ID: 1034587690

View in Genome Browser
Species Human (GRCh38)
Location 7:152110080-152110102
Sequence AACATTATGAAATGTCTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 357}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034587686_1034587690 18 Left 1034587686 7:152110039-152110061 CCACACAAACACATCAAGATGTG 0: 1
1: 0
2: 0
3: 23
4: 290
Right 1034587690 7:152110080-152110102 AACATTATGAAATGTCTGTTGGG 0: 1
1: 0
2: 1
3: 31
4: 357
1034587685_1034587690 22 Left 1034587685 7:152110035-152110057 CCTGCCACACAAACACATCAAGA 0: 1
1: 1
2: 3
3: 42
4: 420
Right 1034587690 7:152110080-152110102 AACATTATGAAATGTCTGTTGGG 0: 1
1: 0
2: 1
3: 31
4: 357
1034587684_1034587690 23 Left 1034587684 7:152110034-152110056 CCCTGCCACACAAACACATCAAG 0: 1
1: 0
2: 4
3: 35
4: 325
Right 1034587690 7:152110080-152110102 AACATTATGAAATGTCTGTTGGG 0: 1
1: 0
2: 1
3: 31
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034587690 Original CRISPR AACATTATGAAATGTCTGTT GGG Intronic
903293757 1:22330773-22330795 AAGGTTTTAAAATGTCTGTTGGG + Intergenic
904730534 1:32587655-32587677 GATATTATGAAATATGTGTTTGG + Intronic
906817847 1:48897771-48897793 TCCTTTAAGAAATGTCTGTTCGG + Intronic
908561881 1:65314343-65314365 AACATTATGAGATACGTGTTTGG + Intronic
909177167 1:72375681-72375703 AACATTATGGAATGATTATTTGG - Intergenic
910009285 1:82440929-82440951 AACATTACTAAGTGTTTGTTGGG - Intergenic
910138133 1:83997007-83997029 AACAAAATGAAATGACTTTTAGG + Intronic
910530630 1:88231363-88231385 ATCATTAGGAAATGTATGGTAGG + Intergenic
911191084 1:94949085-94949107 AACATTATGAGATTTATGCTTGG + Intergenic
911292085 1:96069417-96069439 AATGTTATGAAATGTCTATTGGG + Intergenic
911331889 1:96533946-96533968 AACATTATGAAATTCTTTTTTGG - Intergenic
911778204 1:101842235-101842257 AACATTATCAAATTTAGGTTAGG + Intronic
912397296 1:109355848-109355870 AACATTACCAAATGTTTCTTGGG - Intronic
912500407 1:110118229-110118251 AACATTAATAAATGTTTGGTAGG + Intergenic
912513746 1:110205496-110205518 AACAAAATAAAATGGCTGTTGGG + Intergenic
912809630 1:112784239-112784261 AACATTATGAAATGTTGGCTGGG - Intergenic
916382432 1:164226882-164226904 AACATTATTTAATGTGTGTTAGG + Intergenic
916844789 1:168638607-168638629 ACCATGAAGAAAAGTCTGTTGGG + Intergenic
917240619 1:172944446-172944468 AAAATTGTGAAAAGTCTGTTTGG + Intergenic
917542853 1:175932184-175932206 AAAATTAGAAAATGTCGGTTTGG - Intergenic
917577740 1:176341898-176341920 AAGAATAAGGAATGTCTGTTGGG - Intergenic
918310272 1:183280703-183280725 AACATTATGAGATTTTTTTTTGG + Intronic
919569340 1:199226608-199226630 AACAGTATCAATTTTCTGTTGGG - Intergenic
919637974 1:200022244-200022266 GACATTATGACATATCTATTAGG - Intergenic
921202333 1:212819263-212819285 AACATTAGGAAATCTCTGGATGG - Intergenic
922017719 1:221668529-221668551 AACATTTTGACATGTCTCTGAGG + Intergenic
923173789 1:231443668-231443690 ATCATTTTGAATTCTCTGTTGGG - Intergenic
923202561 1:231726251-231726273 AACATTATGGAATGTGGCTTGGG + Intronic
923703333 1:236320817-236320839 AACATTCTGTAATGTCTTTTTGG + Intergenic
923810775 1:237312569-237312591 AATATTTTGAAATGAATGTTTGG + Intronic
924714491 1:246560070-246560092 AACATTATGAGATGTATGCATGG + Intronic
924805097 1:247355564-247355586 AACATTTGGAAATTTTTGTTTGG - Intergenic
1063697893 10:8355337-8355359 AACATTTTGTAATGCCTGCTAGG - Intergenic
1064009577 10:11724979-11725001 AAAATGCTGAAATGTATGTTGGG - Intergenic
1065203312 10:23334707-23334729 GACATTAGGAAGGGTCTGTTGGG + Intronic
1065460981 10:25964315-25964337 CACATTAGAAAATGTCTATTAGG + Intronic
