ID: 1034586172

View in Genome Browser
Species Human (GRCh38)
Location 7:152094397-152094419
Sequence ACTTGGGCCTCGAGTGAAAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034586172 Original CRISPR ACTTGGGCCTCGAGTGAAAC GGG (reversed) Exonic
900540371 1:3199732-3199754 CCTTGGGGCTCGAGTGCAGCTGG - Intronic
902334543 1:15747471-15747493 CCTTGGGCCTCCAGTGACCCGGG - Intronic
904090368 1:27940867-27940889 CCTTGGGCCAGGAGTGAGACTGG - Intronic
907932725 1:59015538-59015560 ACATGGGCCTCTCTTGAAACAGG - Intergenic
908586700 1:65577736-65577758 ACTTGGACCTTGAGTGAATCAGG + Intronic
909100399 1:71341789-71341811 ACTTAGCCCTGGAGTGTAACAGG + Intergenic
909339468 1:74515534-74515556 ACTTGTGCCTCTTGTAAAACTGG - Intronic
909612981 1:77572703-77572725 AATTGGGCCTGCAGTGAACCTGG - Intronic
914045104 1:144084737-144084759 ATTTGGGCCTAGATTGATACAGG + Intergenic
914133006 1:144875949-144875971 ATTTGGGCCTAGATTGATACAGG - Intergenic
1065634762 10:27719871-27719893 CCTTGGGCCTCGAGAGTAGCTGG - Intronic
1066981178 10:42418100-42418122 CCCTGGGCCTTGAGTGAAATAGG - Intergenic
1069767040 10:70870107-70870129 ACTTGGGACTTGAGAGACACTGG + Intronic
1070464276 10:76703859-76703881 CCTTGGGCCTCGAGTGAACATGG + Intergenic
1072854889 10:98936318-98936340 ACTTGGAACTCTAGTGAGACAGG - Intronic
1076686938 10:132202421-132202443 CCTTTGTCCTCGAGAGAAACGGG + Intronic
1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG + Intronic
1082583897 11:54909955-54909977 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1085599524 11:77842599-77842621 ACTTGGGATTGGAGAGAAACAGG + Exonic
1093259418 12:16917390-16917412 CCTTGGTCCTTGAGTGAAATTGG - Intergenic
1094685710 12:32712230-32712252 ACTTGGGCTTTTAGTGAAATGGG - Intronic
1094857535 12:34417416-34417438 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1095293778 12:40505830-40505852 ACTTGGGTCTCTAGTGATCCAGG - Intronic
1108482631 13:50890188-50890210 ACATGGGCCTCCAGAGAATCCGG - Intergenic
1117866606 14:60156098-60156120 ACTGGAGCCTCGAGTGGAATTGG - Exonic
1121722176 14:96117057-96117079 TCTTGGCCCTTGAGTGTAACAGG + Intergenic
1121822045 14:96978380-96978402 CCTTGGGCTTGGAGTGAAAAGGG - Intergenic
1122652218 14:103232149-103232171 CCTTGGGCCTGGAGCAAAACAGG + Intergenic
1125276960 15:38003715-38003737 CCTTGGGCCTTGAGTGAACATGG - Intergenic
1126095970 15:45091003-45091025 ACTTCTGCCTCAAGTGAAAGAGG - Intergenic
1132967183 16:2663875-2663897 ATTTGGGCCACTTGTGAAACGGG - Intergenic
1135125919 16:19809181-19809203 ACTTTGCCCTGGAGGGAAACTGG - Intronic
1138939747 16:61775971-61775993 ACTTGGGCTTAGAGAGAAAGAGG - Intronic
1142210663 16:88806956-88806978 ACTTGTGCCTTGAGAGATACCGG + Intronic
1143354224 17:6313421-6313443 ACAGGGCCCTCGAGTGAAAGGGG + Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1151588672 17:75028519-75028541 ACTTGGGCCACATGTCAAACAGG + Intergenic
