ID: 1034589738

View in Genome Browser
Species Human (GRCh38)
Location 7:152129070-152129092
Sequence TCCGCAGCTCCCCCGCCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 269}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034589738_1034589744 9 Left 1034589738 7:152129070-152129092 CCTGGCGGCGGGGGAGCTGCGGA 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1034589744 7:152129102-152129124 GTCCGATGTTGAGGGAGAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 114
1034589738_1034589748 18 Left 1034589738 7:152129070-152129092 CCTGGCGGCGGGGGAGCTGCGGA 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1034589748 7:152129111-152129133 TGAGGGAGAAAAGGGCGAGGCGG 0: 1
1: 0
2: 5
3: 95
4: 935
1034589738_1034589742 1 Left 1034589738 7:152129070-152129092 CCTGGCGGCGGGGGAGCTGCGGA 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1034589742 7:152129094-152129116 GCCGCGGAGTCCGATGTTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 37
1034589738_1034589741 0 Left 1034589738 7:152129070-152129092 CCTGGCGGCGGGGGAGCTGCGGA 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1034589741 7:152129093-152129115 GGCCGCGGAGTCCGATGTTGAGG 0: 1
1: 0
2: 0
3: 1
4: 51
1034589738_1034589745 10 Left 1034589738 7:152129070-152129092 CCTGGCGGCGGGGGAGCTGCGGA 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1034589745 7:152129103-152129125 TCCGATGTTGAGGGAGAAAAGGG 0: 1
1: 0
2: 3
3: 13
4: 174
1034589738_1034589749 21 Left 1034589738 7:152129070-152129092 CCTGGCGGCGGGGGAGCTGCGGA 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1034589749 7:152129114-152129136 GGGAGAAAAGGGCGAGGCGGCGG 0: 1
1: 0
2: 1
3: 49
4: 790
1034589738_1034589747 15 Left 1034589738 7:152129070-152129092 CCTGGCGGCGGGGGAGCTGCGGA 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1034589747 7:152129108-152129130 TGTTGAGGGAGAAAAGGGCGAGG 0: 1
1: 0
2: 2
3: 41
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034589738 Original CRISPR TCCGCAGCTCCCCCGCCGCC AGG (reversed) Intergenic
900129520 1:1081495-1081517 TCTGCAGCCCCCACGCAGCCCGG + Intergenic
900427469 1:2587084-2587106 TCCGCAGCTCCACGGCCTGCCGG - Exonic
902271813 1:15310257-15310279 TCCGCAGGACCCAGGCCGCCTGG + Intronic
902313907 1:15603359-15603381 GCCGCAGCACCCCAGCCGCAGGG + Intergenic
903925127 1:26826606-26826628 GCCGCAGCGCCCCCTCCGCCTGG - Intergenic
904485233 1:30820415-30820437 TCAACAGCTCCCCCTCCCCCAGG - Intergenic
904588554 1:31594154-31594176 TCCGCAGCATCCCTGCCCCCTGG + Intergenic
904741107 1:32676533-32676555 ACCGCAACTCCTCCGCCTCCTGG - Intronic
904772213 1:32886635-32886657 TCCCCAGCGCCCCCGCCACCCGG - Intronic
905734705 1:40317094-40317116 TTCGCAGCCCCTCCGCTGCCAGG - Intronic
907904155 1:58769119-58769141 TCCGCAGCTCCATCGCAGCGTGG + Intergenic
911208734 1:95117904-95117926 CCCGCGGCCCCCGCGCCGCCCGG + Exonic
912533017 1:110339886-110339908 TCCGCGCCGTCCCCGCCGCCGGG - Exonic
913144580 1:115976648-115976670 TGCCCATCTCCCCCACCGCCTGG - Exonic
