ID: 1034588508

View in Genome Browser
Species Human (GRCh38)
Location 7:152118096-152118118
Sequence TAGGGTAGAGAGAAGAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1165
Summary {0: 1, 1: 0, 2: 7, 3: 114, 4: 1043}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034588508_1034588513 7 Left 1034588508 7:152118096-152118118 CCCTTCCTCTTCTCTCTACCCTA 0: 1
1: 0
2: 7
3: 114
4: 1043
Right 1034588513 7:152118126-152118148 ACAAAAACAAACCCAGTATCAGG 0: 1
1: 0
2: 3
3: 43
4: 477
1034588508_1034588516 22 Left 1034588508 7:152118096-152118118 CCCTTCCTCTTCTCTCTACCCTA 0: 1
1: 0
2: 7
3: 114
4: 1043
Right 1034588516 7:152118141-152118163 GTATCAGGATGTTTAGTGTCAGG 0: 1
1: 0
2: 2
3: 6
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034588508 Original CRISPR TAGGGTAGAGAGAAGAGGAA GGG (reversed) Intronic
900849354 1:5130374-5130396 GAGGGTGGAGACACGAGGAAGGG + Intergenic
901090888 1:6640353-6640375 TAGGCTGGAGAGGACAGGAATGG + Intronic
901108947 1:6780128-6780150 TGGGATGCAGAGAAGAGGAAAGG + Intergenic
901365758 1:8746843-8746865 GAGGGGAGAGAGAAGAGAGATGG + Intronic
901448796 1:9323884-9323906 GAGGGCAGATATAAGAGGAAGGG - Intronic
901536151 1:9884009-9884031 GAGGGCAGGGAGCAGAGGAAGGG + Intronic
902158516 1:14509831-14509853 TTGGATAGAGAGATCAGGAAAGG + Intergenic
902701964 1:18178746-18178768 TGGGGTAGGGGGAAGGGGAAGGG - Intronic
903430046 1:23289652-23289674 TAGGGTAGAGAGAAGATGAGGGG + Intergenic
903782787 1:25832736-25832758 TAGGAAAGAGAGAGGAGGAGGGG + Exonic
903828903 1:26163303-26163325 AAGAGCAGAGAGAAAAGGAACGG - Intergenic
903949066 1:26983745-26983767 TAGGGTACAGAGAAGATTCAAGG + Intergenic
903991623 1:27274886-27274908 CATGGTAGAGAGAAGAAGAAAGG + Intronic
904785966 1:32983261-32983283 AAGGGCAGAGAGAAGGGCAAGGG + Intergenic
905036300 1:34920122-34920144 AGGAGTAGAGAGAAGGGGAATGG - Intronic
905092018 1:35437305-35437327 AAGGGAAGAGAGGAGAGAAAGGG - Intronic
905357665 1:37396088-37396110 AAAGGAAGAGAAAAGAGGAAAGG - Intergenic
905447031 1:38034243-38034265 TGGGGGAGACAGAATAGGAATGG + Intergenic
905806424 1:40880832-40880854 GAGGGCAGAGAGCAGATGAAGGG + Intergenic
906122462 1:43403570-43403592 TAGGATGGAAAGAAAAGGAAAGG - Intronic
906488944 1:46252627-46252649 TAGGGAACACAGAAGAAGAATGG + Intronic
906495230 1:46301012-46301034 TAGGGGAGGGAGAAGGGGAAAGG + Intronic
906502631 1:46352589-46352611 AAGGGGAGAGAGGACAGGAAAGG + Intronic
907114607 1:51958024-51958046 AAGGTAAGAGAGAAGAGAAAGGG - Intronic
907569387 1:55468805-55468827 GGGGGTAGAGAGAAGAAGGAAGG + Intergenic
907809250 1:57852076-57852098 CAGGGGAGAAAGAAGAGGAAGGG - Intronic
908181568 1:61611299-61611321 TGGGGAGGAGAGAAGAGGAGAGG + Intergenic
908195283 1:61742050-61742072 GAGGGATGAGAGAACAGGAAAGG + Intergenic
908320411 1:62972948-62972970 TAGGGGAGAGGGAGAAGGAAGGG - Intergenic
908859563 1:68468179-68468201 TATGGGAGAGAGAAGAGAAGAGG + Intergenic
909177225 1:72376667-72376689 GAGGTGAGAGAGAAGAGGACAGG - Intergenic
909895333 1:81061843-81061865 AAGAGTAGGGAGAAAAGGAAAGG - Intergenic
910022657 1:82611085-82611107 TAAGGTAGAGAGAAGAGGGAAGG - Intergenic
911177023 1:94827074-94827096 CAGGGAAGTGAGAAGTGGAAAGG - Intronic
911254336 1:95616944-95616966 AAGGGTCCAGAGCAGAGGAATGG - Intergenic
911620876 1:100065560-100065582 AAGGGAAAAGAGAAAAGGAAAGG - Intronic
911654066 1:100423188-100423210 TAGGACTGAGAGAAGAGGACAGG - Intronic
912100845 1:106202242-106202264 TTGGAAAGAGAGAAGAAGAAGGG + Intergenic
913084695 1:115426007-115426029 TTGGCTAGAGGGAAGAGCAAAGG - Intergenic
913123603 1:115765086-115765108 GAGAGTAGAGGAAAGAGGAAGGG - Intronic
913405311 1:118484446-118484468 TATGTTAAAGAGAAGAGGCAAGG + Intergenic
914373194 1:147049639-147049661 TGGGGTATAGAGATAAGGAAAGG + Intergenic
914761729 1:150604537-150604559 TGGGGCAGAATGAAGAGGAAGGG + Intronic
914912700 1:151800395-151800417 CAGGCTACAGAGAAGAGGATGGG - Exonic
915462515 1:156078611-156078633 AAGGCTAGAGAGAAAAGTAAGGG + Intronic
915682382 1:157594162-157594184 AAGGTTAGAGAGAAGAGCATTGG - Intronic
915778598 1:158520184-158520206 TAGAGTATAGAGAAGACAAAGGG + Intergenic
915837339 1:159188293-159188315 GAGGGGAGGGAGAAGAGGAGGGG - Intronic
916008010 1:160679509-160679531 TGGGGTAGAGAAACAAGGAAAGG - Intronic
916042739 1:160975172-160975194 TATGGTGGAGAGAAGAGAAATGG + Intergenic
916078050 1:161214543-161214565 TGGGGAATAGAGAAGTGGAAAGG - Intergenic
916206506 1:162320474-162320496 TTGAGAAAAGAGAAGAGGAAGGG + Intronic
916927596 1:169539742-169539764 AAGAGAAGAGAGAGGAGGAAAGG - Intronic
917027134 1:170656691-170656713 TAAGGTAAAGAGTGGAGGAAGGG + Intergenic
917143589 1:171863392-171863414 TAGGGTAGGAAGCAGAGGGAGGG + Intronic
917496044 1:175540971-175540993 TAGAGTACAGAGAGGAGGCAGGG - Intronic
917538802 1:175893978-175894000 AGGGGAAGGGAGAAGAGGAAGGG - Intergenic
917576080 1:176323046-176323068 TAGGGTGGAGAGAGGAGCATTGG + Intergenic
917592441 1:176490394-176490416 TAGGGCTGGGAGAACAGGAAAGG + Intronic
917655600 1:177122520-177122542 TAGGGAAGAGAGAAAAGGGAGGG - Intronic
917944212 1:179952946-179952968 TAGGGTAAACACAAGAGTAACGG + Intergenic
918039787 1:180907073-180907095 TGGGGAAGAGAAAAGAGGGAAGG + Intergenic
918102165 1:181385835-181385857 GAAGGTAAAGAGAGGAGGAAAGG - Intergenic
918190975 1:182174319-182174341 AAGGGAAGGGAGAACAGGAAAGG + Intergenic
918217727 1:182407590-182407612 TAGGGTAGCCAGAAGATGAATGG - Intergenic
918247023 1:182669566-182669588 CAAGGTGGAGAAAAGAGGAAAGG + Intronic
918302565 1:183217174-183217196 TAGGGCAGGCAGAGGAGGAACGG + Intronic
918331396 1:183464244-183464266 GAGGGAAGAGGGAAGGGGAAGGG + Intergenic
919442123 1:197648787-197648809 TAGGCTATAGGGAAAAGGAAAGG - Intronic
919468244 1:197948214-197948236 TAGGGGATGGAGAAGAGGATTGG + Intergenic
919526448 1:198658632-198658654 CAGGGGTGAGAGGAGAGGAAAGG - Intronic
919931744 1:202225572-202225594 TGGGGTGGAGAGAAGAGAAAGGG + Intronic
920125855 1:203693234-203693256 TAGGGCAGAAAGAATTGGAATGG + Intronic
920318248 1:205095890-205095912 TAGCTAAAAGAGAAGAGGAAGGG + Intronic
920881724 1:209887070-209887092 TGGGGCAGTGGGAAGAGGAATGG - Intergenic
920976757 1:210793178-210793200 TAAGGCAGAGAGAACAGCAAAGG + Intronic
921002276 1:211056029-211056051 GAAGGGAGAGGGAAGAGGAAAGG + Intronic
921137410 1:212273906-212273928 TATGGGACACAGAAGAGGAAAGG - Intergenic
921455083 1:215361416-215361438 TGGGGTGGAGAGAGAAGGAATGG - Intergenic
921588846 1:216980038-216980060 TTGGGTAGAAAGAAAAGAAAGGG - Intronic
922579026 1:226683288-226683310 TAGGGGAGAAAGGAGAGAAAAGG - Intronic
923155611 1:231276648-231276670 TAGGCTCTAGAGAAGAGTAAGGG - Intronic
923791198 1:237112542-237112564 TAGCTTAGAAAGAAGAGGTAGGG - Intronic
924011757 1:239672639-239672661 TAGGGGAGAAAGAATGGGAAAGG + Intronic
924368290 1:243319884-243319906 TAGGGAGGAAAGAAGAGCAAAGG - Intronic
924539879 1:244970695-244970717 GAGGGGAGAGAGAAGAGGGAGGG - Exonic
1063225725 10:4013287-4013309 TAGGGGGTAGAGAAGAGGAGGGG - Intergenic
1063450409 10:6146367-6146389 TGGGGTAGAGAGATGGGGGAGGG + Exonic
1063528123 10:6803302-6803324 TAGGGTAGAGAGAGAAGGCATGG - Intergenic
1064010142 10:11729151-11729173 AAGGGCAGAGGGAAGAGCAAGGG - Intergenic
1064580360 10:16787329-16787351 CAGGGCAGAGTGAGGAGGAAGGG - Intronic
1064641263 10:17417924-17417946 TAGGGGAGGGAGTACAGGAAGGG + Intronic
1064712789 10:18143435-18143457 TAAAGGAGAGAGAAGAGAAAGGG + Intronic
1064805681 10:19128853-19128875 AAGGAGAGAGAGAAGAAGAATGG - Intronic
1064905764 10:20343886-20343908 TAGGTGAGAGAAAAGAGAAAAGG - Intergenic
1064911344 10:20405345-20405367 GAGGGAGGAGAGGAGAGGAAAGG - Intergenic
1064921151 10:20519932-20519954 AAGGGTAGAAAGGAGGGGAAGGG - Intergenic
1065202929 10:23331301-23331323 AAGGGAAGAGGGAAGAGGGAAGG + Intronic
1065266740 10:23984159-23984181 TAGGGTGGAGTGAAGAGCCATGG - Intronic
1065328463 10:24570453-24570475 ATGGGCAGGGAGAAGAGGAAAGG + Intergenic
1065548294 10:26844515-26844537 AAGGGAAGAGGGAAGAGGAGAGG - Intronic
1066109243 10:32181754-32181776 TAGGGAAAGGGGAAGAGGAAGGG - Intergenic
1066465199 10:35643741-35643763 TGGGGGAGAGAGAGAAGGAAAGG - Intergenic
1067056338 10:43054401-43054423 GAGGGTAGTGAGCAGAGGTATGG + Intergenic
1067838538 10:49657003-49657025 CAGGGCAAAGAGAACAGGAAAGG + Intronic
1067907394 10:50307665-50307687 CCGGGTAGGGAGAAGAGGATAGG + Intronic
1068087233 10:52389448-52389470 AAGGGTGGAGAGAAGAAAAAGGG - Intergenic
1068099435 10:52533066-52533088 TGGGGGAGAGGGAAGAAGAAGGG - Intergenic
1068382602 10:56276303-56276325 TGGGGTAGGGAGAGGAGGGAGGG + Intergenic
1068439264 10:57031006-57031028 AAGGGTAAAGAGAACAGAAATGG + Intergenic
1068742974 10:60495717-60495739 TAGGGTAGAGGAAAGAGAAGAGG + Intronic
1068846425 10:61680868-61680890 CAGGGAAGAAAGAAGGGGAAGGG + Intronic
1069154724 10:65013503-65013525 TAGGGGAGAGAAAAGAAAAATGG + Intergenic
1069383472 10:67863449-67863471 AAGGGAAGGGAGAATAGGAAGGG + Intergenic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1069915277 10:71783302-71783324 GAGGGTGGAGAGAAGAGACAGGG - Intronic
1069917549 10:71796791-71796813 TAGGGTATTGAGAAAAGGATGGG + Intronic
1070312615 10:75284453-75284475 TGGGGAAGAGAGGACAGGAAGGG + Intergenic
1070702459 10:78613543-78613565 TAGGGAAGGGGGAAGAGGAAAGG + Intergenic
1071215266 10:83393682-83393704 AAGAGTAGAGAGAAAAGTAAAGG - Intergenic
1071303362 10:84274600-84274622 TAGGGTTCTGAAAAGAGGAAGGG + Intergenic
1071348962 10:84720294-84720316 GAAGGTAGAAAAAAGAGGAAAGG - Intergenic
1071954630 10:90744302-90744324 TAGGGTAGAAAGATGAGTAAGGG - Intronic
1072402000 10:95112419-95112441 TATGGAAGAGAGAGAAGGAAGGG - Intergenic
1072756170 10:98022615-98022637 GAGGGGAGAGAGAAGAGGGGAGG + Intronic
1072797454 10:98366808-98366830 TAGAGGAGAGAGAAAATGAAGGG + Intergenic
1072848041 10:98854654-98854676 TCTGGTAGAGAGAAAAGAAAAGG + Intronic
1073062900 10:100742824-100742846 AAAGGAAGAAAGAAGAGGAAAGG - Intronic
1073462057 10:103671570-103671592 TGGGCTAGAGAGAAGGGGGAGGG - Intronic
1073611081 10:104943961-104943983 TAGGGTGGAGTGAAGTGGCATGG + Intronic
1073647022 10:105315633-105315655 AAGGGTAGAGAGAACACAAATGG + Intergenic
1073983478 10:109181406-109181428 TAGGCCAGAGAGAGGAGGCATGG + Intergenic
1074251188 10:111749904-111749926 TGGGGTAGGAAGATGAGGAATGG + Intergenic
1074484311 10:113858212-113858234 AAGGGAAGAAAGAAAAGGAAGGG - Intronic
1074917727 10:117973699-117973721 TGGGAGAGAGAGAACAGGAAGGG + Intergenic
1075124826 10:119691360-119691382 TAGGGCAGATTGAAAAGGAATGG + Intergenic
