ID: 1034586157

View in Genome Browser
Species Human (GRCh38)
Location 7:152094335-152094357
Sequence ACTTAAGAATGTGCCCGTCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034586155_1034586157 29 Left 1034586155 7:152094283-152094305 CCTGGACAGTTTTGCTTTTTGTT 0: 1
1: 1
2: 3
3: 94
4: 1059
Right 1034586157 7:152094335-152094357 ACTTAAGAATGTGCCCGTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034586157 Original CRISPR ACTTAAGAATGTGCCCGTCA AGG Exonic
906041483 1:42790943-42790965 ACTTGAGAATGGGCCTCTCAGGG + Intronic
912344892 1:108955133-108955155 ACTTAAGACAGTGCCCAGCATGG - Intronic
922313350 1:224417546-224417568 ACTTAAGAATTAGCCAGGCATGG + Intronic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1063416576 10:5877921-5877943 ACTCCATAATGTGCCTGTCATGG + Intronic
1064273995 10:13890579-13890601 ACTTAGAAATGTGCCTGTCTAGG + Intronic
1065906274 10:30255284-30255306 GCCTGAGAATGTGCCCCTCATGG - Intergenic
1075815605 10:125262357-125262379 ACTTAAGTTTGAGCCAGTCACGG - Intergenic
1079257449 11:18844403-18844425 ACTTATGAATGTGCCCAATAAGG - Intergenic
1080663688 11:34317480-34317502 AATTAAGAATGGGCCAGGCATGG + Intronic
1085044230 11:73343992-73344014 TCTTCACACTGTGCCCGTCAGGG + Intronic
1088987776 11:114925347-114925369 ACTTAATAACTTGCCCATCATGG + Intergenic
1099250752 12:80250344-80250366 ACATATTAATGTGCCTGTCATGG + Intronic
1102702324 12:114850198-114850220 ACTTAAGAATCTGCCGGGCATGG + Intergenic
1104093966 12:125539171-125539193 ACTTAAGAATGTGTGTGTCATGG - Intronic
1106881531 13:34137112-34137134 ATTTGAGAATGTGGCTGTCAGGG + Intergenic
1107794777 13:44039115-44039137 CCTTAATAATGTACCTGTCATGG + Intergenic
1110381816 13:74860834-74860856 ACCTATGAATGTGGCCTTCAGGG + Intergenic
1119471216 14:74900878-74900900 ACTTAAGAATTAGCCAGGCATGG - Intronic
1125209865 15:37201476-37201498 CCTTAAGAAAGTGCCCTTAATGG - Intergenic
1138262751 16:55637043-55637065 ACTCAAGAAGGTGCCTGCCAAGG - Intergenic
1145858260 17:28183482-28183504 ACTTAAAAATTAGCCCGGCATGG - Intronic
1148250451 17:46074609-46074631 ACATAAAAATGTGCCAGGCATGG + Intronic
1149756415 17:59190179-59190201 AATTAAGAATGGGCCAGGCACGG + Intronic
1154396910 18:13998951-13998973 ACTGAATCATGTCCCCGTCAGGG - Intergenic
1157910955 18:51617068-51617090 ACTTTAAAATGGGCCCATCAGGG + Intergenic
1159441523 18:68486339-68486361 AATTAAAAATGGGCCAGTCATGG + Intergenic
929642353 2:43594617-43594639 ACTTGAGATTTTGCCCTTCAAGG + Intronic
929728640 2:44461021-44461043 ACTTAAGAATCTGTCACTCAGGG - Intronic
947425288 2:229977897-229977919 ACTTTAGAATGTGTCTCTCAAGG + Intronic
1172996818 20:39076936-39076958 ACTTAAGAATGTCCAGATCAGGG - Intergenic
1174583583 20:51590696-51590718 ACTGGAGAATGTACCTGTCATGG - Intergenic