914702988 1:150150503-150150525 CCCGCACCTCCCCCGCCCCCGGG + Intronic
915637084 1:157194916-157194938 TGTGCAGTTCCCCCGCCGGCGGG - Intergenic
916436459 1:164782196-164782218 TCTGCAGCTCCCCCATCCCCCGG - Intronic
918015955 1:180632459-180632481 CCCGCAGCCCCGCTGCCGCCGGG + Intronic
920260539 1:204685271-204685293 TGGGCAGCGCCGCCGCCGCCGGG - Intronic
920501354 1:206487339-206487361 TCCCCAGTTCCTCCGCCTCCGGG + Intronic
920511751 1:206557086-206557108 TCCCCCGCCTCCCCGCCGCCTGG - Intronic
921217554 1:212950683-212950705 GCCCCTGCTCTCCCGCCGCCCGG + Exonic
922726223 1:227924246-227924268 TCCGCAGCCCCCCCACTGCCAGG + Exonic
922845545 1:228681361-228681383 TCCTCAGCTCGCTCCCCGCCAGG - Intergenic
923043140 1:230333950-230333972 TCAGCTGCTCCCCAGCAGCCTGG + Intronic
923934351 1:238745266-238745288 CCCGCAGCTCACCCGCAGCTCGG - Intergenic
1063115196 10:3067722-3067744 TCCGTCCCTCCCTCGCCGCCGGG - Intronic
1063458968 10:6203492-6203514 GCCACAGCGCCCCCGCCGCCCGG - Intronic
1066298422 10:34075966-34075988 TCAGCAGCTTCCCCGACCCCAGG - Intergenic
1066745810 10:38603784-38603806 CCCGCAGCTCCCCAGCTCCCCGG + Intergenic
1069676992 10:70255477-70255499 TCCGCAGCCTCCTCGCCCCCGGG + Exonic
1070693558 10:78545028-78545050 TCAGCAGCTGCCCCGCCCCGGGG - Intergenic
1070895595 10:79981472-79981494 TCCCCAGCCCTCACGCCGCCCGG - Intronic
1071823066 10:89297530-89297552 TCCGCAGCACCCCAGCCCACAGG + Intronic
1073331691 10:102674191-102674213 TCCGCAGCTCCCACGGCTGCTGG - Exonic
1075519429 10:123135210-123135232 GCTGCCGCTCCCCCGCCCCCTGG - Intergenic
1075734779 10:124657916-124657938 TCCACAGCTTCTCCGCAGCCAGG + Intronic
1076020115 10:127065681-127065703 TCCGCAGCTCCTCCAGCTCCAGG + Intronic
1076878950 10:133230780-133230802 CCCCCAGCGCGCCCGCCGCCCGG + Exonic
1076885138 10:133258744-133258766 TCCGCCGCTTCCCCGCTGTCAGG - Intergenic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1077215166 11:1392355-1392377 TCCACAGCTCCCCTGTGGCCAGG - Intronic
1077235089 11:1478142-1478164 CCCACAGCCCCACCGCCGCCAGG + Intronic
1077244151 11:1527896-1527918 CCCCCAGCTCCCCCGGCCCCCGG + Intergenic
1077317690 11:1926714-1926736 GCCGGCGCTCCCCCGCCTCCAGG + Intronic
1077421457 11:2452058-2452080 GCCGTAGCTCACCCGCTGCCAGG - Intronic
1077635832 11:3840904-3840926 CCCCCAGCTCCCCCGCCTCGGGG - Exonic
1082076609 11:47980452-47980474 TGCGGAGCTCCGCAGCCGCCGGG + Intergenic
1083278576 11:61611410-61611432 TCCGCTGCCCCCTCGCAGCCAGG + Intergenic
1083665373 11:64271406-64271428 TCCCCAGCTCTTCCCCCGCCTGG - Intronic
1083824134 11:65188702-65188724 CGCGGTGCTCCCCCGCCGCCAGG - Exonic
1083933611 11:65859253-65859275 TCCACAGCACCGCCCCCGCCCGG + Exonic
1084385204 11:68839410-68839432 TCAGCAGCAGCCCCGCCCCCAGG + Intronic
1084972909 11:72781358-72781380 TCTCCAGCTCCCCACCCGCCAGG - Intronic
1086993444 11:93330648-93330670 GCCGCCGCGCTCCCGCCGCCTGG - Intronic
1089521730 11:119068991-119069013 TCCGCACCCCCCCCCCCCCCCGG + Intronic