1066130920 10:32393085-32393107 AACATTTTCAAATTTCTTTTGGG + Intergenic
1068806356 10:61198381-61198403 AACACAATGAGATGTTTGTTGGG - Intergenic
1068872687 10:61962121-61962143 AACGTTATGCAATAACTGTTTGG - Intronic
1068908564 10:62353783-62353805 AAAATTAAGAAATGACTTTTAGG - Intergenic
1070043657 10:72808380-72808402 AAAATTATGAAATATTTCTTTGG - Intronic
1070422211 10:76248137-76248159 GACATTATTAAATGACTCTTGGG - Intronic
1070620001 10:78002092-78002114 AAATAAATGAAATGTCTGTTTGG + Intronic
1071970631 10:90902604-90902626 AACTTTATTAAATGTCTTTCTGG - Intronic
1071980243 10:90998159-90998181 AACATGAGGAAATGTGTGGTTGG + Intergenic
1073269596 10:102251182-102251204 AGCATTATGATATGGCTGGTAGG + Intronic
1073651161 10:105360021-105360043 AAACTTATGAATTGTCTCTTTGG + Intergenic
1073885457 10:108034650-108034672 CACATTAAGAAAACTCTGTTTGG - Intergenic
1074090030 10:110242625-110242647 ATAATAAAGAAATGTCTGTTTGG + Intronic
1074731220 10:116377883-116377905 AAAATTATTAAATGTCAGCTGGG + Intronic
1078540397 11:12208645-12208667 AACATTATGATATGCCTATACGG - Intronic
1078702180 11:13697055-13697077 GACATCACCAAATGTCTGTTGGG + Intronic
1080220271 11:29894864-29894886 AATATTACCAAATGTCTTTTGGG + Intergenic
1080982678 11:37427414-37427436 CACATCATGAAATGTTTGATGGG - Intergenic
1081365353 11:42228460-42228482 AACATTATCAAATGTCACCTGGG + Intergenic
1082281254 11:50273600-50273622 AAGAACATGAAATGTTTGTTTGG + Intergenic
1084508046 11:69582282-69582304 AATTTTATAAAATGTCTCTTTGG + Intergenic
1086533309 11:87812523-87812545 AATATTATGAAGAGTCTTTTGGG + Intergenic
1086804885 11:91228228-91228250 AAGATTATTAAATGTCTACTTGG + Intergenic
1087370151 11:97273824-97273846 AACATGAGGTAATGTCAGTTGGG - Intergenic
1087426380 11:97992244-97992266 AATATTCTTAAATTTCTGTTGGG - Intergenic
1087771572 11:102215935-102215957 AACAATATGATATGTCTTTGTGG + Intronic
1088299517 11:108341393-108341415 AATATTATGAAATGTTTATTAGG + Intronic
1088349228 11:108865932-108865954 AAAATAATAAAATGTCTATTTGG + Intronic
1088373529 11:109116751-109116773 AACATTATGAGATTTTTGTATGG - Intergenic
1089379685 11:118019163-118019185 AACTTTATGAAAATTATGTTAGG + Intergenic
1090035705 11:123247766-123247788 AACATAACAAAATATCTGTTTGG - Intergenic
1091639784 12:2227318-2227340 AACAGAATGAAGTGTCTGTCTGG - Intronic
1092712013 12:11348892-11348914 AAAAGTATGAAATGAATGTTTGG - Intergenic
1094465484 12:30749701-30749723 AAAATTATGAAGTGTCGGATAGG + Intronic
1094697809 12:32838924-32838946 AACATTATGAACTTTATCTTTGG + Intronic
1095265926 12:40157699-40157721 CACATTGTGTAATGTCTGTATGG + Intergenic
1095421641 12:42030506-42030528 AACATTATGAAATTTATGCATGG + Intergenic
1097441158 12:59610368-59610390 AACCTTATAAATTGTATGTTGGG + Intronic
1097918933 12:65050664-65050686 AACAGTATAAAATGTTTATTAGG + Exonic
1100659660 12:96683048-96683070 GGCATCATAAAATGTCTGTTAGG - Intronic
1100972632 12:100087183-100087205 GAAATTATTAAAAGTCTGTTAGG + Intronic
1101027665 12:100628522-100628544 AACATTATTAAATGTGAGTCTGG - Intergenic
1104089826 12:125507016-125507038 AGCATGAGGAAATTTCTGTTTGG - Intronic
1106696579 13:32180666-32180688 AACATTGTAAAATGTTAGTTTGG + Intronic
1106814888 13:33396776-33396798 AAATTTATGAGATATCTGTTTGG + Intergenic
1107040204 13:35940000-35940022 AACAATATTAAACGTCTGTATGG + Intronic
1109194443 13:59362447-59362469 AACGATAAGAAATTTCTGTTTGG - Intergenic
1109237582 13:59843566-59843588 CTCTTTATGAAATGTCTGTGAGG - Intronic
1109342449 13:61078228-61078250 AACATAATGACATGTCCCTTCGG - Intergenic
1109626091 13:64977012-64977034 AACATTATAAAATGACTCTTTGG - Intergenic
