ID: 1034588533

View in Genome Browser
Species Human (GRCh38)
Location 7:152118437-152118459
Sequence ACATGCAGACAGTGTCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034588533_1034588534 -1 Left 1034588533 7:152118437-152118459 CCTAGCTGACACTGTCTGCATGT 0: 1
1: 0
2: 2
3: 15
4: 236
Right 1034588534 7:152118459-152118481 TTAAAACTGCTAATAACTTTTGG 0: 1
1: 0
2: 2
3: 35
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034588533 Original CRISPR ACATGCAGACAGTGTCAGCT AGG (reversed) Intronic
900037674 1:431078-431100 ACTTGCAGCCAGGGCCAGCTTGG + Intergenic
900059304 1:666821-666843 ACTTGCAGCCAGGGCCAGCTTGG + Intergenic
905506255 1:38481830-38481852 ATATGTATCCAGTGTCAGCTAGG - Intergenic
909435771 1:75640238-75640260 ACATGTCTACAGTCTCAGCTTGG + Intergenic
909836369 1:80260367-80260389 ACTTGCAGCCAGAGCCAGCTTGG + Intergenic
912199242 1:107437825-107437847 ACTTGCAGAAAATGTCAGTTAGG + Intronic
920468410 1:206205771-206205793 ACATGCAGACGGTGGGCGCTGGG - Intronic
920732133 1:208497172-208497194 ACTTGCAGCCAGGGCCAGCTTGG - Intergenic
921499021 1:215877588-215877610 ACATGCTGACTGTTACAGCTGGG + Intronic
922068770 1:222170288-222170310 ACTTGCAGCCAGAGCCAGCTTGG + Intergenic
923656557 1:235922064-235922086 ACATCCAGACAGCATCTGCTGGG - Intergenic
923768685 1:236917640-236917662 AAATGCAGAGATTGTCAGATTGG + Intergenic
1063555870 10:7079029-7079051 ACAGGTAGACAGTTTCAGTTTGG - Intergenic
1064144017 10:12813221-12813243 ACATGCAGTAAGTATCAGCAGGG - Intronic
1064254243 10:13730556-13730578 ACAATGAGACAGTGTCAGGTTGG - Intronic
1064522157 10:16214357-16214379 ACATGAAGACAGAGGCAGATTGG + Intergenic
1069420436 10:68241778-68241800 ACATGCAAACAATGGCAGCCAGG - Intergenic
1071310761 10:84341595-84341617 ACAGGTAGACAGTGTTAGATTGG - Intronic
1071619469 10:87105951-87105973 ACAGGCAGACTGTGCCAGCCAGG + Intronic
1071902237 10:90133256-90133278 ATATGTAGACAGTGTCTCCTGGG - Intergenic
1071949666 10:90688256-90688278 ACATGAAAACAGTGTCTGTTGGG - Intergenic
1072639565 10:97201782-97201804 GCATGCAAACGGTGGCAGCTGGG - Intronic
1072791193 10:98319078-98319100 GCACGCAGCCAGTCTCAGCTTGG + Intergenic
1073427728 10:103466065-103466087 ACAAGATGGCAGTGTCAGCTGGG + Intergenic
1073694384 10:105848924-105848946 ACCTGGAGAAAGTGTCAGGTAGG + Intergenic
1074085482 10:110206674-110206696 GCATACAGACTGTGTGAGCTTGG - Intergenic
1075632975 10:124012237-124012259 AAATGCAGACCTGGTCAGCTGGG - Intronic
1076183117 10:128426088-128426110 ACATGCAGAGAGAGTCATCAGGG - Intergenic
1076964401 11:69001-69023 ACTTGCAGCCAGGGCCAGCTTGG + Intergenic
1077809302 11:5621345-5621367 ACAGGCAGAGAGAGCCAGCTGGG - Intronic