1089800642 11:121024261-121024283 GCAGTAGCTCCCCCGCCTCCCGG + Exonic
1090204737 11:124878019-124878041 TCTGCAGCTCCTCCCCCGCTGGG - Exonic
1091227302 11:133965219-133965241 TCCGCTGCTACCCCGCTGCCCGG + Intergenic
1091408155 12:221604-221626 TCCCCCGCTCCCCAGCAGCCTGG + Intronic
1092243800 12:6851862-6851884 TCCGCAGCTGCTCCGGCTCCGGG - Exonic
1092261368 12:6955004-6955026 GCAGAGGCTCCCCCGCCGCCTGG - Intronic
1095953723 12:47795236-47795258 GCCACCGCTCCCCCACCGCCGGG - Exonic
1096547212 12:52348288-52348310 TCCACAGCTCTCCCGCCTTCTGG - Intergenic
1097854908 12:64452154-64452176 TCCGCCGCGCCACCGCCGGCGGG - Exonic
1100469056 12:94873828-94873850 TCCGCGCCTCCGCCGCAGCCCGG - Intergenic
1102278342 12:111599339-111599361 TCCGCCGCCCCTCCCCCGCCCGG - Exonic
1102587379 12:113932818-113932840 CCCCCAACTCCCCCGCCCCCAGG - Intronic
1105454257 13:20525831-20525853 CTCGCAGCTCCGCCGGCGCCTGG - Exonic
1105508633 13:21032909-21032931 TCTGCACCTCCCCTGCCACCAGG - Intronic
1105809330 13:23980339-23980361 CCCGCGGCTCCTCCGTCGCCCGG - Intronic
1108355513 13:49625753-49625775 ACCCCAGCTCCCCCACCCCCAGG + Intergenic
1112091688 13:96090445-96090467 GCCGCAGCTACCCGGCTGCCCGG + Intergenic
1112344234 13:98576931-98576953 GCCGCTGAGCCCCCGCCGCCCGG - Intronic
1112456248 13:99566303-99566325 TCCTCAGCGCCCCCACCACCTGG + Intergenic
1113841716 13:113364523-113364545 CCCGCAGAACCCCCGCGGCCTGG + Intergenic
1114516127 14:23301464-23301486 TCCGGAGCTCCGCCACTGCCCGG + Exonic
1115399328 14:32939445-32939467 TCCGCAGCCCGCCCGCCTCCTGG + Intronic
1115576169 14:34714390-34714412 TCCGCTGCTCTCCAGCCGACCGG - Intronic
1117029341 14:51652290-51652312 TCCACGCCTCCCCCGCTGCCGGG - Intronic
1117251911 14:53947014-53947036 TCCACACCCCCCTCGCCGCCGGG - Intergenic
1118345909 14:64940664-64940686 TCCTCAACTCCCCCTCCCCCTGG - Intronic
1119325948 14:73759679-73759701 GCCACAGCTCGCGCGCCGCCTGG + Intronic
1121050358 14:90816049-90816071 GCCGCAGCTCCCTCGCGGCCCGG + Intronic
1122117158 14:99533588-99533610 TCAGCAGCTCCCCAGCCATCAGG + Intronic
1122717942 14:103706620-103706642 TCCCCGGGTGCCCCGCCGCCAGG - Intronic
1122736759 14:103847763-103847785 TCCGCCCCTCCCCCGCCGCCGGG - Intergenic
1122959195 14:105086916-105086938 CCCGGAGCTGCCCTGCCGCCTGG + Intergenic
1124014558 15:25864097-25864119 TCCTCGCCTCCCCCGCCGTCCGG - Intronic
1128156714 15:65396071-65396093 GCCGCGGCTCCCCCGACGCGCGG + Exonic
1128609840 15:69064834-69064856 TCCGCAGCTCCACTGCCCCCTGG + Intergenic
1129322257 15:74781977-74781999 CCCGCAGTGCCCCCGGCGCCCGG + Intergenic
1130370570 15:83283324-83283346 CCCGGAGCCCCGCCGCCGCCTGG - Intronic
1131049110 15:89334697-89334719 TCTGCTGCTCCCCCGACCCCAGG + Exonic
1131107178 15:89743227-89743249 TCCCCAGCTCCCGAGCCCCCAGG - Intronic
1132741273 16:1414515-1414537 TCCGCCGCCCCCGCGCCCCCCGG - Intronic
1132959214 16:2612843-2612865 GCCTCAGCTCCCCGGCCTCCAGG + Intergenic
1132972274 16:2694818-2694840 GCCTCAGCTCCCCGGCCTCCAGG + Intronic
1133201195 16:4205678-4205700 TCAGCAGCTCCCCAGCACCCAGG - Intronic