1110651134 13:77942507-77942529 AATATTATGAAAAGTCTGTTTGG - Intergenic
1111063268 13:83052662-83052684 AATATAATGAAATGTCCTTTGGG + Intergenic
1111117483 13:83799090-83799112 GCCATTATGAAATTTCTGTAAGG - Intergenic
1111353336 13:87062814-87062836 AACATTATGAGATTTTTTTTTGG + Intergenic
1111870423 13:93825175-93825197 AACATTATCAAATGTCCTCTTGG - Intronic
1112690815 13:101891763-101891785 AACATTGTTAAATTTCTGATTGG - Intronic
1112796597 13:103063648-103063670 GACATTATGCATTGTGTGTTAGG - Intronic
1114041505 14:18682837-18682859 AACACTATGAAATGTGTTTAAGG + Intergenic
1114850273 14:26374786-26374808 TACAGTATGAAATGTCTGTAAGG - Intergenic
1115283991 14:31697569-31697591 AAAAATATGAAAAGGCTGTTAGG + Intronic
1115593481 14:34886581-34886603 ATCTTTATAAAATGTCAGTTTGG - Intergenic
1115937253 14:38566462-38566484 AACATATTGGAATGTGTGTTTGG + Intergenic
1116347772 14:43817058-43817080 AAAATTATGTAATGAATGTTTGG - Intergenic
1120621480 14:86770549-86770571 ACCATTAGGAAATGTCTGAGTGG + Intergenic
1124183836 15:27503255-27503277 AACATTGTGAAATATATATTTGG - Intronic
1124353344 15:28976556-28976578 AACTTTATGAAATGGTTTTTGGG + Intronic
1124582507 15:30972090-30972112 AAAATGATGAAATGCATGTTTGG - Intronic
1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG + Intronic
1126228452 15:46297795-46297817 AACATTATGAGATTGCTTTTTGG - Intergenic
1126381526 15:48052650-48052672 AACCTAATGAAAGGTATGTTAGG + Intergenic
1127261238 15:57327859-57327881 AACATTCTAAAATCTCTGATAGG - Intergenic
1128439834 15:67695822-67695844 AAAATTATGAAATGTTAGCTTGG + Intronic
1130514214 15:84613601-84613623 AACATTATGAAATCTCGGCCGGG - Intronic
1131791395 15:95969454-95969476 AATATTGTCAAATGTCTCTTGGG + Intergenic
1132068744 15:98755893-98755915 AATTTTATGAAATGCCTTTTTGG + Intronic
1133480198 16:6162647-6162669 AACATTATGAACTTTCTTTGGGG - Intronic
1135095873 16:19564376-19564398 AACATTTTAAAAAATCTGTTTGG - Intronic
1135130365 16:19848891-19848913 ATAATTATGAAATGTTTGCTAGG - Intronic
1135244474 16:20843684-20843706 AATATTATGAAAAGCCTGTTGGG + Intronic
1135263792 16:21004102-21004124 AAAATTATGAAATACCTTTTAGG - Intronic
1136713722 16:32260523-32260545 CACTTTATGAAATGTCCTTTTGG + Intergenic
1136754190 16:32668907-32668929 CACTTTATGAAATGTCCTTTTGG - Intergenic
1136813923 16:33201458-33201480 CACTTTATGAAATGTCCTTTTGG + Intronic
1136820399 16:33311538-33311560 CACTTTATGAAATGTCCTTTTGG + Intergenic
1136826962 16:33368077-33368099 CACTTTATGAAATGTCCTTTTGG + Intergenic
1136832028 16:33466848-33466870 CACTTTATGAAATGTCCTTTTGG + Intergenic
1136997401 16:35200102-35200124 CACTTTATGAAATGTCCTTTTGG - Intergenic
1137010145 16:35313351-35313373 CACTTTATGAAATGTCCTTTTGG - Intergenic
1137789878 16:51166006-51166028 AACATAAGGAAATGTCTATTGGG + Intergenic
1138319157 16:56096496-56096518 ATCATTATGAAATGTTGGTCTGG - Intergenic
1138954337 16:61952699-61952721 AAAATTATGCAATGTTTATTAGG + Intronic
1139822266 16:69729994-69730016 AACATTATGAAAGGGCTTATTGG + Intergenic
1140997024 16:80270940-80270962 AATATTATTAAATATCTTTTTGG - Intergenic
1202992499 16_KI270728v1_random:24432-24454 CACTTTATGAAATGTCCTTTTGG + Intergenic
1203056336 16_KI270728v1_random:929239-929261 CACTTTATGAAATGTCCTTTTGG - Intergenic
1143556219 17:7662588-7662610 AACATTAAGAAATGTGTAATAGG - Intronic
1144538679 17:16116290-16116312 AACATCATGAAATGGCCATTTGG + Intronic
1145107945 17:20135751-20135773 TAGATTATTAAATGTATGTTGGG - Intronic
1147349737 17:39831880-39831902 AACATTAGGTAGTGTATGTTTGG + Intronic
1147476451 17:40716053-40716075 AAAATTATGAAATATCTGATAGG - Intergenic