1080909499 11:36581408-36581430 ACTTGCAGACAGCCTCTGCTAGG - Intronic
1081484940 11:43520298-43520320 ACACCCAGTGAGTGTCAGCTCGG - Intergenic
1081960587 11:47133753-47133775 AGGTGCTGACAGTGTTAGCTGGG + Intronic
1083148722 11:60776631-60776653 ACAAGGAGACACTGTCAGCCTGG + Exonic
1083271283 11:61574035-61574057 TCATGGAGGCAGTGTCAGTTAGG - Intronic
1083775896 11:64894226-64894248 ACAACCAGGCAGGGTCAGCTGGG + Intergenic
1084574444 11:69979852-69979874 TCATGGAGAAAGTCTCAGCTTGG + Intergenic
1085452012 11:76639829-76639851 AGATGCAGAAAGTCACAGCTTGG + Intergenic
1086755573 11:90558003-90558025 ACATGAAGCCAGGGCCAGCTTGG + Intergenic
1087356192 11:97097601-97097623 ACTTGCAGCCAGGGCCAGCTTGG + Intergenic
1087562128 11:99803281-99803303 ACCTGCAGCCAGGGCCAGCTCGG - Intronic
1089124981 11:116170552-116170574 ACAATCAAACAGTGTCAGTTTGG + Intergenic
1091797463 12:3305450-3305472 ACGTGCAGACAGTGTGAGGCTGG - Intergenic
1091846533 12:3660325-3660347 ACAGGCAGACAGTGTGAGACAGG + Intronic
1093134693 12:15436914-15436936 ACTTGCAGCCAGGGCCAGCTTGG + Intronic
1094773884 12:33698865-33698887 ACATGCAGACAATAGCAGCAGGG - Intergenic
1096189819 12:49609178-49609200 AGATGCAACCAGGGTCAGCTTGG + Intronic
1099274013 12:80552179-80552201 ACAGGCAAACAGTGTCAGAAAGG + Intronic
1101038742 12:100732746-100732768 ACATGCTGTCAGTGTGACCTTGG + Intronic
1102342665 12:112135845-112135867 AAATACAGACAGGGTCGGCTGGG + Intronic
1102620229 12:114188725-114188747 AGATGAGGACAGTGTCAGGTAGG + Intergenic
1106835218 13:33627123-33627145 AAATCTAGACAGTGTTAGCTTGG + Intergenic
1106994390 13:35463968-35463990 AAATGCAGACAGAGACAGTTAGG + Intronic
1107297155 13:38921591-38921613 ACTTGCAGCCAGGGCCAGCTTGG - Intergenic
1110466313 13:75806257-75806279 TCATGCAGACAGGGGCACCTGGG - Intronic
1110583304 13:77158176-77158198 ACATGCAGATACTTTCAGATAGG + Intronic
1111827808 13:93290234-93290256 AAATGCAGGCAGTGGCTGCTGGG + Intronic
1111887529 13:94041161-94041183 AGATGCAGACATTGATAGCTTGG + Intronic
1112265723 13:97921599-97921621 ACATGCAGAGTGTGTCACCATGG + Intergenic
1112837247 13:103531061-103531083 AAATGGAGACAGTCCCAGCTTGG - Intergenic
1113493076 13:110707136-110707158 GAATGCAGACAGTGTTTGCTGGG - Intronic
1115109095 14:29799836-29799858 ACAAGAAGGCAGTGTAAGCTGGG - Intronic
1115186812 14:30698289-30698311 ACATGCTGACAATTTCAGTTTGG + Intronic
1115791906 14:36889307-36889329 ACATGCAGTCAGTTTCATTTTGG - Intronic
1116781402 14:49241283-49241305 ACTTGCAGCCAGAGCCAGCTTGG - Intergenic
1116940327 14:50784851-50784873 CCCTGCAGACAGTGTCCCCTAGG + Intronic
1117930752 14:60838621-60838643 ACATGGAGCCAGTGGGAGCTGGG + Intronic