1136109739 16:28057269-28057291 CCCGCAGCTCCCCCTGCTCCTGG - Intronic
1136453863 16:30369856-30369878 GCCGCAGCTCCCCTCCGGCCCGG - Exonic
1137748675 16:50842140-50842162 ACCGCAGCTTCCCCACCTCCAGG - Intergenic
1139402945 16:66696662-66696684 GCCGCCTCTCGCCCGCCGCCCGG + Exonic
1139949749 16:70663179-70663201 TCCACAGCCGCCCCGCCTCCTGG + Exonic
1139955358 16:70690549-70690571 ACCTCAGCTCCCCCACCCCCTGG - Intronic
1141686840 16:85575040-85575062 TCCCCCTCTCCCCCGCCCCCCGG + Intergenic
1141910223 16:87053582-87053604 TGCGCAGCTCCCCTGCTGGCGGG - Intergenic
1142310179 16:89307657-89307679 GATGCAGCTCCCCCGCCGCCTGG + Intronic
1143119507 17:4598185-4598207 TCCACAGCTCCCTCCCTGCCAGG - Intronic
1143502568 17:7347777-7347799 GCCGCAGCTGCCCTGCCTCCTGG + Intronic
1144504315 17:15817290-15817312 TCCGCAGCTCCACTGCCCGCAGG - Intergenic
1144634068 17:16892958-16892980 TCCGCAGCTCCACTGCCCGCAGG - Intergenic
1144725349 17:17499115-17499137 TTCCCAGCACTCCCGCCGCCTGG + Intergenic
1145168172 17:20632799-20632821 TCCGCAGCTCCACTGCCCGCAGG - Intergenic
1145912893 17:28552633-28552655 TCCGCAGCCCCGCCCCCGGCCGG + Exonic
1146142323 17:30378910-30378932 TCCGGCGGGCCCCCGCCGCCCGG + Exonic
1146229487 17:31095282-31095304 TCCGCCGCCCCCCGGCCGCGGGG + Exonic
1146277785 17:31525969-31525991 TCAGCAGCCCACCAGCCGCCAGG - Intronic
1147150469 17:38510973-38510995 TCCCCACCTCCCGCGCCGCTCGG + Exonic
1148733385 17:49851252-49851274 GCCGCAGCCCACCCGCCGCCGGG - Intergenic
1148852251 17:50560965-50560987 TCCTCCCCTCCCCCGCCGCCTGG + Intergenic
1149491978 17:57091566-57091588 TCCCCAGCTCCCCAGCTCCCCGG - Intronic
1150692277 17:67377139-67377161 TCCGGAGCAGCCCCGCCGTCTGG + Intergenic
1151408800 17:73907183-73907205 TCCTCAGGCCCCCCGTCGCCGGG - Intergenic
1151740532 17:75979132-75979154 TCCGCAGCTCCAGCGCCGGCCGG + Exonic
1152031432 17:77845823-77845845 TCCTCAGCTCCCCAGCTGCCAGG - Intergenic
1152248311 17:79197907-79197929 TCCTCACCTCCCCCGACTCCGGG + Intronic
1152443803 17:80328230-80328252 GCCGCACCTTCCCCGCCACCAGG - Intronic
1152453810 17:80401210-80401232 TCCTCAGCTCGCTCCCCGCCAGG + Intergenic
1154132891 18:11751649-11751671 TCCGCTGCGCCGCGGCCGCCTGG - Intronic
1154173771 18:12068424-12068446 TCCGCGCCGCCGCCGCCGCCGGG + Intergenic
1155152917 18:23136281-23136303 GCCACTGCTCCCCCGACGCCCGG - Exonic
1157833621 18:50879217-50879239 TGCTCAGCTCCCGCGCCGCCCGG - Exonic
1158437094 18:57441421-57441443 ACCGCAGCTCCTCCCCCGCGAGG + Intronic
1159224434 18:65514100-65514122 TCACCACCTCCCTCGCCGCCAGG + Intergenic
1159579744 18:70221445-70221467 TCTGCACCTCCCCCTCCACCCGG - Intergenic
1160719085 19:589812-589834 CCCGCCCCTCCCCCGCCGCGAGG + Intergenic
1161396602 19:4047917-4047939 AGCCCAGCTCCCCCGACGCCCGG - Exonic
1161435097 19:4258367-4258389 TCCGCCGCTCCTCCTCCGACAGG - Exonic
1161735582 19:5990460-5990482 TCCCCAGCTCCTCCTCGGCCGGG - Intergenic
1163015141 19:14450328-14450350 TGCGCAGCTCCACAGCCCCCAGG - Exonic