1153285768 18:3452600-3452622 TCCTCGGCCTCAAGTGAAACAGG - Intronic
1163554596 19:17984863-17984885 ACCTGGGGCTCGAGTGAAGAAGG - Intronic
1163783735 19:19263758-19263780 ACTTGGGCCTGGAGTAAGTCAGG - Intergenic
1164884872 19:31769978-31770000 AATTGGGCCTCCAGGGACACAGG - Intergenic
1202684662 1_KI270712v1_random:38141-38163 ATTTGGGCCTAGATTGATACAGG + Intergenic
928484200 2:31712581-31712603 TTTTGGGCCTTGAGTGAACCAGG + Intergenic
931433175 2:62225958-62225980 AATTAGGCCTCAAGGGAAACTGG + Intergenic
933743294 2:85551875-85551897 ACTTGGCCCTCCAGGGAGACAGG + Exonic
934104238 2:88681377-88681399 ACTTGGCCCTGGGGTGTAACAGG - Intergenic
934529943 2:95079008-95079030 ACTTCAGCCTCCAGTGTAACTGG - Intergenic
942294956 2:174508136-174508158 CCTTGGGCCTTGAGTGAACATGG + Intergenic
947156361 2:227165448-227165470 ACTTGGAATTTGAGTGAAACTGG + Intronic
948817662 2:240521067-240521089 ACTTGGGCCTCAAGAGAGGCTGG + Intronic
948875332 2:240823925-240823947 CCTTGGGCGTCGAGTGACTCTGG + Intergenic
948983488 2:241507043-241507065 AGTTGGGCCTGCAGTGGAACAGG - Intronic
1169750512 20:8987894-8987916 ACTTAGCCCACTAGTGAAACAGG - Intergenic
1170614264 20:17936419-17936441 ACTGGGGCTTTGAGTCAAACAGG + Intergenic
1172340690 20:34155148-34155170 AATTGGCCCTCGAGTGAGTCAGG - Intergenic
1172351613 20:34247233-34247255 ACATGGTCCTCAATTGAAACAGG + Intronic
1172716680 20:36969447-36969469 ACTTGGCCTTGGAGTGTAACAGG + Intergenic
1172754349 20:37272882-37272904 ACTAGGGCCTCAAGTGATTCTGG + Intergenic
1178880005 21:36441930-36441952 ACTTGGGCTGAGAGGGAAACAGG - Intergenic
1181962455 22:26632552-26632574 ACTTAGTCTTCAAGTGAAACAGG - Intergenic
956364362 3:68483819-68483841 ACTTCGGGCTCCAGTGACACTGG - Intronic
957322622 3:78651893-78651915 ACTTGGTCCTCAGGTGACACAGG + Exonic
965433206 3:168614380-168614402 GCTTGGGCCTCAACTGAAATTGG + Intergenic
972716069 4:41647417-41647439 ACTTGGTCCTCAAATGAGACAGG + Intronic
978447054 4:108789651-108789673 ACCTTGGCCTTGAGGGAAACTGG - Intergenic
987631501 5:20478430-20478452 CCTTGGGCCTTGAGTGAACATGG + Intronic
989635727 5:43530905-43530927 TCTTGGGCCCCATGTGAAACAGG + Intronic
990122798 5:52476075-52476097 ACTTGGGCATGGAGGGACACTGG + Intergenic
1005469072 6:26144035-26144057 ACTTTAGCCTCCAGAGAAACTGG - Intergenic
1011430153 6:87277166-87277188 AGTTGGGTCTGGAGTGAAATTGG + Intergenic
1024140658 7:46460110-46460132 ACTTGGTCCTGGAGTGAACAGGG - Intergenic
1027829315 7:83157047-83157069 ACTTGGGCTTCTAGTGATCCAGG + Intronic
1028218323 7:88162764-88162786 ACTGGGGCCTGAATTGAAACAGG - Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1048180701 8:132191976-132191998 ACTTGGACCTCAAGTGCAGCAGG - Intronic
1057644528 9:96860257-96860279 CCTGGGGCCTTGAGTGAAATAGG + Intronic
1190263427 X:48813967-48813989 ATTTGGGCCTCCAGTGTCACAGG + Intronic
1194215348 X:91124175-91124197 ACTTGGCCCTGGGGTGTAACAGG - Intergenic