1120121005 14:80680219-80680241 ACTTGCAGGCAGAGCCAGCTTGG + Intronic
1123939612 15:25210531-25210553 ACATGCACTGAGTCTCAGCTGGG - Intergenic
1124080854 15:26494385-26494407 ACATACAGCAAGAGTCAGCTTGG + Intergenic
1125130618 15:36279688-36279710 ACTTGCAGACAGGGGCAGCTTGG - Intergenic
1126221776 15:46222690-46222712 ACATGGAAACAGTGTGGGCTTGG - Intergenic
1126858503 15:52861693-52861715 CTATGCAGACAGTGGCAGCTGGG - Intergenic
1127587291 15:60390620-60390642 ACATGCAAACATTTTCAACTGGG + Intronic
1128220926 15:65968000-65968022 ACATGCAGGCTGCGTGAGCTTGG - Intronic
1130643003 15:85696990-85697012 ACATACAGACGGTGTAAACTTGG - Intronic
1131020777 15:89096174-89096196 ACCTGCAGACAATGTCAGTGTGG - Intronic
1131585080 15:93684338-93684360 ACTTGCAGCCAAGGTCAGCTTGG + Intergenic
1132444149 15:101896182-101896204 ACTTGCAGCCAGGGCCAGCTTGG - Intergenic
1135747130 16:25026803-25026825 ACATGCATGTAGTCTCAGCTAGG + Intergenic
1135825363 16:25722541-25722563 ATATGGATACAGTGTCACCTGGG + Intronic
1136347623 16:29686280-29686302 ACCTGCAGACAGTGTCGGGGTGG - Intronic
1137596161 16:49725406-49725428 AAATGAAGACAGCGTCACCTTGG + Intronic
1137714760 16:50591946-50591968 ACAAGCAGACAGGGTCCCCTTGG - Intronic
1137843455 16:51663624-51663646 AGATGCTGCCAGTATCAGCTAGG - Intergenic
1138938484 16:61760132-61760154 TCATCTAGACAGTGTCAACTGGG - Intronic
1140062591 16:71583873-71583895 ACATGAAGACAGAGCCAACTGGG + Intergenic
1140189697 16:72804896-72804918 ACCTGCAGACAGGCTCACCTAGG + Intronic
1141874805 16:86816480-86816502 ACATGCACACAGAGTCTGTTAGG - Intergenic
1141887984 16:86905954-86905976 ACCTCCAGCCAGTGTCTGCTAGG + Intergenic
1144093036 17:11874891-11874913 AGAAGCAGACATTCTCAGCTGGG - Intronic
1144671811 17:17137073-17137095 AGATGCAGACAGAGCGAGCTGGG - Intronic
1149112073 17:53046246-53046268 ACTTGCAGCCAGGGCCAGCTTGG + Intergenic
1153514659 18:5892175-5892197 ACAGTCAGAGGGTGTCAGCTTGG + Intronic
1155325225 18:24657924-24657946 ACGTGCAGACGGTGGCAGCAGGG + Intergenic
1156631623 18:38976023-38976045 GCATGCAGACAGAGTCAGAAAGG - Intergenic
1156886377 18:42140728-42140750 ACTTGCAGCCAGGATCAGCTTGG + Intergenic
1160054731 18:75467679-75467701 CCATGCAGACAGTGTGAGGTTGG + Intergenic
1160641204 19:138633-138655 ACTTGCAGCCAGGGCCAGCTTGG + Intergenic
1162086535 19:8252905-8252927 ACCTGCTCACAGTGTCACCTTGG + Intronic
1162763370 19:12902227-12902249 AGATGATGACAGTGTCACCTAGG + Intronic
1163175781 19:15563464-15563486 ACCTGCAGGCAGTATCAGCTGGG - Intergenic
1165351426 19:35277934-35277956 TCATGCCAACTGTGTCAGCTGGG - Intronic
1165898077 19:39155345-39155367 AGCTGCAGACAGTGACAGCCTGG + Intronic