1075173601 10:120138968-120138990 TTGAGGAGAGAGAAAAGGAAAGG - Intergenic
1075223772 10:120606907-120606929 TTTGGGAGAGAGAAGAGGCAAGG + Intergenic
1075284490 10:121171803-121171825 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075284497 10:121171821-121171843 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075284504 10:121171839-121171861 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075312314 10:121424712-121424734 GAGGGTAGAGGGAAGAGGGGAGG + Intergenic
1075602596 10:123781355-123781377 CAGGGCAGAGAGGAGAGGACAGG + Intronic
1075693030 10:124412936-124412958 TAGGGCAGAGACCAGAGGCAGGG + Intronic
1076031905 10:127166412-127166434 CAGGGGAGAGAGAAGATGAGTGG + Intronic
1076516166 10:131045523-131045545 TAGGGGAGAGGGAGGAGGAAAGG + Intergenic
1076617284 10:131763892-131763914 CAGGGTGCAAAGAAGAGGAAAGG + Intergenic
1077159133 11:1104669-1104691 TGGGGTAGAGAGCAGGGGAGAGG + Intergenic
1077216196 11:1396173-1396195 AAGGGAAGAGAGACGAGGAGCGG - Intronic
1077345602 11:2049649-2049671 TAGGGTATAGAGAATAAAAATGG - Intergenic
1077375064 11:2201958-2201980 TGGGGGAGGGAGAGGAGGAAGGG - Intergenic
1077675411 11:4190216-4190238 TAGGGTAGAAATATGAGGAAGGG + Intergenic
1078040317 11:7855694-7855716 GAAGGTAGAGAGCACAGGAAGGG - Intergenic
1078096788 11:8302440-8302462 GAGGGGAGAGAGAAGAAGAAAGG + Intergenic
1078526839 11:12107945-12107967 TCCTGGAGAGAGAAGAGGAATGG - Intronic
1078611134 11:12820418-12820440 TGGGGATGAGAGAAGAAGAAAGG - Intronic
1078664867 11:13316029-13316051 TAAGGTAGAGAAAAGGGCAAAGG - Intronic
1079424512 11:20327371-20327393 TAGAATGGGGAGAAGAGGAAGGG - Intergenic
1079593764 11:22214766-22214788 CAGGGTAGAGAGGAGTGGAGAGG + Intronic
1079605402 11:22359427-22359449 TAGGGTAGAGGTAAGAAGTATGG - Exonic
1080693186 11:34576781-34576803 TAGTGTAAAGAGCAGAGAAATGG + Intergenic
1081073357 11:38638037-38638059 GAGGGGAGAGGGAAGAAGAAAGG - Intergenic
1081207708 11:40293937-40293959 GAGGGGAGAGAGCAGAGGGAGGG - Exonic
1082677937 11:56131582-56131604 GAGGGTGGAGAGTAGAAGAAGGG + Intergenic
1083150503 11:60789041-60789063 TTGGGTAGAGGGGAAAGGAAGGG - Intronic
1083176393 11:60952474-60952496 ACGGGTAGAAAGAAGTGGAAAGG + Intronic
1083731623 11:64655426-64655448 GAGGCTGGACAGAAGAGGAAGGG + Intronic
1083848182 11:65348821-65348843 TAGGCAAGAGGGAAGAGGATGGG - Intronic
1083964654 11:66035975-66035997 AAGGGCATGGAGAAGAGGAAGGG - Intergenic
1084578454 11:70006455-70006477 CAGGGCAGAGAGCAGAGGTAGGG - Intergenic
1084705373 11:70813280-70813302 TAGTGCAGAGAGAAGGGCAAGGG + Intronic
1084888278 11:72224316-72224338 TTGGGTGGAGGGAAGAGGATGGG + Intronic
1084904270 11:72334039-72334061 AATGGGAGAGAGAAGAGGAGGGG + Intronic
1084963817 11:72733037-72733059 GAAGGAAGAGGGAAGAGGAAAGG + Intronic
1085580461 11:77645564-77645586 TTGGGTAGAGGAAAGATGAAGGG + Intergenic
1085587884 11:77728532-77728554 AAGGGGAAAGGGAAGAGGAAAGG + Intronic
1085879404 11:80448214-80448236 AAGGATAGGGAGAAGGGGAATGG - Intergenic
1086097511 11:83065400-83065422 AAGGAAAGAGAGAAAAGGAAAGG + Intronic
1086144148 11:83533148-83533170 AAGGGAGGAGAGAAGAGGAGAGG - Intronic
1086540275 11:87900720-87900742 TAGGGAAGAAGGAAGAGGGAGGG + Intergenic
1086894134 11:92292809-92292831 AAGGGTAGAGTGATGAGGATGGG + Intergenic
1086959794 11:92970058-92970080 TAGGTTAGAGTGAAGGGAAAGGG - Intronic
1087113858 11:94502255-94502277 TAGTGTATGGTGAAGAGGAAAGG - Intergenic
1087412398 11:97808523-97808545 TAGGGCAGTGTCAAGAGGAAAGG + Intergenic
1087461321 11:98452447-98452469 TAGGGAAGAAAGGAAAGGAAAGG - Intergenic
1087479680 11:98683496-98683518 TAGGGCAGAAAGAAATGGAACGG - Intergenic
1087508775 11:99062585-99062607 AAGGGTAGAGTGAAGGGGATAGG + Intronic
1087526050 11:99314695-99314717 TAGGGTAGGGAAAGGAGAAAGGG + Intronic
1087575468 11:99984311-99984333 AAGGGAAGGGAGAAGAGGAAGGG + Intronic
1088022121 11:105132379-105132401 ATTGGGAGAGAGAAGAGGAAGGG - Intergenic
1088230414 11:107668450-107668472 GATGATGGAGAGAAGAGGAAGGG + Intergenic
1088375950 11:109141648-109141670 AAGGGACCAGAGAAGAGGAATGG - Intergenic
1088416490 11:109594941-109594963 TAGTGTAAAGAGAAGATCAAGGG + Intergenic
1088560353 11:111109047-111109069 TAGTGCAGAGAGAAGAGAACAGG + Intergenic
1088885167 11:114000485-114000507 GAGGAGAGAGAGAAGAGGACAGG - Intergenic
1088920106 11:114254507-114254529 TAGGGGAGAGAGCAGAGGTGGGG + Intergenic
1089556025 11:119316436-119316458 TAGGGGACAGAGATGAGGGATGG - Intronic
1089704309 11:120266385-120266407 CAGGGGTAAGAGAAGAGGAAGGG - Intronic
1089744919 11:120609898-120609920 TAGTGGAGAGAGCCGAGGAAAGG - Intronic
1089791335 11:120946720-120946742 TAGTGCAGAGGAAAGAGGAAAGG + Intronic
1089940512 11:122411568-122411590 TGGGAGAGGGAGAAGAGGAAAGG - Intergenic
1089965892 11:122655098-122655120 CAGGGCAGAAAGAAGAGGGAAGG - Intergenic
1089970139 11:122686681-122686703 TAGGGTAGGAAGAAGAGACAGGG - Intronic
1090208082 11:124896706-124896728 TAAGGGAGAGAGAAGAGGCCTGG - Intronic
1090210247 11:124916040-124916062 AAAGGGAGAGAGAAGAGGAGAGG - Intergenic
1090279201 11:125441699-125441721 AGGGGTAGAGAAAAGAGAAAGGG + Intergenic
1090291802 11:125552579-125552601 TAGGGTTGAGCTAGGAGGAAGGG - Intergenic
1090640037 11:128722272-128722294 CAGGGTATGGAGGAGAGGAAGGG + Intronic
1090646523 11:128770962-128770984 CAGGATGGTGAGAAGAGGAAAGG + Intronic
1090966970 11:131607285-131607307 TCCCTTAGAGAGAAGAGGAATGG + Intronic
1091128388 11:133122666-133122688 TGTGCTGGAGAGAAGAGGAAAGG - Intronic
1091192573 11:133707356-133707378 AAGGGGAAAGAGAAGGGGAAAGG + Intergenic
1091234221 11:134009010-134009032 TAGGGTAGTGATCAGAGGCAGGG - Intergenic
1091394044 12:142805-142827 TAGGGGACACAGAAAAGGAAGGG - Intronic
1091446364 12:546137-546159 TCGGGAAGAGGGAAGAGGAGGGG + Intronic
1091524164 12:1280404-1280426 GAGGGTAGAGACAAGAGGAAGGG - Intronic
1091546118 12:1502346-1502368 TAGGGGAGCGAGGAGAGGAGAGG - Intergenic
1091689620 12:2586859-2586881 TTGGATAGAAAGAACAGGAAGGG + Intronic
1092228572 12:6764594-6764616 TGGAGTGGAGGGAAGAGGAAAGG + Intronic
1092318176 12:7441083-7441105 TAGGGTAGTGAGTAGGGGAAAGG + Intronic
1092899666 12:13046279-13046301 TTGGGTGGAGGGAAGAAGAAAGG - Intronic
1092913680 12:13170900-13170922 AAGCGGAGAGGGAAGAGGAAGGG + Intergenic
1093019711 12:14192144-14192166 AAGGGGAAAAAGAAGAGGAAAGG + Intergenic
1093094483 12:14957317-14957339 CAGGGAAGGAAGAAGAGGAAGGG - Intronic
1093219135 12:16398409-16398431 AGGAGTAAAGAGAAGAGGAAGGG - Intronic
1093226333 12:16488348-16488370 GAGGGGAGAGAGATGAGGGAGGG - Intronic
1093341657 12:17982637-17982659 TAGCCTAGAGAGCAGAAGAAAGG + Intergenic
1093573397 12:20695624-20695646 TAGGGAAAAGAAAAGATGAAGGG - Intronic
1093624405 12:21328279-21328301 TATGGGAAAGAGAAGAGAAATGG + Intronic
1093625052 12:21336140-21336162 TAGGAGAGAGAGAAGAGAAAAGG - Intronic
1094021415 12:25918048-25918070 GAGGGCAGAGAGGGGAGGAAAGG + Intergenic
1094083671 12:26565835-26565857 GAGAGTAGAGAGGAGAGGAGAGG + Intronic
1094563668 12:31579808-31579830 GAGAGAAGAGAGAAGAGTAATGG + Intronic
1094808955 12:34119201-34119223 TAGGGTAGAGAATCGAGAAAAGG + Intergenic
1095740118 12:45597635-45597657 TAGGGTAGGTAGAAGTGGGATGG - Intergenic
1095824735 12:46519369-46519391 TAGAGAAGAAAGAAGAGAAAGGG - Intergenic
1096095180 12:48930373-48930395 CATGGGAGAGAGAAGAGTAAGGG + Intronic
1096229876 12:49890875-49890897 TGAGGTAGGGAGAAGGGGAATGG - Intronic
1096739177 12:53679311-53679333 ATTGCTAGAGAGAAGAGGAAGGG + Intergenic
1096865386 12:54559671-54559693 TGGGTAAGAGAGGAGAGGAATGG + Intronic
1097086898 12:56475546-56475568 TAGGATGGGGACAAGAGGAATGG - Exonic
1097263286 12:57731701-57731723 TAGGGAAGATAGATGAAGAAGGG + Intronic
1097341993 12:58449370-58449392 TAGGGAAGGGAGAAGAAAAAGGG + Intergenic
1097544946 12:60986927-60986949 TAGAGTAGTAGGAAGAGGAAGGG - Intergenic
1097995487 12:65883171-65883193 TAGGGGTGAAAGAAGAGGAAAGG + Intronic
1098833377 12:75390939-75390961 GAGGGAGGAGAGAAGAGGGAGGG - Intergenic
1100109563 12:91222862-91222884 TATGGTAGAGAACAAAGGAATGG + Intergenic
1100440973 12:94616670-94616692 TAAGGGGGAGATAAGAGGAAAGG + Intronic
1100444223 12:94646248-94646270 TAGGTTAGAGAGATGGGGGAGGG + Intronic
1100647986 12:96551335-96551357 TTGGGTAGTGAGAAGAGGAGTGG + Intronic
1100718381 12:97329401-97329423 TAGGAGAAAGAGAGGAGGAAGGG + Intergenic
1100779401 12:98008021-98008043 AAGGGGAAAGGGAAGAGGAAGGG + Intergenic
1101043689 12:100783068-100783090 TTGGGTAGATAGAAGAGAGAAGG - Intronic
1101055346 12:100906777-100906799 TGGGGAAGAGGGAAGAAGAATGG + Intronic
1101278543 12:103227178-103227200 TAGAGAAGAGAGTAGAGAAATGG + Intergenic
1101390988 12:104300246-104300268 AAGGGTGAAGAAAAGAGGAAAGG + Intronic
1101714642 12:107300213-107300235 TGGGGTAGGGAGAGGGGGAAGGG - Intergenic
1101792246 12:107938355-107938377 CTGGGTAGAGAGAACAGTAAGGG + Intergenic
1101805948 12:108063822-108063844 TGGGGTTGGGAGAAGAGGGAAGG + Intergenic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1101914186 12:108883675-108883697 GAGGGAAGAGAGAAGACCAAGGG + Intronic
1102779827 12:115554489-115554511 TAGGACAGAGAAAAGAGGATAGG + Intergenic
1102971393 12:117170543-117170565 AAAGGCAGAGAGAAGAGAAAAGG + Intronic
1103799835 12:123531013-123531035 GAGGGGAAAGGGAAGAGGAATGG + Intronic
1103848547 12:123916237-123916259 CAGGGTAGAGAGGAAAGGAAGGG - Intronic
1104390667 12:128388437-128388459 GAGGGAAGAGAGAAGAGACAAGG - Intronic
1104886063 12:132109223-132109245 AAGGGAAGAGAGGAGAGGAGAGG - Intronic
1106035519 13:26041184-26041206 TAAGGTTGAGTGATGAGGAAGGG + Intergenic
1106519188 13:30482256-30482278 AAGGGAAGAGAAAAGAGAAAGGG - Intronic
1106715436 13:32383381-32383403 AAGGTTTGAGAGAAGAGGAAAGG + Intronic
1106754316 13:32807139-32807161 CAGGGAACAGGGAAGAGGAAAGG - Intergenic
1106937148 13:34735583-34735605 TAGGGTGGAGAGAACAGGGGTGG - Intergenic
1107058302 13:36130373-36130395 TCGGTGAGAGAGAAGATGAAAGG - Intronic
1107824293 13:44313606-44313628 TACGGAAGAGAGAGGAGTAAAGG + Intergenic
1107938935 13:45367423-45367445 TAAGGTAGAAAGAGGAGAAATGG + Intergenic
1108233932 13:48381836-48381858 TGGGGTAGGGAGAGGAGGGAGGG - Intronic
1108676286 13:52739918-52739940 CAGGATAGAGTGAGGAGGAAAGG - Intergenic
1108933000 13:55853504-55853526 AAGGTAAGAGAGAAGAGTAAAGG - Intergenic
1109408168 13:61927782-61927804 TAAGGAAATGAGAAGAGGAAAGG + Intergenic
1109476430 13:62885675-62885697 GAGGGTGGAGAGAGGAAGAAGGG - Intergenic
1110055627 13:70967093-70967115 AAGGGGAGAGAGAAAAAGAAAGG - Intergenic
1110151007 13:72253204-72253226 TGGGGTAGTGGTAAGAGGAAGGG - Intergenic