1149402936 17:56317455-56317477 CCCATTGTGAAATGTTTGTTTGG + Intronic
1149446371 17:56716492-56716514 AACATTATGTCTTGTGTGTTTGG + Intergenic
1150480706 17:65507070-65507092 ATCATTAAGAAATATCTGCTGGG - Intergenic
1151301162 17:73227510-73227532 AACAATTTTAAATGTCTGTTGGG + Intronic
1151676117 17:75598770-75598792 AACATTATGAAATGTGAACTGGG - Intergenic
1151917739 17:77130952-77130974 AACCCTATTAAATATCTGTTGGG - Intronic
1153699254 18:7676052-7676074 AACATTGTGAAATGGATGTATGG + Intronic
1154240012 18:12644725-12644747 AACAATATTAAATATATGTTTGG - Intronic
1155469598 18:26177204-26177226 GACATTGTCAAATGTCTTTTAGG - Intronic
1155480009 18:26275718-26275740 AGAATTATGAAATCTCTGCTGGG + Intronic
1156438697 18:37162111-37162133 AACATTATAAAATGACTATTAGG - Intronic
1159429821 18:68337158-68337180 GACATGATAGAATGTCTGTTTGG - Intergenic
1160038936 18:75326950-75326972 ATCATTTTGAAATGCCTGTGAGG - Intergenic
1160048242 18:75407456-75407478 AACATCAGGAAATGTCTGCATGG + Intronic
1162853948 19:13453961-13453983 GACATTGTGAAATGTATGTTTGG + Intronic
1163954219 19:20620385-20620407 AAAATTATGAAATGAGTGTTTGG - Exonic
1164141689 19:22473486-22473508 AACATCAGGAAATTTATGTTGGG + Intronic
1166637362 19:44462264-44462286 TAGAATATGAAATGTCTTTTTGG - Intergenic
1167779293 19:51587218-51587240 TACACTATGAATTCTCTGTTGGG - Exonic
925028664 2:630737-630759 AAATTAATGAAATGTCTGTTAGG - Intergenic
928491099 2:31784140-31784162 AACTTTATTAAATATCTATTGGG - Intergenic
929295930 2:40246636-40246658 TTCCTTATGAAAGGTCTGTTTGG - Intronic
929326831 2:40623725-40623747 AACATTATAAAAAGTCTGGATGG - Intergenic
930332114 2:49998041-49998063 AACATCATGGCATTTCTGTTGGG - Intronic
932541457 2:72658368-72658390 AACATTAAGAAAAGTATTTTTGG - Intronic
933293752 2:80467089-80467111 AACATAAAGAAATGTCTTTCAGG + Intronic
933369908 2:81401373-81401395 AACTTTATGAAATCACTATTAGG + Intergenic
934865435 2:97805804-97805826 AACATTCTAAGATGTCTTTTGGG - Intronic
935345992 2:102108908-102108930 ACCATTACTAAATGTCAGTTTGG - Intronic
935689058 2:105714067-105714089 AATATTAAGAAATGTGTCTTGGG + Intergenic
937613130 2:123887714-123887736 AACTTTATGAAATGCTTTTTTGG + Intergenic
937663965 2:124463276-124463298 AAAATTATAAAATATATGTTAGG + Intronic
938543662 2:132307338-132307360 TAGAATATGAAATGTCTTTTTGG - Intergenic
939002197 2:136749116-136749138 GACATTACTAAATGTCTTTTGGG + Intergenic
939768312 2:146281847-146281869 AACAATATGAAAGTTCAGTTAGG - Intergenic
940248727 2:151649262-151649284 AGCATTATAAAAAGTCTGTGAGG + Intronic
940273604 2:151916787-151916809 GACATTGTGAAATGTCCCTTGGG - Intronic
940670038 2:156656420-156656442 AACATTATAAAACGTGTTTTTGG + Intergenic
941150303 2:161906499-161906521 AACAGTCTGAAATGTCTCTAAGG + Intronic
941553271 2:166942407-166942429 AACATTAGGCAATGTATTTTGGG - Intronic
943026214 2:182632175-182632197 AATCTGATGAAATGTATGTTTGG - Intergenic
943822654 2:192346542-192346564 AACATTATTAAGTGCCTTTTTGG - Intergenic
943994722 2:194747090-194747112 AAAATTATTAAATGTTTGTGAGG + Intergenic
944435654 2:199686497-199686519 TAGCTTATCAAATGTCTGTTTGG - Intergenic
946646473 2:221841675-221841697 AATTTTTTGAAATGTCTTTTAGG + Intergenic
947368375 2:229419843-229419865 AACATTTTCAAATGTCCTTTGGG - Intronic
1169629483 20:7612416-7612438 AACATTATGCAAAGTCAGATGGG + Intergenic
1170180496 20:13524470-13524492 AAAATTAAGAAATGTATGTGTGG - Intronic
1170240632 20:14162358-14162380 AATGTTTTGAAATATCTGTTAGG + Intronic
1170265175 20:14458850-14458872 AGCATTCTGAAATGGCTATTTGG + Intronic
1170618933 20:17978047-17978069 AACATTATGAGATTTTTTTTTGG + Intronic