1163243373 19:16077270-16077292 CCCCCATCCCCCCCGCCGCCTGG - Intronic
1163445153 19:17341589-17341611 CCCGCAGCGCCTCTGCCGCCAGG - Exonic
1163586781 19:18168652-18168674 TCCGAGGCTCCCCAGCTGCCTGG - Intronic
1163641603 19:18465454-18465476 TCCGCGTCTCCTCCTCCGCCTGG + Exonic
1163807078 19:19405923-19405945 TCCCCGGCCCCTCCGCCGCCCGG + Intronic
1164972542 19:32544886-32544908 TCCACAGCTCCCAGGCCTCCTGG + Intergenic
1166199363 19:41226393-41226415 CCCGCAGCCCCCGCGCCGCCCGG - Intronic
1166812477 19:45522507-45522529 GCCCCAGCTCCCCCACCACCAGG - Exonic
1168088205 19:54063849-54063871 GCCGCAGCTCTCCGGCTGCCCGG + Exonic
1168298209 19:55388221-55388243 TGCTCTGCTCCCCCGCCCCCAGG + Intronic
925030980 2:649630-649652 TTCTCAGCTGCCCCGCCGCGGGG - Intergenic
925072944 2:985493-985515 TCCCCAGCTCCCCCTCTGCTGGG + Intronic
927216570 2:20670835-20670857 GCCGCAGAGCCCCCTCCGCCCGG - Exonic
928180873 2:29067374-29067396 TCCCCAGCACCCCTGCCCCCAGG - Intronic
932263685 2:70347787-70347809 TCCCCAGCTCCCCTGCCCCCAGG - Intergenic
932420896 2:71600791-71600813 CCAGCAGCTCCCCCGACGGCTGG - Exonic
932702753 2:74002571-74002593 TCGGCTGCGCCCCCGCCTCCCGG + Intronic
934754648 2:96816644-96816666 TCCTCAGCCGCCCCGCCACCCGG - Exonic
934936808 2:98471749-98471771 GCCGCAGCCCCCTAGCCGCCAGG + Intronic
938364671 2:130725672-130725694 TCTCCAGCCCCCCCGCCCCCGGG - Intergenic
940453756 2:153871924-153871946 TCAGCAGAGCCGCCGCCGCCTGG - Exonic
944271169 2:197786180-197786202 TCCGCTTCTCCCCACCCGCCAGG - Exonic
944766653 2:202871508-202871530 CCCGCCGCGCCCCCGCCTCCCGG + Intronic
945274257 2:207972344-207972366 TCCACCGCCCCCCCGCCCCCCGG - Intronic
946155803 2:217805994-217806016 ACCCCAGCTCCCCCACCACCTGG - Intronic
946188351 2:217994342-217994364 TCTGCACCTCCCCCACCCCCAGG - Intronic
946431766 2:219630146-219630168 TCCCCAGCTCCCCCAGCCCCCGG + Exonic
947119342 2:226799538-226799560 TCCCCTCCTCCCCAGCCGCCTGG - Exonic
948574071 2:238938537-238938559 TCCCCAGCTCAGCCGCCACCCGG - Intergenic
948963277 2:241356475-241356497 GCCTCAGCGCCCCCCCCGCCTGG - Intronic
1170969571 20:21104578-21104600 TCCGAAGCTGCCCCGCGTCCTGG - Intergenic
1171122441 20:22578527-22578549 TCCGCAGCCCGCCCGCCAGCCGG - Intergenic
1171346616 20:24470239-24470261 TCCCCAGCTCCGTGGCCGCCCGG - Intronic
1172061551 20:32190217-32190239 GCCGCGGCGCGCCCGCCGCCCGG - Intergenic
1172317458 20:33967295-33967317 TACCCAGCTCCCCCGCCACTGGG + Intergenic
1172703234 20:36864946-36864968 TCCCCAGCCCCCACACCGCCTGG + Intergenic
1175108605 20:56630706-56630728 TGCGCACCTCCCCCGCCCCCGGG - Intronic
1175395125 20:58652327-58652349 GCCGCAGCTCCACCTCTGCCCGG + Intronic
1175399665 20:58693131-58693153 GCCGCACCCCCGCCGCCGCCGGG + Intronic
1175521231 20:59604052-59604074 TCCCCCGCCCCCCCGCCCCCCGG + Intronic
1175847426 20:62065942-62065964 ACCCCCGCTCCCCCGCCCCCCGG - Intergenic
1176298751 21:5088560-5088582 CCAGCAGCTCCCCAGCCCCCAGG + Intergenic
1176547862 21:8209195-8209217 TCCGCCTCTCGCTCGCCGCCCGG + Intergenic