1110338566 13:74362410-74362432 TAGGTTATAAAGGAGAGGAATGG + Intergenic
1110356225 13:74570964-74570986 AAGGGGAGAAAGAAGAGCAAGGG + Intergenic
1110475916 13:75913215-75913237 AGGGGAAGAGAGAAGAAGAAAGG + Intergenic
1110537587 13:76669690-76669712 GAGGGTAGGGGAAAGAGGAAGGG - Intergenic
1110583469 13:77159650-77159672 CAGGAGAGAGAGAAGGGGAAAGG - Intronic
1110605907 13:77432264-77432286 TAGGGTAGACAACAGAAGAATGG - Intergenic
1111247579 13:85560832-85560854 TTAGGTAGGGAGGAGAGGAAGGG - Intergenic
1111340683 13:86881916-86881938 AAGGACAGAGAGAAGAGGCAGGG - Intergenic
1111552769 13:89837332-89837354 TGGAGTAGACAGAAGAGCAAAGG + Intergenic
1111554874 13:89867643-89867665 CAGGGTTGAGAGTAGAAGAAAGG - Intergenic
1111999841 13:95199891-95199913 TAGTGGAGAGAGATGGGGAAGGG - Intronic
1112006804 13:95260478-95260500 TACGGTAGAGAGAAGAAAGAGGG + Intronic
1112622592 13:101067139-101067161 TGAGGAAGAGAGAAGAGGAGAGG + Intronic
1112703922 13:102044313-102044335 TAGGGGAGAAACAATAGGAAAGG - Intronic
1112895511 13:104295040-104295062 TAAAACAGAGAGAAGAGGAAAGG + Intergenic
1113585249 13:111460185-111460207 GAGTGAAGAGAGAAGGGGAAAGG + Intergenic
1113997256 14:16098744-16098766 TAGGGTGGAGTGGAGTGGAATGG - Intergenic
1114404226 14:22440136-22440158 TAGGGTCAAGAGAAGAGTGAAGG - Intergenic
1114517390 14:23308736-23308758 AAGAGTGGAGAGAAGAGGAGAGG - Intronic
1114538995 14:23441002-23441024 GAGGTTGGAGAGAAGAGGAAAGG + Intergenic
1114775164 14:25473436-25473458 GAGGGTCTAAAGAAGAGGAAAGG + Intergenic
1115135034 14:30097689-30097711 GAGGATAGAGAGTAGAGGTATGG + Intronic
1115353685 14:32424644-32424666 GAGGGTAGAGAGTAGGGGGAGGG - Intronic
1116066082 14:39984847-39984869 TAAGGGAGAGGGAAGAGTAAAGG + Intergenic
1116144260 14:41043368-41043390 GAGGGGAGAGAGACAAGGAATGG + Intergenic
1116224954 14:42138528-42138550 TAGGGTGGAGGTAAGTGGAATGG - Intergenic
1116292048 14:43056591-43056613 TAGGGTAGAGAGGAAGGGATGGG - Intergenic
1116312048 14:43340200-43340222 TAGGAGAAAGAGAAGAAGAAAGG + Intergenic
1116797706 14:49409595-49409617 TAGGGTGGTGAGATCAGGAAAGG + Intergenic
1116898584 14:50340507-50340529 AAGGGTAGAGAGAAAGGAAAGGG + Intronic
1117106637 14:52404184-52404206 TAGTGTAGAGCTCAGAGGAAAGG - Intergenic
1118171957 14:63396246-63396268 CAGGGGAGAGGGAAGAGGAGGGG + Intronic
1118375266 14:65171274-65171296 CAGGGTAGAGAGGAGAGTCAGGG - Intergenic
1118394817 14:65327071-65327093 AAAGGAAGAGAGAAGAGAAAAGG + Intergenic
1118462605 14:66000556-66000578 TAGGGAAGAGAAAAGAGGAAAGG + Intronic
1118568196 14:67165701-67165723 GAGGGGAGGGGGAAGAGGAAAGG + Intronic
1118595674 14:67433330-67433352 TGGGACAGAGAGAAGAGAAAAGG + Intergenic
1118739313 14:68727570-68727592 GAGGGCAGAGAGAGGAGAAAAGG - Intronic
1119092710 14:71799670-71799692 AAGGGTAGGGAGAGAAGGAAAGG - Intergenic
1119529644 14:75350780-75350802 TAGGGGAGAGAGAAGGGCAAAGG + Intergenic
1119592952 14:75907411-75907433 TAGGGCAGAACAAAGAGGAAAGG - Intronic
1120669192 14:87344551-87344573 GAGAGAGGAGAGAAGAGGAAAGG - Intergenic
1120798712 14:88665712-88665734 GGGGGAAGAGAGAAGAGGGAAGG + Intronic
1120876726 14:89382142-89382164 TAGGGTAGGCAGACAAGGAAGGG - Intronic
1121151254 14:91637169-91637191 TAGGGGAGAGAAGAGAGGTAGGG + Intronic
1121395164 14:93615371-93615393 GAGGGTGGGGAGAAGAGGGAGGG - Intronic
1121447373 14:93987631-93987653 GAGAGTGGAGGGAAGAGGAAGGG - Intergenic
1121467990 14:94128301-94128323 CTGGGTAGGGAGAAGAGGAAAGG - Intronic
1121602773 14:95218421-95218443 CAGGGGAGAGAGGAGAGGACAGG + Intronic
1121626450 14:95388911-95388933 TGGGGCAGAGAGGAGAGGGAAGG + Intergenic
1121777102 14:96598225-96598247 GAGGGGGGAGAGGAGAGGAAGGG - Intergenic
1122401096 14:101467866-101467888 GAGGATGGAGAGAAGAGGGATGG + Intergenic
1122747970 14:103910930-103910952 TAGTAAAGGGAGAAGAGGAATGG + Intergenic
1122819749 14:104335475-104335497 CGGGGTTGAGAGAAGAGGGAGGG - Intergenic
1123159001 14:106259132-106259154 TAGGGCAGAGGGAGGAGGATTGG + Intergenic
1123539249 15:21271689-21271711 TGGGGGAGAGGGAAGAGGAAGGG - Intergenic
1123974017 15:25535663-25535685 AAGGGTAGAGGGAGCAGGAATGG + Intergenic
1124227846 15:27911036-27911058 TAAGGTAGAAAGATGAGCAAAGG + Intronic
1125180196 15:36873765-36873787 GAGGGTAAAGAGAGGTGGAAAGG + Intergenic
1125201026 15:37100780-37100802 AGGGGGAGAGAGAAGAGGACAGG + Intronic
1125270917 15:37937585-37937607 TAGGCAAGAGGGAAAAGGAATGG + Intronic
1125293380 15:38174785-38174807 TTTGAAAGAGAGAAGAGGAATGG + Intergenic
1125347316 15:38731573-38731595 AAGGGAAGAGGGAAGAGCAATGG + Intergenic
1125423277 15:39525745-39525767 TGGATTAGAGAGAACAGGAAAGG + Intergenic
1125760116 15:42090588-42090610 GAGGTCAGAGAGAAGAGGAGTGG + Intronic
1125760484 15:42092962-42092984 GAGGTCAGAGAGAAGAGGAGTGG + Intronic
1126099282 15:45110163-45110185 TAGGGTGGGGAGAGGAGGGAAGG + Intronic
1126228165 15:46295506-46295528 GAGGTTAGAGAGTTGAGGAAGGG - Intergenic
1126254222 15:46606134-46606156 GAGCGTGGAGAGAAGAGGCAAGG + Intergenic
1126575550 15:50193014-50193036 TAAGGTTGGGAGAAGAGGTAGGG - Intronic
1127015502 15:54681776-54681798 TAGGGTAGAAAGGGAAGGAATGG + Intergenic
1127267570 15:57374255-57374277 AAGGAGAGAGAGAAGGGGAAGGG - Intergenic
1127636203 15:60872522-60872544 TAGGGCAGTGAGAACAGCAAAGG + Intronic
1127757424 15:62106183-62106205 AAAGGGAGAGAGATGAGGAATGG - Intergenic
1127894752 15:63287229-63287251 GAGGGAAGCGGGAAGAGGAAAGG - Intronic
1128111886 15:65081707-65081729 TATGGAAGAGGGAAGAGAAAGGG - Intergenic
1128304178 15:66587096-66587118 AAGGGGAGAAGGAAGAGGAAGGG - Intronic
1128589951 15:68887159-68887181 TAGGGTAAAGAGGAAAGAAAAGG + Intronic
1128632829 15:69282825-69282847 TGGGGTGGAGAGAAGAGGTGGGG - Intergenic
1129573332 15:76714166-76714188 GAGGATAGAGAAAAGAGAAATGG + Intronic
1129899551 15:79136032-79136054 TAGGGAAGAGAAGGGAGGAATGG - Intergenic
1130010481 15:80149523-80149545 TAGGGTGGGGAGAAGGGGATTGG - Intergenic
1130057999 15:80545525-80545547 CAGGGTAGAGAGGAGATGATTGG + Intronic
1130221081 15:82020234-82020256 TATGACAGAGAGAAGAGGAGAGG - Intergenic
1130585204 15:85175274-85175296 GAGGGGAGGGAGAAGAGGAGAGG + Intergenic
1131135406 15:89930963-89930985 CGGGGCAGAGGGAAGAGGAAGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132716419 16:1292441-1292463 GAGGGGAGAGGGGAGAGGAAAGG - Intergenic
1132716449 16:1292551-1292573 GAGGGGAGAGGGGAGAGGAAAGG - Intergenic
1133255218 16:4512425-4512447 TAGGGCAGGGTGAAGAGGACAGG + Exonic
1133873797 16:9714103-9714125 CTGGGTAGAGGGAAGAGGCAGGG - Intergenic
1133981706 16:10637454-10637476 GAGGGGAGAGGGGAGAGGAAGGG + Intronic
1134115577 16:11545410-11545432 AAGGAAGGAGAGAAGAGGAAGGG + Intergenic
1134117560 16:11560685-11560707 AAGGTTATAGAGAAGGGGAAAGG + Intronic
1134264725 16:12683380-12683402 AAGGGACGAGAGAAGGGGAATGG - Intronic
1134388864 16:13800048-13800070 TAGGGTAGTGGGAAGAAGAATGG - Intergenic
1134523576 16:14928986-14929008 AAGGGTAGAGAAAAGAGAAAGGG - Intronic
1134549322 16:15131951-15131973 AAGGGTAGAGAAAAGAGAAAGGG + Intronic
1134563327 16:15229498-15229520 TGGTGGAGAGAGAAGAAGAAGGG + Intergenic
1134594159 16:15482189-15482211 CAGCCTTGAGAGAAGAGGAAAGG + Intronic
1134711170 16:16327471-16327493 AAGGGTAGAGAAAAGAGAAAGGG - Intergenic
1134719022 16:16370773-16370795 AAGGGTAGAGAAAAGAGAAAGGG - Intergenic
1134923854 16:18141126-18141148 TGGTGGAGAGAGAAGAAGAAGGG + Intergenic
1134948404 16:18341112-18341134 AAGGGTAGAGAAAAGAGAAAGGG + Intergenic
1134955659 16:18381222-18381244 AAGGGTAGAGAAAAGAGAAAGGG + Intergenic
1135165320 16:20134010-20134032 TAGGGTAGTGAGTTGGGGAAAGG + Intergenic
1135394733 16:22122535-22122557 AAAGGAAGAGAGAAGAGTAAGGG + Intronic
1135500395 16:22991037-22991059 TAGGAAAGAGAGCAAAGGAATGG - Intergenic
1135525237 16:23209092-23209114 TTGGGTAGAGCAAACAGGAAAGG - Intronic
1135678501 16:24437466-24437488 TTGGGAAGAGAGAGGAGAAAAGG + Intergenic
1135845357 16:25913641-25913663 CAGGGTAGAGAAGAAAGGAAGGG + Intronic
1135868612 16:26128086-26128108 AATGGGACAGAGAAGAGGAAAGG - Intronic
1135879255 16:26238305-26238327 TGGGGCATAGAGAACAGGAAAGG - Intergenic
1135928857 16:26719492-26719514 AAGGGTTGAGAGAAGGGGAAAGG - Intergenic
1135973473 16:27089324-27089346 AAGGGTAGAGAGAAGAAGGTAGG + Intergenic
1136122207 16:28145351-28145373 CAGGGTGGGGAGAAGAGGAGGGG - Intronic
1136220612 16:28825363-28825385 TAGGGGACAGAGCACAGGAAAGG + Exonic
1136475716 16:30511945-30511967 AAGGGTAGGGGGAAGAGAAAGGG + Intronic
1137417901 16:48301873-48301895 AATGGTACAGAGGAGAGGAATGG - Intronic
1137504040 16:49035643-49035665 TGGGGTAGAGGGAAGAGGGATGG - Intergenic
1137531251 16:49280382-49280404 AGGGGTAGAGAGAGGAGGGAGGG - Intronic
1137949922 16:52774028-52774050 TTTGGTAGAGAGAGGAGGGAAGG - Intergenic
1138046918 16:53734814-53734836 CAGGGTAGGAAGAAGAGGATGGG + Intronic
1139136559 16:64211785-64211807 TGGGGTAGTGAGGAGAGAAAAGG + Intergenic
1139424978 16:66873829-66873851 GAGGGAGGAGAGGAGAGGAAGGG - Intergenic
1139471937 16:67183095-67183117 CAGGGTAGAGAGGAGTGGAGAGG - Intronic
1139483696 16:67244805-67244827 TAGGGCAGAAATAAGAGGAAGGG - Intronic
1140327359 16:74017828-74017850 TGGGGTAGAGATATGGGGAAGGG - Intergenic
1140455100 16:75100388-75100410 TAGGGGAAAGGGAAGGGGAAGGG - Intronic
1141155470 16:81593923-81593945 AAGGGTAGAGGGAAGAGGGAAGG - Intronic
1141551851 16:84811550-84811572 TAGGTGAGGGAGAAGGGGAACGG - Intergenic
1141713944 16:85716384-85716406 GAGAGGAGGGAGAAGAGGAAGGG + Intronic
1142529659 17:571258-571280 GAGGGGAGGGAGAAGAGAAAGGG + Intronic
1143272601 17:5686900-5686922 CAGGGTAGAAAGGAGAGGATGGG + Intergenic
1143416871 17:6756754-6756776 GAGGAGAGAGAGCAGAGGAAGGG + Intronic
1143473914 17:7192382-7192404 TAGGATAGAGGGAGGAGGGAGGG + Intronic
1143894536 17:10125868-10125890 GAGGGTAGAGAGGAGTGGAAGGG - Intronic
1143963428 17:10738999-10739021 AGTGGAAGAGAGAAGAGGAAGGG - Intergenic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144414026 17:15029363-15029385 TAGGGAGGGGAGAAGAGTAAAGG - Intergenic
1145121432 17:20263613-20263635 TAGCGTAAAGAAAATAGGAATGG + Intronic
1146374513 17:32285159-32285181 AAGGGGAGAGAGAAGAGGAGGGG + Intronic
1147026297 17:37587526-37587548 GAAGGTAGAGAGAAGAGAAAAGG - Intronic
1147661641 17:42120116-42120138 GTAGCTAGAGAGAAGAGGAAGGG + Exonic
1148085253 17:44990084-44990106 CAGGGAAGAAAGAAAAGGAAGGG - Intergenic
1148241876 17:46004586-46004608 GAAGGGAGAGAAAAGAGGAATGG - Intronic
1148243345 17:46014207-46014229 AGGAGGAGAGAGAAGAGGAAAGG - Intronic