1171872527 20:30540064-30540086 TAGAATATGAAATGTCTTTTTGG - Intergenic
1173000293 20:39100853-39100875 AAAATTATGTGATGTCTTTTTGG - Intergenic
1173380661 20:42537111-42537133 AATATTATCAAATGTCACTTAGG + Intronic
1173757160 20:45526668-45526690 AACATTATGTCTTGTCTATTTGG + Intergenic
1174079560 20:47961371-47961393 AACATTATGATATGACTACTTGG - Intergenic
1174607806 20:51773637-51773659 CACATCATGAAATGTCTCCTGGG + Intergenic
1174909981 20:54597256-54597278 GACATTATCAAATGTCCCTTAGG - Intronic
1177702234 21:24653992-24654014 GAAATTATGGAAAGTCTGTTTGG + Intergenic
1177714585 21:24822659-24822681 AACATAATCAAATGTCTCCTGGG - Intergenic
1177772003 21:25527262-25527284 GAGATTATGTAATGTCTGCTAGG - Intergenic
1177968155 21:27755483-27755505 ATGTTTTTGAAATGTCTGTTAGG + Intergenic
1178118249 21:29439713-29439735 AAAACTATCAAATCTCTGTTTGG + Intronic
1178459231 21:32786924-32786946 AACATTATGAGATTTGTCTTGGG + Intergenic
1180286808 22:10753738-10753760 TACAGTATGAAATCTCTCTTTGG + Intergenic
1181261311 22:21599980-21600002 AACATTATGAAATGAAAGATTGG + Intronic
1184304252 22:43584698-43584720 AACATTTAGAAATGTTTATTGGG - Intronic
949104192 3:183621-183643 GCCTTCATGAAATGTCTGTTTGG + Intergenic
949959526 3:9300699-9300721 AACATCATGAAATATCTCCTGGG - Intronic
951155363 3:19346458-19346480 GACATTATGAGATGCCTGTGTGG + Intronic
952350881 3:32536249-32536271 AACATAATGAAATGATTATTAGG - Intronic
952547645 3:34438005-34438027 AATCTCATGCAATGTCTGTTTGG - Intergenic
953428382 3:42815445-42815467 CACATTATGAATAGCCTGTTAGG - Intronic
954922726 3:54205530-54205552 AAAATTATGATAACTCTGTTGGG + Intronic
954956505 3:54525300-54525322 AATATTATGCAATGTATGGTTGG - Intronic
955013454 3:55044133-55044155 AATATTTTGAAAAGTCTGCTGGG + Intronic
956422421 3:69098737-69098759 TACATAATGCATTGTCTGTTAGG - Intronic
956450490 3:69370260-69370282 AACGGTCTGAAATGTCTGTCAGG + Intronic
956485820 3:69721151-69721173 GATATTGTGAAATGTATGTTTGG + Intergenic
956830234 3:73039599-73039621 AACATTATCAAATGTTCCTTGGG - Intronic
957284171 3:78196025-78196047 AAAATAATAAAATGCCTGTTTGG + Intergenic
957430717 3:80102245-80102267 GAATTTATGAAATTTCTGTTTGG + Intergenic
957790116 3:84929800-84929822 GACATTCGGAAATTTCTGTTAGG + Intergenic
958061590 3:88489841-88489863 AAAAGTATGAAACGTTTGTTTGG - Intergenic
959461494 3:106631290-106631312 AAGATTATGCTATGTCTTTTAGG - Intergenic
960501123 3:118439609-118439631 CACATAATGAAATATTTGTTTGG - Intergenic
963834550 3:150043700-150043722 AACAATATGAAATTTCTTTCTGG - Intronic
963834555 3:150043761-150043783 AAAAATATGAAATTTCTTTTTGG + Intronic
964524014 3:157597548-157597570 AACAGTATGAAAAATCTGTGAGG - Intronic
964743774 3:159992463-159992485 AAAATTATGAAATGTATCTTAGG - Intronic
966540990 3:181089608-181089630 AACATGATAACATTTCTGTTAGG + Intergenic
966584990 3:181613381-181613403 AACATTATGACATGTTTACTGGG - Intergenic
967523173 3:190459642-190459664 AACATTTTCAAATGTCAATTTGG - Intergenic
967756445 3:193175418-193175440 AACATTCTGAAGTGACTCTTAGG + Intergenic
968717402 4:2170875-2170897 AGCATGTTGTAATGTCTGTTTGG - Intronic
970141064 4:12982795-12982817 AACAATTTGAAATCTCTCTTGGG + Intergenic
971469191 4:27001664-27001686 AAAATTGTCAAATGTCTGCTAGG + Intronic
971714761 4:30161115-30161137 AATACTATTAAATGTCAGTTTGG + Intergenic
972662188 4:41127243-41127265 ACCATAATGAAAAGTCTTTTGGG + Intronic
972925261 4:43997936-43997958 AACTTAATGAAAAATCTGTTTGG - Intergenic
972996605 4:44886545-44886567 GACATTGTGAAATGTCCCTTGGG + Intergenic
974115427 4:57573329-57573351 AACATTGTCAAATGTCCGGTTGG - Intergenic
