGGGGG + Intronic
1059771826 9:117434025-117434047 CTTGGTAGAGGGGAGATGGGTGG + Intergenic
1060401665 9:123353246-123353268 CTTTCCAGGAAGCAGATGGAAGG + Intergenic
1061163658 9:128910307-128910329 CTGTGTCGGGGGCAGAAGGGTGG - Intronic
1061594987 9:131623150-131623172 CTTTTTAGGGAGCAGTTTGTGGG - Intronic
1062040165 9:134400872-134400894 GTTTGAGGGGACCAGATGGGTGG - Intronic
1188527038 X:31097907-31097929 CTTTATAGGGATATGATGGGGGG + Intronic
1190061170 X:47212602-47212624 CTTTGTGGGGATCAGATTGTGGG + Intronic
1190182113 X:48201509-48201531 CTTTGGAAGGCGGAGATGGGCGG - Intronic
1190195247 X:48312222-48312244 CTTTGGAAGGCGGAGATGGGCGG - Intergenic
1190702154 X:52997116-52997138 TTTTCTGGGGAGCAGTTGGGAGG - Intergenic
1191616106 X:63171162-63171184 CCTTGAAGGAAGCAGATGGTTGG - Intergenic
1191620191 X:63207761-63207783 CCTTGAAGGAAGCAGATGGTTGG + Intergenic
1192559020 X:72113258-72113280 CTGTGTGGGAAACAGATGGGAGG + Intergenic
1193330530 X:80231369-80231391 TTTTGAAGAGAGCAGATGGTTGG + Intergenic
1195370462 X:104167259-104167281 ATTCGTAGGGTACAGATGGGGGG - Intronic
1195824563 X:108984134-108984156 CTTTGGAGGGACCCGATGGGAGG + Intergenic
1198177344 X:134169926-134169948 GTTTGTTGGGAACAGATGGTGGG - Intergenic
1199326511 X:146504467-146504489 CTTTGCAGGGCTGAGATGGGAGG + Intergenic
1200122703 X:153798648-153798670 TTTTGTGGGGACCAGACGGGGGG - Intergenic