1148374604 17:47131530-47131552 GAGGGGAGGGAGAAGGGGAAAGG + Intronic
1148481768 17:47964409-47964431 GAGAGGAGAGAAAAGAGGAAGGG - Intergenic
1148497275 17:48060349-48060371 AAGGGTAGAGTGAACAGGAAAGG + Exonic
1148650844 17:49249225-49249247 TGGGGTGCAGAGAAGAGGATAGG - Intergenic
1148721215 17:49754636-49754658 TGGGGTAGAGAGGAGAAGAAGGG + Intronic
1148768411 17:50052885-50052907 TAGGGCACAGAGAAGAGGGAAGG + Intergenic
1148780762 17:50120299-50120321 AAGGGAGGAGAGCAGAGGAAGGG + Intronic
1149416915 17:56469245-56469267 GAGGGGAGAGAGAAGAAGTAGGG - Intronic
1149478883 17:56985814-56985836 TAGGAGAGAGAGAAAAGGACTGG - Intronic
1149798944 17:59548496-59548518 TAGGGTGGCAAGGAGAGGAAGGG + Intergenic
1149979327 17:61297107-61297129 TAAGGTAGGGATAGGAGGAATGG + Intronic
1150427284 17:65086721-65086743 GAGGGAAGGGAGAACAGGAAGGG - Intergenic
1150680565 17:67281096-67281118 TGGGGAAGAAAGAGGAGGAAAGG - Intergenic
1150828300 17:68495949-68495971 GAGAGGAGAGAGGAGAGGAAAGG - Intergenic
1151086900 17:71390436-71390458 AGGGGTAGAGAGAAGAAGAGTGG + Intergenic
1151323818 17:73366875-73366897 GAGGGGAGAGAGTAGAGGCAGGG - Intronic
1151350364 17:73528228-73528250 CAGGGGAGAGTGAAGAGGTAGGG + Intronic
1151719363 17:75846691-75846713 TAGGGTAGAGAGATGAGGGTGGG + Exonic
1151872296 17:76844592-76844614 TGGGGAAGAGAGAAGGGGGACGG + Intergenic
1152038597 17:77888998-77889020 AAGGGGAAAGTGAAGAGGAAGGG + Intergenic
1152727018 17:81952418-81952440 GAGGGGAGGGAGAGGAGGAAGGG + Intergenic
1203182114 17_KI270729v1_random:68256-68278 TGGAGTGGAGAGAAGAGGAGTGG - Intergenic
1203214111 17_KI270730v1_random:106637-106659 TGGGGTAGAGTGGAGTGGAATGG + Intergenic
1153890088 18:9505357-9505379 TAGGGTGTGGAGAAGAGGCAGGG - Intronic
1154162465 18:11990402-11990424 GAGGGGAGAGAGAAGAGGAGGGG + Intronic
1154275765 18:12958522-12958544 GGGGGTAGAGGGAGGAGGAAGGG - Intronic
1154940780 18:21111316-21111338 CAAGGGAGGGAGAAGAGGAAAGG + Exonic
1155105593 18:22662332-22662354 TAGGGTAGAGGGAGGAGGGAGGG + Intergenic
1156482799 18:37446688-37446710 AGAGGTAGAGAGAGGAGGAAGGG - Intronic
1156768547 18:40689628-40689650 CAGGGCAGAAAGAGGAGGAAAGG - Intergenic
1156967607 18:43114261-43114283 TAGGGTGAGGAGAAGAGGTAGGG + Intronic
1156992678 18:43428698-43428720 GAATGTATAGAGAAGAGGAAGGG + Intergenic
1157276151 18:46312243-46312265 AAGGCTGGAGAGGAGAGGAAAGG - Intergenic
1157393676 18:47324395-47324417 TATGGTAGAGAGAACAGTGAGGG + Intergenic
1157462952 18:47917883-47917905 GAGGATAGGGAGAAGAGGTAAGG + Intronic
1157500918 18:48190095-48190117 CAAGGCAGAGAGAAGAGGGACGG - Intronic
1157865515 18:51180326-51180348 TTGGGTACAGAGAAGACAAATGG + Intronic
1157907177 18:51579694-51579716 GTGAGTAGAGAGAAAAGGAAAGG - Intergenic
1158669404 18:59461445-59461467 AAGGGTAGAGAGAAGGGTAGAGG - Intronic
1158927310 18:62281014-62281036 TAGAAAAGAGGGAAGAGGAAGGG - Intronic
1158932277 18:62333718-62333740 TGGGGTAGGGAGTAGAGAAAGGG + Intronic
1158938250 18:62384561-62384583 CGGGGCAGAGAAAAGAGGAATGG - Intronic
1159477106 18:68935819-68935841 GAGGGAAGGGAGAAGAGGGAAGG + Intronic
1159624689 18:70679034-70679056 AAGGGGAAAGAGAAGAGGAAGGG - Intergenic
1160001880 18:75032503-75032525 TAGAGTCGAGAGAAGAGAGAAGG - Intronic
1160801752 19:973676-973698 AGGGGTTGGGAGAAGAGGAAGGG - Exonic
1161327958 19:3672477-3672499 TTGTGCAGAGAAAAGAGGAACGG - Intronic
1162070065 19:8147973-8147995 TGGGAGAGAGAGGAGAGGAATGG + Intronic
1162228249 19:9242844-9242866 GAGGGAAGAAAGAAGAGGAAAGG - Intergenic
1162487287 19:10968969-10968991 AAGGGCAGAGTCAAGAGGAAGGG - Intronic
1164415582 19:28044437-28044459 TAGGGTGGAGAAGAGAAGAAAGG + Intergenic
1164714994 19:30384679-30384701 GAGGGTTGAGAGAGGAGGAATGG + Intronic
1164744159 19:30599125-30599147 GAGGAGAGAGAGAAGAGGAAGGG - Intronic
1165031072 19:32998732-32998754 TAAAGGAGAGAGGAGAGGAAAGG + Intronic
1166184655 19:41132087-41132109 AAGAGAAGAGAGAAGAAGAAAGG + Intergenic
1166329581 19:42070216-42070238 CAGGAGAGAGAGAAGAGGGAGGG + Intronic
1166505892 19:43371372-43371394 TAGAGAACAGAGGAGAGGAAAGG - Intergenic
1166647498 19:44543036-44543058 CAGGCCAGAGGGAAGAGGAAAGG + Intergenic
1166649383 19:44560173-44560195 AAGGGGAGAGGGGAGAGGAAGGG + Intergenic
1166690954 19:44821006-44821028 GAGGGAAGAGGGAAGAGGGAAGG - Exonic
1166693570 19:44839279-44839301 GAAGGGAAAGAGAAGAGGAAAGG + Intergenic
1166827361 19:45617702-45617724 GAAGGGAGAGAGAAGAGGCAGGG + Intronic
1167033350 19:46978252-46978274 TAGGGAAGAGAGGCCAGGAAAGG + Intronic
1167110474 19:47457679-47457701 TTGGGGAGAGAGATGAGGAGTGG - Intronic
1167212015 19:48139384-48139406 TAGAGAAGAGAGAAGAGGGCAGG - Intronic
1167478079 19:49712476-49712498 TGGGGTGGGGATAAGAGGAAAGG + Intronic
1167489170 19:49781923-49781945 TAGGGCAGAGGAAGGAGGAAAGG - Intronic
1167793735 19:51695768-51695790 GAGGGGAGAGAGAAGAGGCTGGG + Intergenic
1168075891 19:53980867-53980889 TAGAATACAGAGAAGAGGGAGGG + Intronic
1168249519 19:55133844-55133866 GAGGGTAGGGACAAGAGCAAGGG + Intronic
925215328 2:2089784-2089806 GAGGGGAGAGAGGAGAGGAGTGG - Intronic
925472105 2:4174056-4174078 TAGGGTTGAGCTAGGAGGAAGGG - Intergenic
925655768 2:6146578-6146600 TAGGCATGAGAGATGAGGAAAGG + Intergenic
925925776 2:8669183-8669205 TTGGGTAGGGTGAAGAGGATTGG - Intergenic
926266809 2:11330795-11330817 GAGGGAGGAGAGAGGAGGAAGGG + Intronic
927233394 2:20847477-20847499 GAGGTAAGAGAGCAGAGGAAAGG + Intergenic
927269588 2:21191756-21191778 GAGGGGGGAGAGAAGAGGAGAGG - Intergenic
927868650 2:26609296-26609318 GAGGGCAGGGGGAAGAGGAAGGG + Intronic
927917484 2:26946290-26946312 TGGGGTAGAGAGGAGGGGACAGG - Intronic
927927422 2:27023688-27023710 CAGGGTCCAGAGAGGAGGAAGGG - Intronic
928265518 2:29808309-29808331 GAAGGTGGAGAGAAGATGAAAGG + Intronic
928346699 2:30504697-30504719 GAAGGGAGAGAGAAAAGGAAGGG - Intronic
928434534 2:31246022-31246044 CAGAGTAGGGAGCAGAGGAAGGG + Intronic
928664931 2:33540656-33540678 AAGGGAAGAGAGAAAAGGTAAGG - Intronic
928815163 2:35285098-35285120 TGGGGTAGAGAGAAGAGGTAAGG - Intergenic
929444500 2:41991946-41991968 GAGGGGAGGGAGAAGAGGAGGGG + Intergenic
930018218 2:46985190-46985212 TCAGGAAGAAAGAAGAGGAAGGG - Intronic
930084075 2:47480252-47480274 AAGGGGAAAGGGAAGAGGAAAGG - Intronic
930302206 2:49630628-49630650 AAGGGCAGAGAGAAGGGGAAGGG + Intergenic
930395644 2:50820615-50820637 GAGGGTAGAGCGAGGATGAAAGG - Intronic
930436486 2:51350599-51350621 TAGGGAAAAGAGGGGAGGAAAGG + Intergenic
930569782 2:53070710-53070732 TGGGGTAGGGGGAGGAGGAAGGG + Intergenic
930729222 2:54711262-54711284 GAGGGTAGGGAGAAGTGGATGGG - Intergenic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
931059933 2:58516213-58516235 GAGGATAGAGAGAAGAGCAAAGG - Intergenic
931604182 2:64035169-64035191 GAGAGAAGAGAGAAGGGGAAAGG + Intergenic
931990514 2:67785401-67785423 TGGAGTACAGGGAAGAGGAAAGG - Intergenic
932171971 2:69565621-69565643 CAGGGAAGGGAGAAGAGAAATGG + Intronic
932439335 2:71722070-71722092 ATGGGTAGAGAGAAGGGGACAGG - Intergenic
932440611 2:71732305-71732327 TTGGGGAAAAAGAAGAGGAAGGG + Intergenic
932626162 2:73297596-73297618 GAGAGAAGAGAGGAGAGGAAAGG - Intergenic
933396142 2:81733756-81733778 AAGTGTAGAGAAGAGAGGAAAGG + Intergenic
933916949 2:87004918-87004940 TAGGGAAGAGAAAAAAGAAAAGG - Intronic
934006046 2:87764996-87765018 TAGGGAAGAGAAAAAAGAAAAGG + Intronic
934153118 2:89168677-89168699 TAGGGTAGAAACAAAAGAAATGG + Intergenic
934214122 2:90013254-90013276 TAGGGTAGAAACAAAAGAAATGG - Intergenic
934612221 2:95748980-95749002 GATGATAGAGAGTAGAGGAATGG + Intergenic
934841931 2:97630476-97630498 GATGATAGAGAGTAGAGGAATGG - Intergenic
935070918 2:99692685-99692707 TAGGGTTCAGAGAAGAGGGAAGG - Intronic
935094119 2:99927577-99927599 GAGGGTAGAGGGCAGAAGAAGGG + Intronic
935103562 2:100019366-100019388 TAGGCTAGAAAGAAGATAAATGG + Intronic
935308365 2:101759563-101759585 GAGGGGAGAGAGGAGGGGAATGG - Intronic
935769000 2:106399098-106399120 TAGGGAAGAGAAAAAAGAAAAGG + Intronic
935911097 2:107896827-107896849 TAGGGAAGAGAAAAAAGAAAAGG - Intergenic
935969216 2:108513659-108513681 TAGGGAAGAGAAAAAAGAAAAGG - Intergenic
936132878 2:109861870-109861892 TAGGGAAGAGAAAAAAGAAAAGG - Intergenic
936211819 2:110509615-110509637 TAGGGAAGAGAAAAAAGAAAAGG + Intergenic
936341199 2:111633919-111633941 CAGGGGAGAGAGAACAGGAAAGG - Intergenic
936420958 2:112364194-112364216 TAGGGAAGAGAAAAAAGAAAAGG + Intergenic
936548564 2:113414291-113414313 TAGGGAAGAAAAATGAGGAAGGG - Intergenic
936660559 2:114538260-114538282 CAGAGAAGAAAGAAGAGGAAAGG + Intronic
936778331 2:116001262-116001284 AATGGGAGAGAGAGGAGGAAGGG + Intergenic
937052607 2:118904817-118904839 GAGGGTGGAGTGAGGAGGAATGG + Intergenic
937468197 2:122153174-122153196 TTGGGTAGACAGAGAAGGAAGGG + Intergenic
937494059 2:122399513-122399535 TAAGATGTAGAGAAGAGGAAAGG - Intergenic
938252040 2:129822893-129822915 ATAGGTAGAGGGAAGAGGAAAGG + Intergenic
938371002 2:130768348-130768370 TAGGGTCCAGAGAGGAGCAAAGG + Intergenic
938419827 2:131136213-131136235 CAGGGGAGAGAGGAGAGGAGAGG - Intronic
938672622 2:133600335-133600357 AGGGAGAGAGAGAAGAGGAAAGG + Intergenic
938835876 2:135103617-135103639 TAGATTAGAGAGAAGAGGGGAGG - Intronic
939021008 2:136958556-136958578 AAGGGTAGAGTTCAGAGGAAAGG + Intronic
939257398 2:139761333-139761355 AAGGGGAGGGAGAACAGGAAAGG - Intergenic
939606591 2:144262606-144262628 GAGGGGAGATAGGAGAGGAAGGG + Intronic
939846380 2:147251375-147251397 TAGAGGAGGGAGAGGAGGAAAGG + Intergenic
939875911 2:147577668-147577690 CAGGGCTGAGAAAAGAGGAATGG - Intergenic
940508020 2:154580275-154580297 TATGGGAGAGAGAAGGGGAAGGG + Intergenic
941653482 2:168118677-168118699 GAGGGTAGAGGAAAGAGCAAGGG - Intronic
941987953 2:171526414-171526436 GAGGGGAGAGAGAGGGGGAAAGG - Intronic
942543023 2:177034460-177034482 GAGGGAAGAGAGAAGACGGAAGG + Intergenic
942559189 2:177202264-177202286 TAGGGCTGAGAGAAAAAGAATGG + Intergenic
942597140 2:177601968-177601990 GAGGAGAGAGAGAAGAGGAAAGG - Intergenic
943683253 2:190789804-190789826 TGGGGAAGAGAGATAAGGAAAGG - Intergenic
944036344 2:195298864-195298886 TTGGATAGAGAGAAGAAGAAAGG - Intergenic
944412606 2:199458355-199458377 CAGGGAGGAGGGAAGAGGAAGGG + Intronic
944517966 2:200531400-200531422 TAGGGAGGAGGGAAGATGAATGG + Intronic
944731245 2:202519897-202519919 GTGTGTAGAGAGGAGAGGAAGGG - Intronic
945014715 2:205503025-205503047 GAGGGAAGAGAGAAGAGAGAGGG - Intronic
945091934 2:206183725-206183747 TAGAGTGGAGAAAAGAGAAACGG + Intronic
945119054 2:206440260-206440282 TAGGGGAGAAAGTAGAAGAAGGG - Intergenic