1167489930 19:49786728-49786750 ACAGGCAGTCAGCATCAGCTTGG + Intronic
926136243 2:10338658-10338680 ACATGCACCCAGAGTCAGCTTGG + Intronic
926302620 2:11615312-11615334 ACATGCAGACAGGGACAAGTAGG - Intronic
927480822 2:23452482-23452504 ACATCCAAACCGTGTCAGATGGG + Intronic
928831412 2:35489882-35489904 AGATTCATACAATGTCAGCTGGG - Intergenic
930210890 2:48635532-48635554 ACTTGCAGCCAGGGCCAGCTTGG - Intronic
934545340 2:95209703-95209725 ACCTGCTGACAGTGTCTGATTGG + Intronic
935623228 2:105146563-105146585 ACATTCAGACTGTGACAGGTTGG + Intergenic
937330627 2:121026097-121026119 GAATGCAGACAGTGACTGCTGGG - Intergenic
937520897 2:122711603-122711625 ACATGCAGACTGTCACTGCTAGG - Intergenic
940704264 2:157084188-157084210 ACATGCAGACACTGTTGGCATGG - Intergenic
945625367 2:212198330-212198352 ATAGGCAGACAGTTTCAGTTTGG - Intronic
948600787 2:239106471-239106493 TCCTGCAGCCAGTGTCTGCTGGG + Intronic
948937651 2:241178060-241178082 ACAAGCAGCCTGTGCCAGCTTGG + Intronic
1170905708 20:20513927-20513949 ACTTGCAGCCAGGGCCAGCTTGG + Intronic
1171392693 20:24811640-24811662 TGAAGCAGACAGTGTCAGGTGGG - Intergenic
1171510252 20:25676641-25676663 ACATGCAGGGAGTGTCACCAGGG - Exonic
1175008307 20:55709542-55709564 AGATGCAGACAGTGTCAGTTGGG - Intergenic
1178904942 21:36628857-36628879 AAAAGCAAACAGTGTGAGCTGGG + Intergenic
1179379856 21:40888388-40888410 ACCTGCACACAGGGTCAGCCTGG - Intergenic
1179597070 21:42450115-42450137 ACTTCCAGACGGTGTCAGCAGGG - Intergenic
1179778971 21:43687471-43687493 ACAAGCACCCAGTGCCAGCTGGG - Intronic
1181920997 22:26320413-26320435 ACAAGCAGCCAGTGTCATCCCGG + Intronic
1183678217 22:39311639-39311661 ACAGGGAGACAGTGACAACTTGG + Intergenic
1184304183 22:43584275-43584297 ACATGCAGAGAATCACAGCTGGG + Intronic
1184396906 22:44247644-44247666 ACAAGAAGACAGACTCAGCTGGG - Exonic
1184490737 22:44807322-44807344 ACATGAAGACAGTGCTTGCTAGG + Intronic
952662349 3:35866874-35866896 AGATGATCACAGTGTCAGCTGGG + Intergenic
953084308 3:39652101-39652123 ACATGTAGACAGTGGCAACATGG - Intergenic
954485998 3:50851656-50851678 ACAGGCAGCCAGGGCCAGCTTGG - Intronic
954736119 3:52707682-52707704 CCATGGAGGAAGTGTCAGCTGGG - Exonic
955497829 3:59554547-59554569 ACAGGCTGACAGTGTGAGCCTGG + Intergenic
955568155 3:60272031-60272053 AGATGCAGACAGAGGCAGCCTGG + Intronic
958497628 3:94864724-94864746 ACTTGCAGCCAGAGGCAGCTTGG - Intergenic
959753309 3:109864649-109864671 CCATGCAGACTCTCTCAGCTGGG + Intergenic
959754055 3:109875443-109875465 ACTTGCAGCCAGGGCCAGCTTGG + Intergenic
959948281 3:112149991-112150013 ACTTGCAGCCAGGGCCAGCTTGG - Intronic
