ID: 1034589553

View in Genome Browser
Species Human (GRCh38)
Location 7:152128222-152128244
Sequence AGGCGCCCCTGGGCAGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034589553_1034589560 8 Left 1034589553 7:152128222-152128244 CCAGAACCTGCCCAGGGGCGCCT No data
Right 1034589560 7:152128253-152128275 GCCGTGTTGCAGTCGGCCCGTGG No data
1034589553_1034589565 28 Left 1034589553 7:152128222-152128244 CCAGAACCTGCCCAGGGGCGCCT No data
Right 1034589565 7:152128273-152128295 TGGAAACTTACTCCTGAGGCTGG No data
1034589553_1034589566 29 Left 1034589553 7:152128222-152128244 CCAGAACCTGCCCAGGGGCGCCT No data
Right 1034589566 7:152128274-152128296 GGAAACTTACTCCTGAGGCTGGG No data
1034589553_1034589559 1 Left 1034589553 7:152128222-152128244 CCAGAACCTGCCCAGGGGCGCCT No data
Right 1034589559 7:152128246-152128268 GAGTCTAGCCGTGTTGCAGTCGG No data
1034589553_1034589563 24 Left 1034589553 7:152128222-152128244 CCAGAACCTGCCCAGGGGCGCCT No data
Right 1034589563 7:152128269-152128291 CCCGTGGAAACTTACTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034589553 Original CRISPR AGGCGCCCCTGGGCAGGTTC TGG (reversed) Intergenic
No off target data available for this crispr