945655376 2:212616613-212616635 GAGGGGAGAGAGGAGGGGAAGGG - Intergenic
945655391 2:212616647-212616669 GAGGGGAGAGAGGAGGGGAAGGG - Intergenic
945975181 2:216264942-216264964 TAGAGCAGGGAGCAGAGGAAGGG - Intronic
946013549 2:216585970-216585992 GAAGAAAGAGAGAAGAGGAAAGG - Intergenic
946030204 2:216697622-216697644 AAGGGTAGAGAGAAGGGGGGAGG + Intergenic
946123113 2:217533776-217533798 TAAGGCAGAGAGAAAAGGGAAGG + Intronic
946647203 2:221850565-221850587 CAGGGTAGAACGAAGAGCAATGG + Intergenic
946883909 2:224203926-224203948 TAGGATGGAGAGAGGAGAAAGGG + Intergenic
947696213 2:232191983-232192005 TAGGGTAGAGAAGACAGGAGAGG - Intronic
948180790 2:235978374-235978396 GAGGGAAGAGTGAAGGGGAAAGG - Intronic
948344354 2:237282721-237282743 AAGGGGAAGGAGAAGAGGAAGGG + Intergenic
948458622 2:238118689-238118711 GAGGGTGGATAGAGGAGGAATGG + Intronic
1168770403 20:411014-411036 AAAGGTAGAGAGATGAGGACTGG - Intronic
1168981760 20:2010047-2010069 TAGAGGAGAGAGAAGAGTCAAGG + Intergenic
1169024160 20:2353376-2353398 AAGGCTACAGAGAAGAGAAAGGG - Intergenic
1169135740 20:3195992-3196014 TGGAGGAGAGAGAAGAGGCAGGG - Intronic
1169268988 20:4184983-4185005 TAGGCTAGAAGGAAGAGGAAAGG + Intronic
1170316315 20:15044612-15044634 TAAGGTAAAGAGGAGAGTAAAGG + Intronic
1170497840 20:16944126-16944148 CATGGTAGAGAGAAGACAAATGG - Intergenic
1170751740 20:19154368-19154390 CAGGGTGGAGAGAGGAGAAAGGG - Intergenic
1170771855 20:19339829-19339851 TTGGGTAGAGAGAAGAAGGGAGG + Intronic
1170791230 20:19511147-19511169 CAGGGTGGAGAGATGAGGCAGGG - Intronic
1171057456 20:21921155-21921177 TAGGGGAGTGAGACAAGGAAGGG - Intergenic
1171428328 20:25062571-25062593 GATGGAGGAGAGAAGAGGAAGGG - Intergenic
1171872063 20:30536452-30536474 TAGGGTGGAGGGAAGGGGGAGGG - Intergenic
1172007325 20:31826463-31826485 TGGGGGAGAGAGGAGAGGCAAGG + Intronic
1172010355 20:31842844-31842866 TGGGGCAGAGGGAAGAGGAAAGG - Intergenic
1172581456 20:36051612-36051634 TGGGGAAGAGAGGAGAGAAATGG + Intergenic
1172890317 20:38259902-38259924 CTGGGGAGAGGGAAGAGGAAGGG - Intronic
1172910104 20:38402295-38402317 TAAGGTAGAGAGAGGAGAGATGG - Intergenic
1173165506 20:40684606-40684628 TGAGGTCTAGAGAAGAGGAAGGG - Intergenic
1173416842 20:42864345-42864367 GAGGGGAGAGAGGAGAGGGATGG + Intronic
1173472258 20:43332998-43333020 TAGGAGAGGGAGAAGAGGAAAGG - Intergenic
1174198001 20:48786870-48786892 GAGGGTAGGGAGGAGAGGAAAGG + Intronic
1174374361 20:50115653-50115675 TTGGGCACAGGGAAGAGGAAGGG + Exonic
1175126341 20:56754815-56754837 GGGGGTAGGGAGAAGGGGAAGGG - Intergenic
1175673755 20:60929866-60929888 TAAGAAAGAGAGAAGAGAAAAGG - Intergenic
1176270384 20:64233136-64233158 GAAGGGAGGGAGAAGAGGAAAGG - Intronic
1176529922 21:7950119-7950141 TGGAGTAGAGAGGAGTGGAATGG - Intergenic
1176754146 21:10713265-10713287 TAGAGTAGAAAGGAGTGGAATGG - Intergenic
1176891654 21:14326798-14326820 GAGAGAAGAGAGAAGAGGAGGGG + Intergenic
1177013895 21:15760280-15760302 TAGGATAAAGAGAAGGGCAAAGG - Intronic
1177217335 21:18147230-18147252 GTGTGTACAGAGAAGAGGAATGG + Intronic
1177370420 21:20196636-20196658 CAGGGTAGGGGGAAGAGAAAGGG + Intergenic
1177744695 21:25197551-25197573 TGCGGTAGAGAGAAAAAGAAGGG + Intergenic
1177853563 21:26377080-26377102 GAGGGTATAGGGAAGAGGGAGGG + Intergenic
1178762557 21:35417669-35417691 TTGGGTAGAGAGGTGGGGAAAGG - Intronic
1179094355 21:38299065-38299087 TAGGGTAGAGTGAGGAGCAGAGG - Intronic
1179470945 21:41609964-41609986 GAGTGGAGAGAGAAGAGGAATGG - Intergenic
1179588175 21:42387258-42387280 GAGGGCAGAGAGAAGAGAAAAGG + Intronic
1180736771 22:18023494-18023516 TAGGGAGGAGAGAGGAGGGAAGG + Intronic
1180847888 22:18994346-18994368 TAGAGAAGGGAGAAGAGGCAGGG - Intergenic
1181306757 22:21921445-21921467 TCGGGTAGAGGGAAGAGGGCAGG - Exonic
1181527890 22:23500517-23500539 AAGGGAGGGGAGAAGAGGAAGGG + Intergenic
1181534350 22:23533995-23534017 GAGGGTGGGGAGATGAGGAAGGG + Intergenic
1181896289 22:26110856-26110878 TTGGGTAGTGGGAAGAGGAGAGG - Intergenic
1182095191 22:27621194-27621216 TAGGGGAGAGAGAGGAGGGCAGG - Intergenic
1182735422 22:32529470-32529492 GAGGAAAGAGGGAAGAGGAAAGG + Intronic
1182754559 22:32668376-32668398 GAGGGGAAAGAGAAGGGGAAAGG - Intronic
1182833995 22:33326700-33326722 TATGGTGGAAAGGAGAGGAAGGG + Intronic
1182859917 22:33550424-33550446 TAGGATAGAGGGAAGAGGCTAGG + Intronic
1182900336 22:33893273-33893295 TGGGGTGGTGGGAAGAGGAAGGG - Intronic
1182948751 22:34351083-34351105 GAAGGTAGAGAGAATAGAAAGGG - Intergenic
1183803749 22:40191052-40191074 TTGAGGATAGAGAAGAGGAAGGG + Intronic
1183970455 22:41473664-41473686 TAAGGTAGAGAGAATAGGGGTGG + Intronic
1184012830 22:41762286-41762308 GAGGGGAGGGAAAAGAGGAAAGG - Intronic
1184142411 22:42585595-42585617 TAACGTAGAGAGAAGAGCACAGG + Exonic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
1203296638 22_KI270736v1_random:48301-48323 TAGAGTAGAGTGGAGTGGAATGG + Intergenic
1203298219 22_KI270736v1_random:58826-58848 TCGGGTCGAGAGCAAAGGAATGG + Intergenic
1203298356 22_KI270736v1_random:59800-59822 TAGAGTAGAGAGGAGTGGAGTGG + Intergenic
1203298579 22_KI270736v1_random:61265-61287 TAGAATAGAGTGAAGTGGAATGG + Intergenic
1203300044 22_KI270736v1_random:70748-70770 TGGAGTAGAGAGAAGTGGAGGGG + Intergenic
1203300120 22_KI270736v1_random:71308-71330 TAGAATGGAGAGAAGTGGAATGG + Intergenic
1203300438 22_KI270736v1_random:73372-73394 TGGAGTAGAGTGAAGTGGAATGG + Intergenic
1203304517 22_KI270736v1_random:99900-99922 TATAGTAGAGTGGAGAGGAATGG + Intergenic
1203304908 22_KI270736v1_random:102417-102439 TTGAGAGGAGAGAAGAGGAATGG + Intergenic
1203306425 22_KI270736v1_random:112418-112440 TGGAGTCGAGTGAAGAGGAATGG + Intergenic
1203306944 22_KI270736v1_random:115856-115878 TAGAGTAGAGTGGAAAGGAACGG + Intergenic
1203309446 22_KI270736v1_random:132376-132398 TAGAGTGGAGAGGAGAGAAATGG + Intergenic
1203309899 22_KI270736v1_random:135421-135443 TGGAGTAGAGAGTAGTGGAATGG + Intergenic
1203309926 22_KI270736v1_random:135615-135637 TAGTGTAGAGTGGAGAGGAGTGG + Intergenic
1203309928 22_KI270736v1_random:135620-135642 TAGAGTGGAGAGGAGTGGAAGGG + Intergenic
1203310149 22_KI270736v1_random:137108-137130 TAGGGTGGAGTGGAGTGGAATGG + Intergenic
1203310374 22_KI270736v1_random:138532-138554 TAGAGTGGAGTGAAGTGGAATGG + Intergenic
1203311188 22_KI270736v1_random:143979-144001 TGGAGTAGAGAGGAGTGGAAAGG + Intergenic
1203311945 22_KI270736v1_random:148908-148930 TGGAGTAGAGTGAAGTGGAATGG + Intergenic
1203311977 22_KI270736v1_random:149108-149130 TAGAATGGAGAGAAGTGGAATGG + Intergenic
1203312500 22_KI270736v1_random:152562-152584 TAGAGTGGAGAGGAAAGGAATGG + Intergenic
1203313084 22_KI270736v1_random:156496-156518 TAGAGTGGAGAGGAAAGGAATGG + Intergenic
949201443 3:1384905-1384927 TAGGGTTCAGATAAGAGGTAAGG - Intronic
949236601 3:1816809-1816831 AAGGGAAGAAAGAAAAGGAAAGG - Intergenic
949589070 3:5474443-5474465 GATGGTATAGAGAAAAGGAAAGG - Intergenic
949807084 3:7967242-7967264 AAGGATAGAGAGAAATGGAAGGG + Intergenic
949955894 3:9268342-9268364 TATGGCAGAGAGAAGAGAGAGGG - Intronic
950080760 3:10220419-10220441 TGGGGGAGAGAAAAGAGGAAAGG - Intronic
950108819 3:10405518-10405540 TAGGGAGAAGAGAATAGGAAGGG + Intronic
950133573 3:10564535-10564557 TAGGGGAGAGGGGAGGGGAAGGG - Intronic
950469762 3:13177358-13177380 CTGGGTAGAGAGAAAAGCAATGG + Intergenic
950668623 3:14512108-14512130 TAGGGAAGAGGCCAGAGGAACGG + Intronic
950687892 3:14631900-14631922 AAGGAGGGAGAGAAGAGGAAGGG + Intergenic
951260131 3:20497383-20497405 TAGAGGAGAGAGAAAAGGAGTGG - Intergenic
951880469 3:27476676-27476698 TAGGAGAGAGAGAAGTGGGAAGG - Intronic
952442582 3:33347145-33347167 GGGGGTAGAGAGTAGAAGAATGG - Intronic
952513466 3:34079852-34079874 TGGGGTAGAGGGAGGGGGAAGGG - Intergenic
952904881 3:38133167-38133189 TAGGGCAGAAAGAGGAGGTAGGG + Intronic
953135585 3:40178978-40179000 TAGGGTACACAGAAGACGCAGGG - Intronic
953335854 3:42093604-42093626 GAGGGGAGAGAAAAGAGGACAGG - Intronic
953361815 3:42303839-42303861 GAGGGGTGAGAGAAAAGGAAAGG + Intergenic
953386417 3:42508747-42508769 GAGGGGAGAGAGGAGAGAAAAGG - Intronic
953788429 3:45928713-45928735 TGGGGAACAGAGATGAGGAAAGG - Intronic
953940370 3:47089814-47089836 TAAGATAAAGACAAGAGGAAAGG + Intronic
954009025 3:47618636-47618658 CAGGGCTGAGAGAAGAGGAGCGG + Intronic
954565354 3:51595401-51595423 TAGGGCAGATTGAAGAGGGATGG + Intronic
954867688 3:53743835-53743857 TAAGCTAAAGAGAAGTGGAAAGG + Intronic
955074902 3:55604451-55604473 TAGGGTAGAGAGAATTGTAAAGG - Intronic
955783410 3:62510143-62510165 GAGAGGAGAGAGGAGAGGAAAGG - Intronic
956004158 3:64761180-64761202 TGGGGTAGAGAGGAGGGAAATGG - Intergenic
956624502 3:71253601-71253623 GAAGGGAGAGAGAAGAGAAAAGG - Intronic
956694496 3:71906943-71906965 GAGGGAAGGAAGAAGAGGAAGGG + Intergenic
956823819 3:72978398-72978420 GAGGGAAGAGAGAAAAGGCAGGG - Intronic
957235815 3:77588894-77588916 TGGCGAAGAAAGAAGAGGAAGGG + Exonic
957923483 3:86778107-86778129 TAAGAGAGAGAGAAGAGAAAAGG + Intergenic
958600012 3:96285348-96285370 GAGGGTCGAGGGAAGAGGAGCGG + Intergenic
958712614 3:97736328-97736350 TTGGAGAGAGAGAAAAGGAAGGG - Intronic
958871295 3:99562190-99562212 AAGAGGAAAGAGAAGAGGAAAGG - Intergenic
958973589 3:100640360-100640382 TAGTATAGGGAGAAGAGGAGAGG + Intronic
959539603 3:107523961-107523983 AAGGGGAGAGAGAAGAGGGAGGG + Intronic
960596382 3:119411522-119411544 GAGGGCAGAGTGAAGTGGAAGGG + Intronic
961226863 3:125257695-125257717 GAGGGTAGAGAGAAATGGGAAGG - Intronic
961721101 3:128896682-128896704 TAAGGTCAAGATAAGAGGAATGG - Intronic
961782763 3:129330663-129330685 TGGGGAAGTGAGAGGAGGAAAGG - Intergenic
961996749 3:131253535-131253557 TAGGGAAGGAAGAAGAGGAAAGG - Intronic
962078196 3:132107918-132107940 TAGGAAAGAGATAGGAGGAAGGG - Intronic
962507028 3:136057511-136057533 AAGGGGAGGGAGAAGATGAAGGG + Intronic
962520397 3:136193443-136193465 TGAGGTAGGGGGAAGAGGAAGGG - Intronic
962715647 3:138124000-138124022 TAGGATGAAGAAAAGAGGAAAGG - Exonic
962865899 3:139447928-139447950 GAAGGCAGAGGGAAGAGGAAGGG - Intergenic
963304120 3:143631581-143631603 TATGAAAGAGATAAGAGGAAAGG - Intronic
963368277 3:144366401-144366423 AAGGGTGGAGGGAAGAGGCAGGG + Intergenic
963796290 3:149634056-149634078 TAGGGTGGAGGCAACAGGAATGG + Intronic
964713320 3:159695358-159695380 TAGGGAAGACATAGGAGGAAGGG - Intronic
964956819 3:162369713-162369735 TAGGGGAGAGAGATGAGGAGAGG - Intergenic
965190571 3:165522666-165522688 TAGGGGATAAAGAAGTGGAATGG + Intergenic