960337837 3:116440014-116440036 AAATGCTGAAACTGTCAGCTGGG - Intronic
961709539 3:128817100-128817122 ACATGCAGGCAGAATAAGCTGGG - Intergenic
962090700 3:132241380-132241402 ACAGGCAGATAGTTCCAGCTAGG - Intronic
962259176 3:133892323-133892345 GCTGGCTGACAGTGTCAGCTTGG - Intronic
963048652 3:141123817-141123839 ACATGGGGAGAGTGTCAGGTGGG - Intronic
963508286 3:146215933-146215955 AAATGCAGACAGTCCCGGCTGGG + Intronic
964307138 3:155354005-155354027 ACATGAAGACAGAGGCAGATTGG - Intergenic
964476015 3:157098352-157098374 ACATCCAGAAGGAGTCAGCTGGG + Intergenic
964652457 3:159026844-159026866 ACTTGCAGTCAGGGCCAGCTTGG - Intronic
967815806 3:193797230-193797252 ACATCCAGACAGTGGGAGCTAGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
968916129 4:3497756-3497778 ACAGGCAGGCAGGGGCAGCTTGG + Intronic
968927478 4:3557310-3557332 ACATGCAGACAGGGTCACGCTGG - Intergenic
968927491 4:3557400-3557422 ACATGCAGACAGGGTCATGCTGG - Intergenic
968927496 4:3557430-3557452 ACATGCAGACAGGGTCACTCTGG - Intergenic
968927501 4:3557460-3557482 ACATGCAGACAGGGTCACTCTGG - Intergenic
968927565 4:3557760-3557782 ACATGCAGACAGGGTCACTCTGG - Intergenic
968927576 4:3557850-3557872 ACATGCAGACAGGGTCATGCTGG - Intergenic
969242743 4:5911560-5911582 ACATGCAGAAAGGCCCAGCTTGG + Intronic
969454395 4:7292932-7292954 CCATGCAGATAGTGTCTGCTGGG + Intronic
970375735 4:15455429-15455451 ACATGAAGAAAGAGTCAGCAGGG - Intergenic
970940129 4:21622055-21622077 GCATGAAGACAGTGACAGCAAGG - Intronic
973597970 4:52512050-52512072 TCATCCAGACAGTGCCAGGTTGG + Intergenic
974164360 4:58181710-58181732 AAAAGCAGAAATTGTCAGCTGGG - Intergenic
974775561 4:66476385-66476407 ACATGAAGCCAGGGCCAGCTTGG + Intergenic
975737969 4:77400206-77400228 ACATGCAGAGAGAGTCAGGTAGG - Intronic
977310943 4:95386396-95386418 ACATGCAGAAAGTATTATCTGGG - Intronic
978041789 4:104073591-104073613 ACATGCAGTCAGTGTCAACCAGG - Intergenic
978182685 4:105819141-105819163 ACAGGCAGACAGTGCCAGATAGG - Intronic
981739306 4:147985439-147985461 GCGTGCAGACAGAGCCAGCTTGG - Intronic
982859880 4:160435096-160435118 TCCTGCAGCCAGTGTCAGCCAGG - Intergenic
984171846 4:176368751-176368773 ACTTGCAGGCAGGGCCAGCTTGG - Intergenic
986062361 5:4203347-4203369 CCAAGCAGACAGGGACAGCTGGG - Intergenic
986442320 5:7793151-7793173 AAAGACACACAGTGTCAGCTGGG + Intronic
986540075 5:8835689-8835711 ACGTGCAGAGAATGTCAACTAGG + Intergenic
986729317 5:10623607-10623629 ACATTCAGACTGTGGCAGGTGGG + Intronic
988646971 5:33105412-33105434 ACTTGAAGCCAGGGTCAGCTTGG - Intergenic
992911161 5:81397359-81397381 ACAGGAAGACGCTGTCAGCTTGG + Intergenic
993312618 5:86354762-86354784 ACATGCACACAGTGTTGGCAAGG - Intergenic