974287680 4:59890995-59891017 AAAATTGTGAAATGTTTCTTGGG - Intergenic
974517802 4:62939428-62939450 AACATTTATAAATGTTTGTTGGG - Intergenic
975449211 4:74504912-74504934 ATCATTATGTATTGTATGTTTGG + Intergenic
975618156 4:76268123-76268145 TACATTTTGAAATGACTGCTTGG + Intronic
975914019 4:79301187-79301209 AATAATATGAAATGTTTATTCGG - Intronic
978027228 4:103892094-103892116 CACATTAAAAAATGTCTGATGGG + Intergenic
978133371 4:105226858-105226880 AACCTTTTGAAAGGTATGTTAGG - Intronic
978944587 4:114480308-114480330 AAGATTCTGAAGTGTCAGTTGGG + Intergenic
978962179 4:114693826-114693848 AAAATTATGATATTTCTGATAGG - Intergenic
979303048 4:119109195-119109217 GACATTGTCAAATGTCCGTTGGG + Intergenic
979358735 4:119736051-119736073 AACATTTTGTGGTGTCTGTTGGG + Intergenic
979393453 4:120156124-120156146 AACTTAATGAAAAGTCTTTTAGG - Intergenic
979500192 4:121431270-121431292 GAAATGATGAAATGTCTTTTGGG - Intergenic
979505433 4:121490380-121490402 AAAAATATGAAATGTATGTGGGG + Intergenic
979724914 4:123949406-123949428 ATTATTCTGAAATATCTGTTCGG - Intergenic
979752920 4:124301877-124301899 AAAATTATGAAGTGGATGTTTGG + Intergenic
979759264 4:124380310-124380332 AACATTAAGAAATGCCCTTTAGG + Intergenic
979942964 4:126785661-126785683 AACATTATGAAATTTATGCATGG - Intergenic
980487166 4:133473657-133473679 GAAATAAAGAAATGTCTGTTTGG - Intergenic
981117337 4:141007020-141007042 AAAATTTTGAAATGCCTTTTAGG - Intronic
982568566 4:157019241-157019263 AACATTCTGAAATGACTATCAGG + Intergenic
982757896 4:159245878-159245900 GAAATTATGAAATGTCAGTTGGG - Intronic
983654160 4:170064598-170064620 AACATTATGAGTTGGCTGGTGGG + Intronic
984968714 4:185166964-185166986 AACATTATGAGATTTTTTTTTGG + Intronic
987337670 5:16911435-16911457 AACATTATGAGATTTCTGCTGGG + Intronic
987518677 5:18949498-18949520 AATGTTTTTAAATGTCTGTTAGG - Intergenic
987632461 5:20493046-20493068 AACTTTATGAAATATGTTTTTGG + Intronic
987822921 5:22989453-22989475 AACATTCTGAAATGTAATTTGGG - Intergenic
988105874 5:26746435-26746457 AATATTTTGAAACATCTGTTTGG - Intergenic
988295003 5:29346065-29346087 TATATTATGAATTCTCTGTTTGG - Intergenic
988882964 5:35523742-35523764 AACATCATCAAATGCCTTTTTGG + Intergenic
989761821 5:45024484-45024506 GATATTGTGAAATGTCTGTTTGG - Intergenic
990087956 5:52002265-52002287 AATATTATGAAATCTGTTTTAGG + Intergenic
990249932 5:53903341-53903363 AACATTATCAAATGTCCCGTGGG - Intronic
990786228 5:59423611-59423633 AAAATTATGAAAGGTCTTCTAGG + Intronic
992096988 5:73372088-73372110 AACAAAATGAAATGTCTATTTGG - Intergenic
992806335 5:80341754-80341776 AACATGGAGAAATATCTGTTGGG + Intergenic
993896587 5:93542499-93542521 AACATTATCAAATGTCCCCTAGG + Intergenic
993968115 5:94382995-94383017 TACAATATTAAATGTCTGTCTGG - Intronic
994340382 5:98619946-98619968 AAAATTGTGAAATGCTTGTTGGG - Intergenic
994680932 5:102887051-102887073 GACATTAAGAAATATTTGTTAGG + Intronic
995079675 5:108034995-108035017 AAAATTATGTAATGTTTATTGGG - Intronic
996638578 5:125725583-125725605 TACATTTTAAAATGTCTGCTGGG - Intergenic
997011815 5:129887464-129887486 AATATTAGGAAATGTTTCTTGGG + Intergenic
997703245 5:135920951-135920973 AACACTATGAAATTTTTTTTTGG + Intergenic
998843544 5:146281581-146281603 AAGTTTATGAAATTTGTGTTGGG + Intronic
1000742918 5:164992808-164992830 GACTTTATGGAATGTCTTTTGGG - Intergenic
1000864538 5:166496386-166496408 ATCATTATGAAATGTAGGATAGG - Intergenic
1001630227 5:173169427-173169449 AAAATTATGAAATTTCTGCCAGG - Intergenic
1001689105 5:173619151-173619173 AACATTCGGAAATGGCTGTGCGG + Intergenic
1001977605 5:176013133-176013155 AGCACTCTGAAATGCCTGTTTGG - Intronic