965434415 3:168631089-168631111 TAGGGTGCAGAGAAAAGGGAAGG - Intergenic
966303042 3:178499832-178499854 TTTGGTGGAGAGAAGGGGAATGG + Intronic
966443789 3:179977425-179977447 TAAGGGAGAGTCAAGAGGAAAGG - Intronic
966524848 3:180909744-180909766 GAGAGAAGAGAGAAGAGAAAAGG + Intronic
966821064 3:183924897-183924919 TATGGGAGAGAGAAGGGCAAAGG + Intronic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
967575669 3:191088569-191088591 TGGGGTAGTGGGAAGGGGAAAGG - Intergenic
967633503 3:191774713-191774735 GAGGGTAGAGAGAAGCAAAAGGG - Intergenic
968589852 4:1451949-1451971 TGGGGGAGGGAGAAGAGGAGGGG - Intergenic
968887198 4:3341287-3341309 AAGGGTAGAGAGATGGGGTATGG + Intronic
969442029 4:7222883-7222905 GAGTGGAGGGAGAAGAGGAATGG - Intronic
969593128 4:8133177-8133199 TTGGGAAGGGAGAAGAGGGAAGG - Intronic
969717879 4:8877238-8877260 GAGGGGAGAGAGGAGAGGAGTGG + Intergenic
969827993 4:9773254-9773276 TAGGGTAGAGGGGAGGGGATGGG - Intronic
970044661 4:11838222-11838244 TCTGGTAGGGTGAAGAGGAAAGG - Intergenic
970538157 4:17051141-17051163 GAGGGGAGAGAGAAGAGGAGGGG + Intergenic
970551674 4:17188001-17188023 TAGGGTACAAAGATGAGGTAAGG - Intergenic
970844575 4:20521371-20521393 GAGATTAGAGAGAAGAGGCAGGG + Intronic
972108234 4:35520885-35520907 TAGCATAGAAAGAGGAGGAAAGG - Intergenic
972127619 4:35789218-35789240 CAGGGGAGAGAGGAGGGGAAGGG + Intergenic
972148778 4:36063587-36063609 TAGGGTAGCAGGAAGAGGAAAGG - Intronic
973184300 4:47306418-47306440 CAGGGTAGAGATAGGAGGAAGGG + Intronic
973829372 4:54742907-54742929 TGGGGAAGGGTGAAGAGGAAGGG + Intergenic
974092567 4:57327410-57327432 TAGTTGAGAGAGGAGAGGAATGG - Intergenic
974102690 4:57435391-57435413 TGTGATAGATAGAAGAGGAAAGG + Intergenic
974744378 4:66051774-66051796 GAAGGAAGAGAGAAGAGGAAGGG + Intergenic
975230255 4:71924314-71924336 TAGGGCAGTGAAAAGGGGAAAGG + Intergenic
976158585 4:82174204-82174226 TAGGGAAGAGATTAGAAGAAGGG - Intergenic
976944430 4:90747061-90747083 AGAGGTAGAGAGAAGAGAAAAGG + Intronic
977048303 4:92094414-92094436 AAGGATAAAGAGAAGAGGGATGG - Intergenic
977116352 4:93033670-93033692 AAGGAGAGAGAGGAGAGGAATGG - Intronic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977575995 4:98674642-98674664 TTAGGTGGAGAGAAGAGTAAGGG - Intergenic
977802077 4:101246909-101246931 TGGGGTAGCTAGAAGACGAAGGG - Intronic
978313944 4:107415151-107415173 TAGGGTAAGGGGAAGGGGAAGGG + Intergenic
978957346 4:114630773-114630795 TAGGGTAGAAAGAAGAATTAAGG + Intronic
978999867 4:115203143-115203165 GAGGGCAAAGAGAAGAGGGAAGG - Intergenic
979151915 4:117328520-117328542 GAGTGTAGAGACAGGAGGAAAGG - Intergenic
979560145 4:122092616-122092638 TAGAGTAGAGAGAATGGGTACGG + Intergenic
979684633 4:123497797-123497819 TAGGGTGGGGAGAGGTGGAATGG - Intergenic
980280063 4:130707392-130707414 TAGGGTAGTGCAAAAAGGAAAGG - Intergenic
980680752 4:136156505-136156527 TAAAGTAGAGAAAAGAGGAGTGG - Intergenic
980710063 4:136554209-136554231 TATAATAGAGAGAAGAGAAATGG + Intergenic
981027161 4:140088310-140088332 TAGGGGAGAGAGGAGGGAAAGGG - Intronic
981375968 4:144016322-144016344 AAGGGAAGAGACAGGAGGAAGGG - Intronic
981386491 4:144137687-144137709 AAGGGAAGAGACAGGAGGAAGGG - Intronic
981655199 4:147105031-147105053 AAGGGCAGAGGGAAGAGGAGGGG - Intergenic
981950590 4:150401906-150401928 AAGAGGAGAGAGAGGAGGAAGGG + Intronic
982112894 4:152072530-152072552 TTTGATAGAGAGAAGAGGAAAGG + Intergenic
982300654 4:153876204-153876226 GAGGGCAGAGAGAAGAGGTGAGG - Intergenic
982362739 4:154538583-154538605 TAGAAGACAGAGAAGAGGAAAGG + Intronic
982410354 4:155069086-155069108 TGGGGTGGAGAGAAGAGGGAGGG + Intergenic
982872314 4:160596824-160596846 TAGGGTAGAAACATGAAGAAAGG - Intergenic
983191612 4:164760301-164760323 AAGGGTAGAAAGAAAAGCAAAGG + Intergenic
983547317 4:168977878-168977900 TAGGATAGTGAGAATAGAAATGG - Intronic
983702228 4:170611945-170611967 TGGGACAGAGAGAAAAGGAAAGG - Intergenic
984175968 4:176417283-176417305 TAGTGGAGAGAGATCAGGAAAGG - Intergenic
984966533 4:185144707-185144729 CAGGGTAGAGAGAAGGGAAGAGG - Intronic
985626962 5:994085-994107 GAGGGGAGAGAGGAGAGGAAAGG + Intergenic
986058939 5:4169692-4169714 TAGGGGTGAGAGGAGACGAAAGG + Intergenic
986343819 5:6816002-6816024 TAGGGTAGCTAGGAGTGGAATGG + Intergenic
986648280 5:9939614-9939636 TGGGGAAGAGGGAGGAGGAAAGG + Intergenic
986872678 5:12068414-12068436 TTGGGTAAAGGGAAGGGGAAGGG + Intergenic
987258937 5:16184240-16184262 TTGGGTGGAGAGCAGAGGATTGG + Intergenic
988515793 5:31903344-31903366 AGGGGTAGAAAGAATAGGAAAGG + Intronic
988629145 5:32910640-32910662 AAGGGTACAGAGGAGAGAAAGGG + Intergenic
988633363 5:32955212-32955234 TAAGGAGGAAAGAAGAGGAAAGG + Intergenic
988667717 5:33348307-33348329 TAGGGTGGGGGGAAGGGGAAGGG - Intergenic
988984118 5:36600179-36600201 TAGGGAAGAGAGAGGAGGAGGGG + Intergenic
989412781 5:41139820-41139842 TGGAGCACAGAGAAGAGGAAAGG - Intergenic
990078423 5:51880865-51880887 TAGGGTAGAGAGAGAAAGACAGG + Intergenic
990493905 5:56327518-56327540 AGTGGGAGAGAGAAGAGGAATGG + Intergenic
990920031 5:60953458-60953480 TCCAGTAGAGGGAAGAGGAAAGG - Intronic
991994157 5:72370755-72370777 TAAGGGATAGAGAGGAGGAAAGG - Intergenic
992268744 5:75044306-75044328 TGGGGCAGAAAGAAGAGGAATGG - Intergenic
992418927 5:76581525-76581547 TAGGACAGAAAGAGGAGGAAAGG - Intronic
992530046 5:77644941-77644963 AAGGGGAGAGAGAAAGGGAAAGG - Intergenic
993165514 5:84349057-84349079 TATAGTAAAGAGAAGAGAAAAGG - Intronic
993257075 5:85605225-85605247 AAAAGTAGAGAGAAGAGTAAAGG + Intergenic
993333454 5:86627905-86627927 TAGGGTAGGGAGAATGGGGATGG + Intergenic
993452963 5:88095231-88095253 TAGTGGAGAGATCAGAGGAAGGG + Intergenic
993623374 5:90193417-90193439 AAGGGGAGAGAAAAGTGGAAAGG + Intergenic
993758002 5:91755914-91755936 AATGCTAGAGAGGAGAGGAAGGG - Intergenic
994151945 5:96457597-96457619 CCAGGTAGAGAGAAGAGCAAGGG - Intergenic
994491606 5:100452721-100452743 AAGGGTAGGAAGAAGAAGAAAGG + Intergenic
994598704 5:101873496-101873518 TACAGATGAGAGAAGAGGAAAGG - Intergenic
994957829 5:106557148-106557170 CAGGGAAGAATGAAGAGGAAAGG + Intergenic
995207443 5:109497422-109497444 TAGGGTATAGTCAAGAGGGATGG + Intergenic
995295776 5:110519974-110519996 TAGTGAAGAGTGAAGAGGGAGGG + Intronic
995639170 5:114233835-114233857 TAGGGAACAGAGAAGAAAAATGG - Intergenic
996394959 5:123004501-123004523 AAGTGTAGTGAGAAGAGGAGAGG - Intronic
996620695 5:125498857-125498879 AAGGGGAGAGAAGAGAGGAAGGG + Intergenic
996938690 5:128977447-128977469 AAGGTGAGAGAGAAAAGGAAAGG + Intronic
996988231 5:129594785-129594807 TGGGGAAGGGAGAAGAGGAGGGG - Intronic
997722259 5:136088601-136088623 TTGGGTGGGGAGAAGAGGAAGGG + Intergenic
998418263 5:141960820-141960842 AAGGGAACAGAGAAGAGGGAGGG + Intronic
998495822 5:142588469-142588491 GAGAGAAGAGAGAAGAGGGAGGG - Intergenic
998749603 5:145305142-145305164 AAGGATAGAGAGAATAGGATAGG + Intergenic
998930498 5:147176135-147176157 TAAGGAAGAGAGAAGAAGCAAGG - Intergenic
998981053 5:147702475-147702497 GAAGGAAGAGAAAAGAGGAAAGG + Intronic
999261537 5:150241668-150241690 TTGAGGAGAGGGAAGAGGAAGGG - Intronic
999261558 5:150241770-150241792 GAGAGGAGAGGGAAGAGGAAAGG - Intronic
999480192 5:151941018-151941040 GAGGGTATAGAGAAGAGTAGTGG + Intergenic
999957013 5:156713424-156713446 TAGGAGGGAGAGAGGAGGAAAGG + Intronic
1000121434 5:158201690-158201712 AAGGAAAGAGAGAAGAGGAGGGG - Intergenic
1000616469 5:163433207-163433229 TTGGGGAGAGAAAAGAGAAAAGG + Intergenic
1001108390 5:168875212-168875234 GAGGGAAGAGAGAAGAAGGAAGG + Intronic
1001475145 5:172045024-172045046 TAGGGAAGAGAGAGGATGGATGG + Intronic
1001920518 5:175596135-175596157 TATGGGAAAAAGAAGAGGAAAGG - Intergenic
1002307498 5:178292467-178292489 TGAGGGAGAGAGCAGAGGAAGGG - Intronic
1002390737 5:178909761-178909783 GAAGGAAAAGAGAAGAGGAAGGG - Intronic
1002531971 5:179852597-179852619 TAGGATACTGAGAAGAGGGAGGG + Intronic
1002543361 5:179921264-179921286 TAGGGTAGAAAGAAGGGCAAGGG - Intronic
1002941239 6:1718227-1718249 TAGTGTAGAGAAAAGAGGTCAGG - Intronic
1002952532 6:1829123-1829145 TAGGCTTGAGAGAACAAGAAAGG + Intronic
1003347846 6:5287311-5287333 TGGGGAAGAGAGAAGAGAAATGG + Intronic
1003394785 6:5743716-5743738 TGGGGGAGAAAGAAGATGAATGG + Intronic
1003458061 6:6302175-6302197 TAGGGTGGGGAGAAGAGGAGAGG - Intronic
1003486555 6:6585093-6585115 GAGGGGAGAGAGGAGAGGAGAGG - Intergenic
1003487841 6:6595197-6595219 AGGGGGAGAAAGAAGAGGAAGGG + Intronic
1003517253 6:6827406-6827428 CAGAGGAGAGAGAAGAGAAAGGG + Intergenic
1004037406 6:11936790-11936812 GAGAGTAGAGAGTAGAGGAGGGG - Intergenic
1004151096 6:13120701-13120723 CAGGGAAGAGAAGAGAGGAAGGG - Intronic
1004205264 6:13586698-13586720 TAGGGAAGAGAGGAAGGGAAGGG + Intronic
1004249952 6:14015619-14015641 GAGGAGAGAGAGCAGAGGAATGG - Intergenic
1004287972 6:14340165-14340187 TAGGATAAAGAGAGGAGAAAGGG + Intergenic
1005017844 6:21390900-21390922 AAAGGAAGAGAGAAAAGGAAGGG - Intergenic
1005275361 6:24211303-24211325 GAGGGTAGAGAGGAGAACAAAGG + Intronic
1005802410 6:29440493-29440515 AAGGGCAAAGAGAAGATGAAAGG - Exonic
1006136063 6:31897206-31897228 TGGGGCCGAGAGAAGAGGAGGGG + Intronic
1006278695 6:33028975-33028997 GAGGAGAGAGAGAAGAGAAAGGG - Intergenic
1006281589 6:33058631-33058653 GAGTGTAGAGAGATGAGCAAAGG - Intergenic
1006336042 6:33420892-33420914 GAGGGAAGAGAGAAGAGAGAGGG + Intronic
1006455940 6:34131903-34131925 ATGGGGAGAGGGAAGAGGAAGGG - Intronic
1006727069 6:36207165-36207187 TGGGGTAGAGAGGGGTGGAAGGG + Intronic
1007053345 6:38856101-38856123 AAGGGTAAGGAGAAGAGGATAGG - Intronic
1007154499 6:39729271-39729293 TGGGGAAGAGAGAAGAGAATGGG + Intergenic
1007287348 6:40757214-40757236 TAGGTTAGAGAATAGAGGACTGG + Intergenic
1007339891 6:41184570-41184592 TGGGGTAGGGAGAAGGGGGAGGG + Intergenic
1007545273 6:42688589-42688611 TATGGTTGAGGGAAGAGGAGTGG - Intronic
1007587823 6:43002672-43002694 TAGGGATGAGAGAACAGGAGAGG - Intronic
1007775047 6:44220024-44220046 TAGGGTAGGGGGAAGAGGTCTGG + Intronic
1007868208 6:44999534-44999556 CAGGGAAGAGAGAAGAGGTTTGG - Intronic
1007924920 6:45643025-45643047 GAGGGCAGAGAGAAGGGGAAAGG - Intronic
1008382652 6:50851394-50851416 TGGGGTACAGAGACGTGGAAAGG + Intergenic
1008420429 6:51292922-51292944 TAGTGGAAAGAGAAGTGGAATGG + Intergenic
1008826634 6:55702413-55702435 AAGGGTAGAGAGAAAAGTGAAGG - Intergenic
1009671934 6:66765168-66765190 TTGGGAAGAGAGAAGAGGAAGGG - Intergenic
1009697960 6:67134190-67134212 TAGGGCAGGGAGAGGAGAAAGGG + Intergenic