994992520 5:107015415-107015437 AAAGGCAGACATTGTCACCTGGG + Intergenic
995487274 5:112651791-112651813 ACCTGGAGTCAGTGTGAGCTGGG - Intergenic
997055495 5:130438595-130438617 ACTTGCAGCCAGGGCCAGCTTGG - Intergenic
997078978 5:130715781-130715803 TGAGGCAGACAGAGTCAGCTGGG + Intergenic
997250942 5:132388078-132388100 GCATGCTGACAGTGGCTGCTGGG - Intronic
999672265 5:153968307-153968329 ACCTACAGACTGTGTGAGCTTGG - Intergenic
1002736147 5:181387788-181387810 ACTTGCAGCCAGGGCCAGCTTGG - Intergenic
1002748551 6:87036-87058 ACTTGCAGCCAGGGCCAGCTTGG + Intergenic
1005249782 6:23931140-23931162 GTATGTAGACAGTGTCAGCACGG - Intergenic
1012676191 6:102115698-102115720 ACTTGCAGCCAGGGCCAGCTCGG - Intergenic
1013255487 6:108380441-108380463 ACTTGCAGCCAGGGCCAGCTTGG - Intronic
1015295217 6:131583574-131583596 ACATTCTGAAAGTGTCAGCTGGG - Intronic
1016175705 6:141075467-141075489 ACTTGTAGCCAGAGTCAGCTTGG - Intergenic
1016220805 6:141668175-141668197 ACTTGCAGGCAGGGCCAGCTTGG + Intergenic
1018401237 6:163422697-163422719 ACATGCAGTGAATGTGAGCTGGG + Intronic
1022609151 7:31851319-31851341 ACATGCAGATGGTGTCAGCTGGG + Intronic
1023024107 7:36035596-36035618 ACACACAGACAGTGTCTGCGGGG - Intergenic
1023148190 7:37173815-37173837 CCAAACAGACAGTGTCTGCTCGG + Intronic
1024298842 7:47869424-47869446 ACATGCAAACAGTAACAGCAAGG + Intronic
1024372311 7:48600362-48600384 AAAGGCAGACATTGTCAGATTGG - Intronic
1024879303 7:54067590-54067612 ACATCCAGACAGTGAGATCTGGG - Intergenic
1030116642 7:106066588-106066610 CCATGGAGACAGTGTGAGCCAGG + Intergenic
1032913524 7:136461295-136461317 ACTTACAGACAGTCTCAGGTGGG + Intergenic
1033432390 7:141300938-141300960 AGAGGCAGACAGGGCCAGCTGGG - Intronic
1034003569 7:147443374-147443396 ACCTGCAGGCAGTGGCAGCATGG - Intronic
1034441798 7:151089394-151089416 ACATAAACACAGTGTCAGCTGGG + Intronic
1034588533 7:152118437-152118459 ACATGCAGACAGTGTCAGCTAGG - Intronic
1035459225 7:159029074-159029096 ACATCCTGTCAGTGTCACCTTGG - Exonic
1035506872 8:144779-144801 ACTTGCAGCCAGGGCCAGCTTGG + Intergenic
1035598328 8:879333-879355 CCAAGCAGACAGTGTCATTTCGG - Intergenic
1037157255 8:15718228-15718250 ACATTCAGACAGAATCAGTTGGG + Intronic
1037644065 8:20774309-20774331 ACATTCAAACAGTGTCACCTGGG + Intergenic
1039745588 8:40423208-40423230 ACAACCTGACAGTGTCAGCGAGG - Intergenic
1041364663 8:57089176-57089198 ACATGAACACAGGGTCAGCGGGG - Intergenic
1041777061 8:61534969-61534991 ACATGCAGACAGTGAGAAGTTGG - Intronic
1042109611 8:65367048-65367070 ACTTGCAGCCAGGGCCAGCTTGG + Intergenic
1042617932 8:70670136-70670158 ACACGCAGACTCTGTCATCTGGG - Intronic