1002239816 5:177830633-177830655 AGCACTCTGAAATGCCTGTTTGG + Intergenic
1004324466 6:14662223-14662245 AACATGAGGAAACTTCTGTTAGG + Intergenic
1005742093 6:28801644-28801666 AAGAACATGAAATGTTTGTTTGG + Intergenic
1006142082 6:31935770-31935792 GACACTAGGAAATGGCTGTTAGG - Intronic
1006291541 6:33141598-33141620 AACATGATGAGATTTGTGTTTGG + Intergenic
1006707360 6:36032371-36032393 AACTTTATGCATTGTCTGTGAGG + Intronic
1009344568 6:62597246-62597268 AACATTTTAAAATTTCTGTGTGG + Intergenic
1009599971 6:65786455-65786477 AACATGAAGAAAGCTCTGTTTGG - Intergenic
1010738765 6:79473475-79473497 GATATTAAGAAAAGTCTGTTGGG - Intergenic
1011667586 6:89649884-89649906 AACATTTTGAAATACCTGTTAGG - Intronic
1011848748 6:91600333-91600355 AATATTATGAAATATGTGTTTGG + Intergenic
1012114271 6:95275261-95275283 AATATTATGAAATGTATTTGGGG + Intergenic
1012212472 6:96538390-96538412 AACAATTGGAGATGTCTGTTAGG + Intronic
1013438768 6:110139951-110139973 AATATTATGAAATATTTATTTGG + Intronic
1014436118 6:121422584-121422606 ACTATTATTAAATATCTGTTGGG - Intergenic
1014880750 6:126721491-126721513 AACATTCTGGAATGTATTTTTGG - Intergenic
1015119950 6:129690059-129690081 AACATTATAAACGGACTGTTTGG - Intronic
1015355029 6:132267790-132267812 AACATTTTTATATATCTGTTGGG - Intergenic
1015572524 6:134636203-134636225 AAGATTCTGAACTGGCTGTTGGG - Intergenic
1015684422 6:135843706-135843728 ATCATTATGGAATGACTTTTTGG + Intergenic
1015896387 6:138020954-138020976 AAAAATATGAAATGGCTGTGTGG - Intergenic
1016116564 6:140292517-140292539 AATGTTCTGTAATGTCTGTTAGG - Intergenic
1017471399 6:154740357-154740379 GACATTATTAAATGTTTCTTTGG + Intronic
1017474658 6:154777544-154777566 AACATTAATAAATGTATGTAAGG - Intronic
1017943651 6:159076047-159076069 AAAATTAAGCAATTTCTGTTTGG + Intergenic
1019297715 7:287447-287469 AACATAATGAAATGTATCTGGGG - Intergenic
1020647045 7:10827078-10827100 AAGATAATGAAATGTGTTTTTGG + Intergenic
1021001352 7:15334962-15334984 ACCAAAATTAAATGTCTGTTTGG + Intronic
1021279606 7:18701333-18701355 AGAATTTTGAAATGTCTTTTTGG - Intronic
1021468651 7:20975462-20975484 AACATACTGAAATATCTCTTAGG + Intergenic
1021517857 7:21506968-21506990 AACATTTGGAAATTTTTGTTTGG + Intronic
1021722082 7:23514322-23514344 AACATTCTTAAATATCTGCTAGG - Intronic
1022020196 7:26392273-26392295 AATATTATGAAATGATTGTCAGG - Intergenic
1022434379 7:30366439-30366461 AACATTATGAACATTATGTTGGG - Exonic
1023036234 7:36134004-36134026 TACATTCTGAAAAGCCTGTTTGG + Intergenic
1023116481 7:36867724-36867746 AACATTTTGTAATTTCTCTTGGG + Intronic
1023284730 7:38607383-38607405 AACATAGTTAAATGTCTATTTGG + Intronic
1024054232 7:45649425-45649447 CACATTTTGAGATGTTTGTTTGG - Intronic
1024676471 7:51642078-51642100 AACAGTGTGAAATCTCTGCTGGG + Intergenic
1024950248 7:54853493-54853515 AGCATTCTGAGATGTCTATTAGG + Intergenic
1025783050 7:64618820-64618842 CACATTTTTAAATGGCTGTTTGG - Intergenic
1027455334 7:78384212-78384234 TACATTATGAAAGCTATGTTAGG - Intronic
1027970778 7:85078411-85078433 AACTTTGTGTAATGTCTGTGTGG + Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028877505 7:95840510-95840532 AACATTTTGAATTCTCTGTTGGG + Intronic
1029036722 7:97529865-97529887 GATATTATAAAATGTATGTTTGG - Intergenic
1030405580 7:109108130-109108152 GACATTGTTAAATGTCTCTTGGG + Intergenic
1030704269 7:112674944-112674966 GACATTATCAAATGTCCCTTGGG - Intergenic
1031221383 7:118970440-118970462 AACATAATGACCTGTCTGATCGG + Intergenic
1031395577 7:121269755-121269777 AACATTTTTTCATGTCTGTTGGG + Intronic