1176094855 20:63335937-63335959 CCTTTGGAATGTGCCCTTCAAGG - Intergenic
950904132 3:16522185-16522207 AATTAAGAGTGTGCCAGTCAGGG + Intergenic
952485853 3:33808910-33808932 ACTTAAGAATGTATCTGGCATGG - Intronic
955850809 3:63217774-63217796 ATTTAACAATGTGCCCTTCTAGG - Intergenic
956410124 3:68970521-68970543 ACTTAACACTGTGCCCGACTTGG + Intergenic
960892691 3:122466843-122466865 ATTTAAAAATTTGCCAGTCATGG + Intronic
961975861 3:131024596-131024618 ACTTAAGAATGTCTCCATGATGG + Exonic
964752979 3:160069155-160069177 GCTTAAGCATGTCCCTGTCAAGG + Intergenic
966003671 3:174981933-174981955 ACTTCAGAAAGTGTCCGTAAAGG - Intronic
967534103 3:190582605-190582627 ATTTAAGAATGTGCCAGGCAGGG - Intronic
970077915 4:12245839-12245861 ATTTATGAATGTGTCCGGCAGGG + Intergenic
973789462 4:54364927-54364949 ACTCAATAATGTGCCCTTCATGG + Intergenic
977142265 4:93388248-93388270 TCTTAAGATTGTTCCAGTCAAGG + Intronic
982166140 4:152615137-152615159 ACTTAGAAAAGTGCCAGTCATGG + Intergenic
982765791 4:159346961-159346983 ACGGAAGAAAGTGCCCGTAAAGG + Exonic
986469033 5:8056100-8056122 ACTGAAGAATGTGCGTGTCAGGG - Intergenic
987007317 5:13723914-13723936 ATTTAAGAATGTCCCCGCCCAGG - Intronic
987129188 5:14844932-14844954 ACTTAAAAATGTTTCCCTCAGGG + Intronic
988321168 5:29698436-29698458 ACATAATAATGTGCCACTCAAGG - Intergenic
996479259 5:123955334-123955356 ACTTAAGAATGTGCTGGATAAGG + Intergenic
999589291 5:153126263-153126285 ACTTAAGTATTTGCCTGTAAAGG + Intergenic
1003345752 6:5264947-5264969 ACTTAAAAATCTGCCAGGCATGG - Intronic
1005879297 6:30042914-30042936 ACTAAAACATGTGCCCCTCAAGG - Intergenic
1012200176 6:96396226-96396248 ACTTATGAATGGGCCTGGCATGG - Intergenic
1012752445 6:103181376-103181398 ACTTAAAAATGAGCCAGGCATGG - Intergenic
1016608250 6:145959785-145959807 ACTTATGAATGTGCAGGTGATGG + Intronic
1019127515 6:169850825-169850847 ACTGGAGAATGTGCCCATTATGG + Intergenic
1019763632 7:2832761-2832783 ACTTAAGAAAGTGGGGGTCAGGG + Intronic
1025082639 7:55996888-55996910 ACTTAAGAATGGGCCAGGCGTGG + Intronic
1030726597 7:112933624-112933646 ACTAAAGGATGTGCTCGTCCTGG - Intronic
1034586157 7:152094335-152094357 ACTTAAGAATGTGCCCGTCAAGG + Exonic
1040054660 8:43047173-43047195 AATTAAAAATGTGCAGGTCATGG - Intronic
1048327183 8:133448753-133448775 ACTTCAGCATGTGCCTTTCAAGG - Intergenic
1056731550 9:89170218-89170240 ACTAAACAATGTGCCTGGCATGG + Intronic
1056777142 9:89521522-89521544 ACTTAAAAATGAGCCAGGCATGG + Intergenic
1058326490 9:103704928-103704950 ACTTAAGATTATGCCAGGCAAGG - Intergenic
1192257230 X:69472055-69472077 AATGAAGAATGTGCCCTACAAGG + Intergenic
1196719010 X:118836402-118836424 ACTTAAAAATTAGCCCGGCATGG + Intergenic