1043171437 8:76972036-76972058 ACTTGCAGCCAGTGCCAGCTTGG + Intergenic
1044875364 8:96660182-96660204 ACATGCAGACACTTTGATCTTGG - Intronic
1053802411 9:41772779-41772801 ACATGCAGACAGGGTCACGCTGG - Intergenic
1053802425 9:41772869-41772891 ACATGCAGACAGGGTCATGCTGG - Intergenic
1053802433 9:41772929-41772951 ACATGCAGACAGGGTCATGCTGG - Intergenic
1054142805 9:61542141-61542163 ACATGCAGACAGGGTCATGCTGG + Intergenic
1054142817 9:61542231-61542253 ACATGCAGACAGGGTCACTCTGG + Intergenic
1054142822 9:61542261-61542283 ACATGCAGACAGGGTCATTCTGG + Intergenic
1054142827 9:61542291-61542313 ACATGCAGACAGGGTCACTCTGG + Intergenic
1054142852 9:61542471-61542493 ACATGCAAACAGTGTCACGCTGG + Intergenic
1054190701 9:61984005-61984027 ACATGCAGACAGGGTCATGCTGG - Intergenic
1054190719 9:61984125-61984147 ACATGCAGACAGGGTCACTCTGG - Intergenic
1054190730 9:61984185-61984207 ACATGCAGACAGGGTCACTCTGG - Intergenic
1054190742 9:61984275-61984297 ACATGCAGACAGGGTCATGCTGG - Intergenic
1054462551 9:65473291-65473313 ACATGCAGACAGGGTCATGCTGG + Intergenic
1054462559 9:65473351-65473373 ACATGCAGACAGGGTCACACTGG + Intergenic
1054647632 9:67603442-67603464 ACATGCAGACAGGGTCATGCTGG + Intergenic
1054647640 9:67603502-67603524 ACATGCAGACAGGGTCATGCTGG + Intergenic
1054647654 9:67603592-67603614 ACATGCAGACAGGGTCACGCTGG + Intergenic
1057106929 9:92427943-92427965 ACAGGTAGCCAGTGTCAGCAGGG + Intronic
1057950636 9:99366526-99366548 AGATGCAGGGAGGGTCAGCTGGG + Intergenic
1059328912 9:113522925-113522947 ATAGGCAAACAGTGTCACCTGGG - Exonic
1061789894 9:133053671-133053693 ACATGCAGGCCCTGTCACCTTGG - Intronic
1062127117 9:134869879-134869901 GCTTGCAGACAGTGGGAGCTCGG - Intergenic
1203601435 Un_KI270748v1:12550-12572 ACTTGCAGCCAGGGCCAGCTTGG - Intergenic
1186179931 X:6963465-6963487 CCAGGCAGACAGTGTCAGGATGG + Intergenic
1187631388 X:21176666-21176688 ACATTCAGTCAGGGTCATCTGGG + Intergenic
1189289367 X:39874382-39874404 ACATGCAAACAGCTTCTGCTTGG + Intergenic
1190115006 X:47620435-47620457 ACATCCACACAGGCTCAGCTAGG + Intergenic
1193026657 X:76852209-76852231 ACTTGCAGTCAGGGCCAGCTTGG - Intergenic
1194897932 X:99468823-99468845 ACTTGCAGTCAGGGCCAGCTTGG + Intergenic
1194923634 X:99796860-99796882 ACTTGCAGCCAGGGCCAGCTTGG - Intergenic
1195628778 X:107032073-107032095 AAATGCAGACAGTTTTAGTTAGG - Intergenic
1197275404 X:124473501-124473523 ACATGCAAAGACTGACAGCTTGG - Intronic
1198602408 X:138297509-138297531 TCATGCTGACAGTGTCAGCAGGG + Intergenic
1200863688 Y:8019890-8019912 GAATGAAAACAGTGTCAGCTGGG + Intergenic
1200935704 Y:8736480-8736502 ACATCCTGACTGTGTTAGCTGGG - Intergenic