1031813046 7:126396271-126396293 AACATTGTGAAATGTTTCATTGG + Intergenic
1032869217 7:135964042-135964064 AACATTATAATATGTCAATTTGG + Intronic
1033570643 7:142625265-142625287 AATATTATGATATGTCTGGGAGG - Intergenic
1034587690 7:152110080-152110102 AACATTATGAAATGTCTGTTGGG + Intronic
1038276897 8:26128776-26128798 AACATTATGAATGAACTGTTTGG + Intergenic
1038517809 8:28202149-28202171 TACATTTTGATATGACTGTTTGG - Intergenic
1039396517 8:37230032-37230054 TACATTATGATTTGTGTGTTTGG - Intergenic
1039713383 8:40082282-40082304 AACATTCTAAAATGTCTGAGAGG + Intergenic
1039785156 8:40828223-40828245 AACATTTTGAAATGTCTAATGGG + Intronic
1039982701 8:42421824-42421846 AATATCATCAAATGTCTTTTTGG + Intronic
1043127536 8:76418495-76418517 AACATTATCAAATGCCTATGTGG - Intergenic
1043490799 8:80747288-80747310 AAAATTATTAAATGTTTGGTGGG - Intronic
1043752300 8:83953100-83953122 AACATTTTGACAGGTTTGTTAGG + Intergenic
1047050437 8:121105629-121105651 CACATGATGAAAGCTCTGTTAGG + Intergenic
1047094879 8:121614226-121614248 AACAATTAGAACTGTCTGTTTGG + Exonic
1047267480 8:123320286-123320308 AACCTTAAGAAATGTATTTTTGG + Exonic
1048640593 8:136354760-136354782 AACCTTAAAATATGTCTGTTTGG - Intergenic
1048735947 8:137501586-137501608 AACTATTTGAAATCTCTGTTGGG - Intergenic
1050726404 9:8654126-8654148 AACATTATCAAATGTCTCCTGGG + Intronic
1050745885 9:8875473-8875495 AACATTAGGAATTCTTTGTTTGG + Intronic
1050876706 9:10648075-10648097 TGCATTATGAAATGTTTGATAGG + Intergenic
1052300125 9:26944631-26944653 AAGTTTATGAAATTTGTGTTGGG + Intronic
1052882955 9:33616383-33616405 AATATTATGATATGTCTGGGAGG - Intergenic
1053728817 9:41031557-41031579 AACTTTTTGAAATATCTGTTGGG + Intergenic
1054699693 9:68400526-68400548 AACTTTTTGAAATATCTGTTGGG - Intronic
1055683718 9:78745959-78745981 AACATTTTGAAATCTATGTTAGG + Intergenic
1056373275 9:85980506-85980528 GACATTATGAAATATATATTTGG - Intronic
1057329236 9:94097102-94097124 AACTTTATTAAATGTCTATGTGG - Intronic
1058186795 9:101864515-101864537 AACAATATGAATAGTCTCTTTGG - Intergenic
1058226841 9:102375150-102375172 AACATTATCTAATGTATGTATGG + Intergenic
1058438376 9:104985285-104985307 AAAATTATGGAATATCTGTTGGG + Intergenic
1058554966 9:106157409-106157431 TACTTTATGAAATATCTGCTTGG + Intergenic
1058938108 9:109787938-109787960 AACATTATGAAATATCTCAGGGG - Intronic
1185930749 X:4200914-4200936 TACATTTGGAAATGTCTCTTGGG - Intergenic
1186091853 X:6057168-6057190 AACATTATGAAACTCCTTTTTGG - Intronic
1186396127 X:9210988-9211010 CACAATATGATTTGTCTGTTTGG + Intergenic
1186756497 X:12677216-12677238 AACATTACCAAATGTCCCTTGGG + Intronic
1187375162 X:18745797-18745819 AATTTTATGAAATGTCATTTTGG + Intronic
1188569553 X:31566380-31566402 AACTTTATCAAAAATCTGTTGGG + Intronic
1190419086 X:50209966-50209988 AAAATTTTTAAATTTCTGTTTGG - Intronic
1190781008 X:53594763-53594785 AACATTTTGAATTTTCTGATAGG - Intronic
1191833254 X:65437507-65437529 CACATTTTCATATGTCTGTTTGG + Intronic
1193836012 X:86344812-86344834 AAAGTTGTGAAATGTATGTTTGG - Intronic
1194994167 X:100574969-100574991 AACATTCGGAAATGTTTGTTTGG + Intergenic
1197337652 X:125227335-125227357 AATATTATGAATAGTCTGTGTGG + Intergenic
1197472369 X:126879164-126879186 GACATTATCAAATATCTCTTGGG - Intergenic
1198797542 X:140414856-140414878 AACATTATGTACTGTCATTTTGG - Intergenic
1200773351 Y:7147610-7147632 AACAATATAAAATTTCAGTTAGG + Intergenic
1202240415 Y:22761421-22761443 AACATCATAAAATTTCTGATAGG - Intergenic
1202393401 Y:24395175-24395197 AACATCATAAAATTTCTGATAGG - Intergenic
1202477384 Y:25274925-25274947 AACATCATAAAATTTCTGATAGG + Intergenic