1009760515 6:67998912-67998934 GAGAGGAGAGAGGAGAGGAAGGG - Intergenic
1009760519 6:67998929-67998951 TGGGGGAGAGAGAGGAGGAGAGG - Intergenic
1010015864 6:71104545-71104567 TAGAGTAGAGAGTGGAGGACGGG - Intergenic
1010250938 6:73706382-73706404 GGGAGGAGAGAGAAGAGGAAAGG + Intronic
1010813271 6:80324658-80324680 GAGGGTAGTGAGAAAGGGAAAGG - Intronic
1010977523 6:82332543-82332565 GAGGGGATAGAGAAGAAGAAGGG - Intergenic
1011124006 6:83986835-83986857 AAGGCAAGAGAGGAGAGGAAGGG + Intergenic
1011398358 6:86934402-86934424 TATGGTAGAGGGAAGAGTAACGG - Intergenic
1012084808 6:94810584-94810606 TATGTTAGAGACAAAAGGAAGGG + Intergenic
1012723058 6:102772588-102772610 GAAGGTAGGGAGAAGAGTAAGGG + Intergenic
1013387204 6:109643448-109643470 TAGGGTAGTGAACACAGGAATGG - Intronic
1013673505 6:112431459-112431481 GAGGGTAGGGAAAGGAGGAAGGG + Intergenic
1013677442 6:112481084-112481106 AAAGGAAGAGAGAAGAGAAAGGG - Intergenic
1013737414 6:113243896-113243918 TGGGTCAGAGATAAGAGGAAAGG - Intergenic
1014002987 6:116385514-116385536 TAGGGAAGGGAGAAAAGGAGGGG + Intronic
1014284109 6:119476961-119476983 TGGGTTAGAGAAAAGAGGAAAGG + Intergenic
1014455018 6:121624923-121624945 TAGAGAAGAGAGTAGAGAAATGG + Intergenic
1014777119 6:125523995-125524017 AAGGGCAGAGAGATGAGGGAGGG - Intergenic
1014984267 6:127982595-127982617 TAGGGAAGAGCAAAGGGGAAAGG - Intronic
1015113465 6:129619534-129619556 AAGGGGAGAGAGAAAAGGAAGGG + Intronic
1015113476 6:129619565-129619587 AAGGGGAGAGGGAAAAGGAAGGG + Intronic
1015391840 6:132691123-132691145 TAGAGGATAGAGAATAGGAAGGG + Intronic
1015431701 6:133138394-133138416 TGGGAGAGAGAGAAGGGGAAAGG - Intergenic
1015778217 6:136836370-136836392 TAAGGTAGAAAGCAGGGGAAGGG + Intronic
1015888964 6:137950110-137950132 TAGGGGAGAGGAAAGAAGAAGGG - Intergenic
1016140047 6:140597172-140597194 TAGTTTAGAGACAAGAGGAAAGG - Intergenic
1016998338 6:149976868-149976890 TAAGGTAGGGCGTAGAGGAAGGG - Intergenic
1017676516 6:156819984-156820006 TGTGGTGGAGAGGAGAGGAAGGG + Intronic
1017796840 6:157852429-157852451 CATGGTAGCGAGAGGAGGAAGGG - Intronic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1019061128 6:169259072-169259094 CAGGCCAGAGAGAAGAGCAAGGG - Intergenic
1019061698 6:169262117-169262139 CAGGCCAGAGAGAAGAGCAAGGG + Intergenic
1020288654 7:6706185-6706207 TGGAGCAGAGAGAGGAGGAAGGG + Intronic
1020361130 7:7327981-7328003 TGGGGGAGAGAGAGAAGGAAGGG + Intergenic
1020683950 7:11270535-11270557 TGGGAGGGAGAGAAGAGGAAAGG - Intergenic
1020711946 7:11617837-11617859 TGGGGTAGGGAGAGGAGGGAGGG + Intronic
1020791924 7:12637631-12637653 GAAGGAGGAGAGAAGAGGAAGGG + Intronic
1021098779 7:16564072-16564094 GAGGGGAAAGAGAAGACGAAGGG + Intronic
1021116003 7:16747387-16747409 AAGGGGAGAGAGAGGAGGGAAGG - Intergenic
1021202975 7:17746261-17746283 TGGGGGGGAGAGAAGGGGAAAGG - Intergenic
1021344160 7:19502947-19502969 TAGAGTGAAGAGAAGAGGAAAGG + Intergenic
1021414315 7:20364789-20364811 GAGGTTATAGAGACGAGGAAAGG - Intronic
1021608276 7:22431604-22431626 TAGGGCAGAGAGTGGAGCAAAGG - Intronic
1021614526 7:22488319-22488341 TTGGGGAAGGAGAAGAGGAAGGG + Intronic
1021912436 7:25399858-25399880 TAGAATGGAGAGAAAAGGAAAGG - Intergenic
1022028160 7:26467740-26467762 GTGGGTAGAGAGAAGAGCAATGG - Intergenic
1022098540 7:27155795-27155817 GAGGAGAGAGAGAAGAAGAAAGG + Intronic
1022891968 7:34710325-34710347 TAGGGAAGAAAGCAGAGGAAAGG + Intronic
1023977128 7:45038958-45038980 GAGGTCAGAGAGAATAGGAAAGG + Intronic
1024107989 7:46112636-46112658 TAGGATACAGAGAAAAAGAAAGG - Intergenic
1024213329 7:47226130-47226152 TAGTGTAGAGAAAAGGAGAAGGG + Intergenic
1024355634 7:48411137-48411159 AAGGGGAGAAAGAAAAGGAAAGG - Intronic
1024841823 7:53595847-53595869 CAGGGGAGATAGAAGAGGTAGGG - Intergenic
1024972345 7:55082322-55082344 TGGGGTACAGAGGGGAGGAAAGG - Intronic
1025066113 7:55857427-55857449 AAGAGAAGAGAGAAAAGGAAAGG + Intronic
1025269042 7:57491904-57491926 TGGGGTAGAGAGGAGTGGAATGG + Intergenic
1026158465 7:67848342-67848364 TAGGGCACAGAGAGGATGAAAGG + Intergenic
1026437094 7:70408487-70408509 CAGGGCAGAGAGAACAGGAAAGG + Intronic
1026789767 7:73324086-73324108 GAGGGAAGAGGGAAGAGGGAAGG + Intronic
1026837668 7:73649203-73649225 AAGGAAAGAGAGAAGAGAAAGGG - Intergenic
1027499256 7:78927524-78927546 AAGGGTAGAGATAAGGGTAAGGG + Intronic
1027547025 7:79540414-79540436 CAGAGAAGAGAGAAGAGAAAAGG - Intergenic
1028836974 7:95385203-95385225 TGGGGTAGGGGGAAGAGGGAGGG + Intronic
1029099686 7:98118652-98118674 TAGGGCAGAGGGAAGGGTAAAGG - Intronic
1029421801 7:100475859-100475881 TAAGGGACAGAGCAGAGGAAGGG + Intronic
1029456381 7:100674376-100674398 TAGGGTGGAGACGAAAGGAAGGG - Intronic
1029483568 7:100826667-100826689 TGGGGTAGGGAGGAAAGGAAAGG + Intronic
1029981657 7:104884982-104885004 CAGGGGAGAGGGAAGAGGAGAGG + Intronic
1030302875 7:107992037-107992059 TGGGGTAGTGAGAGAAGGAAAGG - Intronic
1030380258 7:108803247-108803269 AAGGGAAGAAAGAAGGGGAAGGG - Intergenic
1030418537 7:109277100-109277122 TAGTTTAGAGAGAATAGGAAAGG - Intergenic
1030618044 7:111758859-111758881 TATGGCAGAGAGAAGAGGATGGG + Intronic
1030639361 7:111986539-111986561 TAGGGAAGAGAGAGGATGAGAGG + Intronic
1030646526 7:112067413-112067435 TAGGGAAGAGAGAGGAGGATAGG + Intronic
1030712059 7:112760811-112760833 TAGGGTAAAGGGAGTAGGAATGG + Intergenic
1030944521 7:115700360-115700382 GAGAGAAGAGAGAAGAGGAGAGG - Intergenic
1031154024 7:118087412-118087434 AATGGTGGAAAGAAGAGGAAAGG - Intergenic
1031171727 7:118300165-118300187 TATGCTAAAGAGCAGAGGAAAGG - Intergenic
1031212556 7:118849019-118849041 GAGGGTAGTAGGAAGAGGAAGGG + Intergenic
1031438405 7:121762172-121762194 TAGGGCTGAGAGAAGGGCAATGG + Intergenic
1031518519 7:122733122-122733144 TAGGTTAGAAAGAACATGAAAGG + Intronic
1031561244 7:123241299-123241321 TAGGCAAGAGAGAAGAGGGAGGG - Intergenic
1032016078 7:128381155-128381177 CAGGGGAGAGAGAAAAGGAATGG - Intergenic
1032839999 7:135705974-135705996 GAGGAGAGAGGGAAGAGGAAGGG + Intronic
1033365224 7:140668035-140668057 TATGGTTTAGAGAAGAGAAATGG - Intronic
1033530183 7:142254922-142254944 TGAGGTACAGAGAAAAGGAAAGG + Intronic
1033601585 7:142892532-142892554 TATGGTAGAGTGAAGAGGATTGG - Intergenic
1033804327 7:144937422-144937444 AAGGGTAAGGAGAAGGGGAAGGG - Intergenic
1033828655 7:145224932-145224954 GCGGGTAGAGAGAAGTGCAATGG - Intergenic
1034036406 7:147828009-147828031 TAGGGTACAGAGGAGAGAAAAGG + Intronic
1034121287 7:148630253-148630275 TAGCGTAGAGTGAAAAGGAGTGG - Intergenic
1034190174 7:149207726-149207748 CTGGGTGGAGAGACGAGGAAGGG + Intronic
1034298703 7:149996233-149996255 GAGGGGAGGGAGGAGAGGAAGGG + Intergenic
1034588508 7:152118096-152118118 TAGGGTAGAGAGAAGAGGAAGGG - Intronic
1034635660 7:152565520-152565542 GAGGGAAGAGGGAAGAGGCAGGG - Intergenic
1034807314 7:154100547-154100569 GAGGGGAGGGAGGAGAGGAAGGG - Intronic
1035100211 7:156389945-156389967 GAGGGGAGAGAAAAGAGGGAGGG - Intergenic
1035105703 7:156440293-156440315 TAGGGAAGAGGGAAGGAGAACGG + Intergenic
1035333246 7:158110151-158110173 GAGGTCAGAGAGAAGAGGGAGGG - Intronic
1036023444 8:4875017-4875039 AGAGGGAGAGAGAAGAGGAAGGG - Intronic
1036950948 8:13138745-13138767 TAGGGTAGAGAGTGGGGGTAGGG - Intronic
1037308062 8:17526610-17526632 TGAGGAAGAGAGAAGAAGAAAGG + Intronic
1037357156 8:18033208-18033230 GAGGGTAGAGGGAAGAGTGAGGG - Intergenic
1037400260 8:18488916-18488938 GAGGGGAGAGAGAGGAGGAGAGG + Intergenic
1037577107 8:20217400-20217422 TGGGGAAGAGAGAAGTGGTAAGG - Intronic
1037694217 8:21209335-21209357 GGGTGTAGAGAGAAGGGGAATGG + Intergenic
1038350232 8:26769969-26769991 TAGGGCACAGGGAAGAGGGAGGG - Intronic
1038885172 8:31655436-31655458 TAGGGTAGGGAGGAGGGGAAAGG + Intronic
1039127663 8:34221356-34221378 AAGAATAGGGAGAAGAGGAATGG - Intergenic
1039407605 8:37326631-37326653 GAGAGGAGAGAGGAGAGGAAAGG - Intergenic
1039876185 8:41588486-41588508 GAGAGAAGAGAGAAAAGGAAAGG - Intronic
1040836537 8:51737532-51737554 CAGGGTAGAAAGAGGAGAAAGGG - Intronic
1040854299 8:51932797-51932819 TAGGGAGGAGGTAAGAGGAAAGG - Intergenic
1041412812 8:57575269-57575291 GAGGCTGGACAGAAGAGGAAAGG + Intergenic
1041732430 8:61076195-61076217 AAAGGGAGAGAGAGGAGGAAAGG - Intronic
1042034896 8:64522067-64522089 AAGGGAAAAGATAAGAGGAAGGG - Intergenic
1042777035 8:72443749-72443771 TATGGAAGAGAGAATAAGAAGGG - Intergenic
1043405424 8:79927643-79927665 TGGGGTTGAGAGGAGAGGAGAGG - Intronic
1044131733 8:88532204-88532226 TGGGGTAGGGGGAAGAGGGAGGG - Intergenic
1044391160 8:91653282-91653304 AAGGGTTGAGAAAAGAGGAGTGG + Intergenic
1044536344 8:93360516-93360538 TAGAGTGGAGAAAAAAGGAAAGG + Intergenic
1044619515 8:94175283-94175305 TAGTGAAGAGAGAAAAGGTACGG + Intronic
1044755176 8:95454107-95454129 GAGTGTAGAGAGAAGAGGAATGG - Intergenic
1045069638 8:98488466-98488488 TAGGGTAGGGAGGAAATGAAAGG + Intronic
1045258301 8:100548296-100548318 TAGAGTATAGAGAACAAGAAGGG - Intronic
1045453234 8:102349549-102349571 GAGGGGAGAGAGAAGAGCAAAGG + Intronic
1045603015 8:103739379-103739401 TAGGGTAGAGGGAAGGGGGAGGG + Intronic
1045688469 8:104736025-104736047 TGGGGTAGAGTGAATAGGAGTGG + Intronic
1045861664 8:106820523-106820545 AAGGAGAGAGAGAAAAGGAAGGG - Intergenic
1045867720 8:106887650-106887672 TAGGGAAGAGGGTAGAAGAAGGG + Intergenic
1045920629 8:107524755-107524777 TAGTGTAGTGAGAGAAGGAATGG - Intergenic
1046902190 8:119535616-119535638 GAGGGCAGAGAGGAGAGAAAGGG - Intergenic
1047142912 8:122162252-122162274 TGGGGGAGAGAGAGGATGAAGGG + Intergenic
1047164513 8:122422035-122422057 GAGGGGAGAGAGGAAAGGAAGGG - Intergenic
1047652919 8:126943856-126943878 TAGGGTAGATAATAAAGGAAAGG - Intergenic
1047760268 8:127949437-127949459 TAGGGGAGAGAGGAGAGAGAGGG - Intergenic
1047787497 8:128168062-128168084 TTGGAGGGAGAGAAGAGGAAGGG - Intergenic
1048007643 8:130432047-130432069 GGGGGAAGAGAGAGGAGGAAAGG + Intronic
1048057458 8:130881593-130881615 TAGGGCAGTGGGAAGAGAAAAGG + Intronic
1048234935 8:132680699-132680721 AAGGGAAGAGAGGAGGGGAAAGG - Intergenic
1048475749 8:134740984-134741006 TATGGTAGAGGGAAAAGGGAGGG - Intergenic
1048728536 8:137412474-137412496 TTGGGAAGAGAGACTAGGAAGGG + Intergenic
1048963263 8:139597234-139597256 CGGGGTAAAGAGAAAAGGAAGGG - Intergenic
1049904432 9:202881-202903 TAGGGAAGAAAAATGAGGAAGGG + Intergenic
1049907054 9:227788-227810 TAAGGGGAAGAGAAGAGGAATGG + Intronic
1049945994 9:596396-596418 TCGGGTAGAGAAAAGACTAAAGG + Intronic
1050041342 9:1496951-1496973 AAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1050155508 9:2662790-2662812 TTGGTTAGAGAGGAGAGGCATGG - Intergenic
1050433374 9:5584603-5584625 TATGGTTGAGAGAAGAGGTTAGG + Intergenic
1050596500 9:7209731-7209753 GAGGTTAGAGAGAGGAGAAAAGG - Intergenic
1050607630 9:7317835-7317857 AAGCATAGAGAGAAGAGCAAAGG + Intergenic
1050689623 9:8210765-8210787 TGGAGTGGAGAGAAAAGGAAAGG - Intergenic
1050799975 9:9598382-9598404 CAGGATAGAGAGAATAGTAAAGG - Intronic
1051132546 9:13878558-13878580 AGGGGTGGAGAGAAGAGAAAGGG - Intergenic
1051601537 9:18879151-18879173 TGTGGGAGAGAGAAGAGGAGGGG + Intronic
1051793563 9:20837016-20837038 AAGGGCAGAGAGCAGAGAAAAGG - Intronic
1052025810 9:23571908-23571930 TGGGCTAGACAGAAGAGGTACGG + Intergenic
1052462217 9:28779965-28779987 TGGTGTAGAGAGAAGAAAAAAGG - Intergenic
1053004821 9:34597390-34597412 TAGGGGAGAGGGAAGATAAAAGG + Intergenic
1053727004 9:41014455-41014477 TAGGGAAGAAAAATGAGGAAGGG + Intergenic
1055141639 9:72883210-72883232 TGGGGGAGAAAGAAGGGGAAAGG - Intergenic
1055613135 9:78043690-78043712 TATAATAGTGAGAAGAGGAAGGG - Intergenic
1055967991 9:81883922-81883944 TAGGGGAGTCAGGAGAGGAAGGG - Intergenic
1056234206 9:84575356-84575378 TTATCTAGAGAGAAGAGGAAGGG + Intergenic
1057293734 9:93823502-93823524 TAGTGTAGAGAGTCAAGGAATGG - Intergenic
1057398781 9:94704054-94704076 AAGGGCAGAGGGAAGAGGAGGGG - Intergenic
1057493346 9:95540090-95540112 TGGAGAAGAGAGAAGCGGAAGGG - Intergenic
1058139467 9:101342439-101342461 AAGGGGAGGGGGAAGAGGAAGGG + Intergenic
1058711561 9:107683633-107683655 TTGGGGACAGAGAAGAGGAAGGG - Intergenic
1058787080 9:108399771-108399793 GAGGGAAGGGAGAAGAGGTATGG + Intergenic
1058876844 9:109252057-109252079 TAAGGGAGAGAAAAGAGGGAGGG + Intronic
1058889274 9:109346944-109346966 TAGGAGAAAGAGAAGAGGCAAGG + Intergenic
1058944225 9:109841680-109841702 GAGGGTGGAGGGAAGAGGAGAGG + Intronic
1059050781 9:110922757-110922779 TAGGGAAGATAGAAAAGTAAAGG + Intronic
1059157266 9:112001266-112001288 TCTGGAAGAGAGAAGAAGAAAGG + Intergenic
1059276200 9:113099344-113099366 GAGGCCAGAGGGAAGAGGAAGGG + Intergenic
1059476634 9:114552731-114552753 TGGGAGAGAGAAAAGAGGAAAGG + Intergenic
1059652732 9:116330930-116330952 TAGGGCAGTGATAAGAGGAAGGG - Intronic
1060045798 9:120339159-120339181 GAGGGAAGAAAAAAGAGGAAGGG + Intergenic
1060110515 9:120903473-120903495 TGGGCTGGAGAGAACAGGAAGGG + Exonic
1060243396 9:121924375-121924397 GAGGGCAGAGAAAAGAGGCAAGG + Intronic
1060289365 9:122286256-122286278 TAGGCTAGAGATAGGAGAAAGGG + Intronic
1060313996 9:122491427-122491449 AAGGGAGGAGAGAAGAGGAAAGG + Intergenic
1060447534 9:123705366-123705388 AAGGGTACAAAGAATAGGAAAGG + Intronic
1060757588 9:126224355-126224377 GAAGGTGGAGAGGAGAGGAAAGG - Intergenic
1060836735 9:126761239-126761261 TAGGAAAGAGAGAGGAGTAACGG + Intergenic
1061013378 9:127968233-127968255 AAGGGGAGAGAGAGGAGGAACGG + Intronic
1061255698 9:129453469-129453491 GAGGGTAGAGGGATGGGGAATGG + Intergenic
1061314905 9:129789014-129789036 GAGGGGAGAGACAAGAGAAAGGG + Intergenic
1061566821 9:131446357-131446379 AAGGGGAGAGGGAAGAGGAGGGG - Intronic
1203386110 Un_KI270438v1:57523-57545 TAGAGTAGAGTGCAGTGGAATGG + Intergenic
1203387240 Un_KI270438v1:66963-66985 TGGAGTAGAGAGGAGTGGAATGG + Intergenic
1203343717 Un_KI270442v1:16670-16692 TGGTGTAGAGTGAAGTGGAATGG + Intergenic
1203343891 Un_KI270442v1:17825-17847 TAGAGTGGAGAGAAGTGGAATGG + Intergenic
1203344512 Un_KI270442v1:23965-23987 TGGGGTGGAGTGAAGTGGAATGG + Intergenic
1203350225 Un_KI270442v1:75513-75535 TGGAGTAGAGAGAAATGGAAAGG + Intergenic
1203683885 Un_KI270757v1:20399-20421 TGGGGTGGAGTGGAGAGGAATGG + Intergenic
1185623896 X:1469160-1469182 GAGGGGAGAGGGGAGAGGAAAGG - Intronic
1186046754 X:5544893-5544915 TAGAGGAGAGAGAAGAGAAGAGG + Intergenic
1186581729 X:10826932-10826954 TAAGGATGAGAGTAGAGGAATGG - Intronic
1186785809 X:12955180-12955202 TAGGGGAGAGAGAATGGGAGGGG - Intergenic
1187116122 X:16353097-16353119 TACTAGAGAGAGAAGAGGAAAGG + Intergenic
1187283761 X:17883155-17883177 GAAGGGAGAGGGAAGAGGAAGGG + Intergenic
1187738423 X:22328340-22328362 TAGGGTAGAAAGAACATGGAAGG + Intergenic
1187968823 X:24639538-24639560 GTGGGTAGGGAGAAGTGGAAAGG - Intronic
1188049680 X:25469546-25469568 TAGGGTAGTGAGGGGAGCAAAGG - Intergenic
1188079231 X:25815553-25815575 CAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1188465868 X:30480311-30480333 TAGGGTTGAGGGAAGGTGAAGGG + Intergenic
1188569176 X:31561366-31561388 GAGGGTAGAAAGAACAGGAAGGG + Intronic
1189010384 X:37040939-37040961 TAGGGTAGAGAACAGAAGGAGGG + Intergenic
1189038200 X:37514769-37514791 TAGGGTAGAGACAAGAAGGAGGG - Intronic
1189110548 X:38285942-38285964 AAGGGGAGGAAGAAGAGGAAGGG - Exonic
1189286123 X:39853677-39853699 GGGGAAAGAGAGAAGAGGAAGGG + Intergenic
1189303520 X:39969804-39969826 CAGCCTAGAGAGAAGGGGAAAGG + Intergenic
1189357755 X:40324334-40324356 TAGGGAAGTGAGACAAGGAAAGG - Intergenic
1189548888 X:42072589-42072611 TGGGGAAGAGACAAGGGGAAGGG + Intergenic
1189684019 X:43545037-43545059 TAGGAGAGAGAGAAGAGGTCTGG + Intergenic
1190428212 X:50352474-50352496 TAGGGCAGAGTGAAAAAGAAAGG - Intergenic
1190845058 X:54183386-54183408 TTGGGTAGAGAGAAGGGGAGGGG + Intergenic
1191204143 X:57816653-57816675 TAGGCAAGAAAGAAGAAGAAAGG + Intergenic
1191857727 X:65640743-65640765 GAGGGCAGAGAAAGGAGGAAAGG + Intronic
1192321260 X:70092392-70092414 TGGGGTAGGGAGAAGTGGGAAGG + Intergenic
1192764761 X:74129305-74129327 TGGGGTGGAGACAAGAGGAGTGG + Intergenic
1192968508 X:76206059-76206081 CAGGGAAGAGAAAAGTGGAAAGG - Intergenic
1193234813 X:79093812-79093834 TAGTGGAAAGAGAACAGGAATGG - Intergenic
1193738289 X:85186224-85186246 CAGGGTAGAGTGGAGAGGACAGG - Intergenic
1193899671 X:87161830-87161852 CAGTGTAGAGAAAAAAGGAATGG - Intergenic
1194187538 X:90791853-90791875 TTGGGTGGAGAGAAGGTGAAAGG - Intergenic
1194482955 X:94449624-94449646 TGGGATAGAGGGAGGAGGAATGG - Intergenic
1194706643 X:97182952-97182974 TAGGGCAGAGAGTATAAGAAAGG + Intronic
1194891002 X:99378594-99378616 CAGGGGATAGGGAAGAGGAAGGG - Intergenic
1195255110 X:103082457-103082479 TAGGGTAGTGACAAGAGGCAAGG - Intronic
1195611241 X:106869778-106869800 TAGGGTTGAGTGAAGACAAAAGG - Intronic
1195713004 X:107790063-107790085 TTGGGCAGACAGAGGAGGAAGGG - Intronic
1196393171 X:115231152-115231174 TTAGGAAGAGACAAGAGGAAGGG - Intronic
1196584955 X:117418837-117418859 AAGGGTAGAGACATGGGGAAGGG - Intergenic
1196593161 X:117512491-117512513 TAGGGTAGAGAGACAGAGAAAGG + Intergenic
1196943218 X:120798163-120798185 CAGGGGAGAGAGAAAAGGAAAGG - Intergenic
1197103519 X:122685732-122685754 AAAGGTGGAGAGAAGAGGATGGG + Intergenic
1197226462 X:123960732-123960754 GAGGGTGTAAAGAAGAGGAAGGG + Exonic
1197419663 X:126223219-126223241 TAGGGTGAAGAGTGGAGGAATGG - Intergenic
1197532495 X:127646892-127646914 TAGGAGAGAGAGAAGAGAGAGGG + Intergenic
1197718110 X:129724763-129724785 GAGGTTATAGAGAAGAGGATAGG + Intergenic
1197960308 X:131997434-131997456 AATGGGAGAGAGAAGAGGGAAGG + Intergenic
1198074409 X:133180771-133180793 TAGGAGAGAGAGAAGAGGCTTGG - Intergenic
1198100658 X:133419165-133419187 AAGGGAAGAGAGGAGAGGAGAGG + Intergenic
1198999692 X:142620153-142620175 AAAGGGAGAGAGAAGGGGAAAGG + Intergenic
1199520454 X:148729405-148729427 TCGGGAAGGGAGAAGAGCAAAGG + Intronic
1199714390 X:150495956-150495978 CAGGATAGAGAGAATAGGAGAGG - Intronic
1200031621 X:153301535-153301557 GAGGGGAGAGAGAGTAGGAAAGG + Intergenic
1200371714 X:155733017-155733039 GTGGGGAGAGAGAAGGGGAATGG + Intergenic
1200534128 Y:4373807-4373829 TTGGGTGGAGAGAAGGTGAAAGG - Intergenic
1200638776 Y:5690967-5690989 TAGGGTGGAAAGTTGAGGAATGG - Intronic
1200993704 Y:9366492-9366514 GAGGGAAGAGAGAAGAGGCCAGG - Intronic
1201097526 Y:10632780-10632802 TGGAGTGGAGAGAAGAGGACAGG - Intergenic
1201098238 Y:10651557-10651579 TGGAGTGGAGAGAAGAGGACAGG - Intergenic
1201098547 Y:10653818-10653840 TAGGATAGAGTGGAGAGGAGTGG - Intergenic
1201098644 Y:10654548-10654570 TAGAGTAGAGAGGAGTGGAGTGG - Intergenic
1201100330 Y:10666843-10666865 TAGAGTGGAGAGGAGTGGAATGG - Intergenic
1201100966 Y:10672433-10672455 TAGAGTGGAGAGGAGTGGAATGG - Intergenic
1201102164 Y:10686216-10686238 TGGAGTAGAGTGGAGAGGAATGG - Intergenic
1201102748 Y:10690570-10690592 TGGAGTAGAGTGAAGTGGAATGG - Intergenic
1201103014 Y:10692731-10692753 TAGAGTGGAGAGGAGTGGAATGG - Intergenic
1201103018 Y:10692756-10692778 TAGCGTGGAGAGGAGTGGAATGG - Intergenic
1201105936 Y:10763250-10763272 TGGAGTAGAGTGGAGAGGAAAGG - Intergenic
1201106269 Y:10765718-10765740 TGGAGTGGAGTGAAGAGGAATGG - Intergenic
1201108915 Y:10784465-10784487 TAGAGTGGAGAAGAGAGGAATGG - Intergenic
1201109266 Y:10787107-10787129 TAGAGTGGAGAGGAGTGGAATGG - Intergenic
1201109953 Y:10791979-10792001 TAGAGTGGAGAGGAGTGGAATGG - Intergenic
1201109954 Y:10791984-10792006 TAGAGTAGAGTGGAGAGGAGTGG - Intergenic
1201110260 Y:10793985-10794007 TAGAGTGGAGAGTAGTGGAATGG - Intergenic
1201110971 Y:10799232-10799254 TAGGGTGGAATGAAGTGGAATGG - Intergenic
1201116021 Y:10836001-10836023 TGGAGTAGAGTGAAGTGGAATGG - Intergenic
1201119597 Y:10862836-10862858 TAGGATAGAATGAAAAGGAATGG - Intergenic
1201122589 Y:10884556-10884578 TGGAGTGGAGAGAAGTGGAATGG - Intergenic
1201123726 Y:10894040-10894062 TGGAGTGGAGAGAAGTGGAATGG - Intergenic
1201124455 Y:10900699-10900721 TGGGGTGGAGTGGAGAGGAATGG - Intergenic
1201131450 Y:10954865-10954887 TGGAGTAGAGTGAAGTGGAATGG - Intergenic
1201134119 Y:10977474-10977496 TGGAGTAGAGAGGAGAGGAATGG - Intergenic
1201135633 Y:10988048-10988070 TGGAGTAGAGTGAAGAGGAATGG - Intergenic
1201135851 Y:10989543-10989565 TGGGGTGGAGAGGAGTGGAATGG - Intergenic
1201138441 Y:11008400-11008422 TAGAGTGGAGAGGAGTGGAATGG - Intergenic
1201138649 Y:11009932-11009954 TAGAGTGGAGAGGAGTGGAATGG - Intergenic
1201138832 Y:11011230-11011252 TGGAGTAGAGAGGAGTGGAATGG - Intergenic
1201138992 Y:11012407-11012429 TGGAGTAGAGAGGAGTGGAATGG - Intergenic
1201139916 Y:11019720-11019742 TGGGGTGGAGAGGAGTGGAATGG - Intergenic
1201140445 Y:11023225-11023247 TGGGGTGGAGAGGAGTGGAATGG - Intergenic
1201201016 Y:11540357-11540379 TGGAGAAGAGAGAAAAGGAATGG + Intergenic
1201549943 Y:15209268-15209290 GAGGGGAGGGAAAAGAGGAAGGG + Intergenic
1201917899 Y:19202574-19202596 AAGAGAAGAGAGAAGAGGAGAGG - Intergenic
1202027148 Y:20536307-20536329 TAGAGTAGGTAGAAGTGGAATGG + Intergenic
1202607559 Y:26651889-26651911 TAGGGTGGAATGGAGAGGAATGG + Intergenic
1202607856 Y:26654133-26654155 TGGAGTAGAGTGGAGAGGAATGG + Intergenic