1176555753 21:8253397-8253419 TCCGCCTCTCGCTCGCCGCCCGG + Intergenic
1176574690 21:8436431-8436453 TCCGCCTCTCGCTCGCCGCCCGG + Intergenic
1176611304 21:8987724-8987746 TCCGCCTCTCGCTCGCCGCCCGG + Intergenic
1179209430 21:39313182-39313204 TCCCCAGTGTCCCCGCCGCCGGG - Intronic
1179796807 21:43789707-43789729 TCCGGAGCTTCCTCACCGCCCGG - Exonic
1179858275 21:44173389-44173411 CCAGCAGCTCCCCAGCCCCCAGG - Intergenic
1180737013 22:18024616-18024638 GCCGCAGCTCCGCGGCCTCCTGG - Intergenic
1181494079 22:23278159-23278181 TGCTCAGCACCCCCTCCGCCTGG + Intronic
1183587657 22:38762406-38762428 TCCTCAGCTCCCTCAGCGCCAGG + Intronic
1184640409 22:45867330-45867352 CCCCCAGCACCTCCGCCGCCCGG + Intergenic
1184759547 22:46536975-46536997 CCAGCAGCTCCCGCGGCGCCCGG + Exonic
1203252738 22_KI270733v1_random:125482-125504 TCCGCCTCTCGCTCGCCGCCCGG + Intergenic
1203260794 22_KI270733v1_random:170568-170590 TCCGCCTCTCGCTCGCCGCCCGG + Intergenic
949877082 3:8633612-8633634 CCCCCAGCTCCCCAGCCCCCCGG + Intronic
949993743 3:9600675-9600697 GCCCCAGCGCCCCCGCCCCCCGG - Intergenic
950097450 3:10338223-10338245 GCCGCAGCTCCCGCTCCGCGTGG + Exonic
950549079 3:13655471-13655493 GCCGGAGGTCGCCCGCCGCCAGG + Intergenic
953485069 3:43286896-43286918 CCCGCCGCCGCCCCGCCGCCAGG - Intronic
953766320 3:45746515-45746537 CACGCTGCTCCCCCGCCGGCAGG - Intergenic
954610383 3:51941921-51941943 CTCCCAGCTCCCCAGCCGCCTGG + Exonic
954809862 3:53241176-53241198 TCAGCAGCTCCGCCTCGGCCAGG + Exonic
954871282 3:53769259-53769281 TCAGCAGCTCCACCTCCTCCAGG - Intronic
955368788 3:58333131-58333153 CCCGCAGCCCCCTCGCGGCCCGG - Intronic
956192287 3:66619528-66619550 ACCCCAGCTCCCCTGCCTCCTGG - Intergenic
956669338 3:71671653-71671675 CACGCAGCCGCCCCGCCGCCCGG - Intergenic
963043911 3:141088654-141088676 CCCCCAGCTCCCCAGCCTCCAGG + Intronic
963087912 3:141455606-141455628 TCCACAGGTGCCCCGCCGCACGG + Intergenic
964786291 3:160399901-160399923 TCGGCCGCTCCCCGGCGGCCCGG + Intronic
965881656 3:173395655-173395677 TCCGCAGCGCCCGCGGCGGCAGG - Intergenic
968230786 3:197003436-197003458 TCCCCAGCGGCCCCGGCGCCCGG - Exonic
969487074 4:7478324-7478346 TCACCAGCTCCCCCTCCTCCAGG + Intronic
978384471 4:108166944-108166966 CCCGCACCGCCCCCGCAGCCCGG + Intronic
981532517 4:145765859-145765881 TCCCCAGCTCCCCCACTGCTGGG + Intronic
982985783 4:162203807-162203829 GCCTCAGCTGCCCCGCCGCGGGG + Intergenic
985537733 5:474151-474173 TCCGCAGCTCCTCTCCCTCCAGG - Intronic
985537779 5:474354-474376 TCCGCAGCTCCTCTCCCTCCAGG - Intronic
985537824 5:474557-474579 TCCGCAGCTCCTCTCCCTCCAGG - Intronic
985537848 5:474654-474676 TCCGCAGCTCCTCTCCCTCCAGG - Intronic
985537870 5:474755-474777 TCCGCAGCTCCTCTCCCTCCAGG - Intronic
985537887 5:474825-474847 TCCGCAGCTCCTCTCCCTCCAGG - Intronic
985541181 5:488489-488511 CCTGCAGCTGCCCCGCGGCCCGG - Intronic
985604166 5:849693-849715 TCCCCAGTGCCCCCGCAGCCAGG - Intronic
986330695 5:6714191-6714213 GCCGCGTCGCCCCCGCCGCCCGG + Intergenic
989103460 5:37840137-37840159 TCCTCTCCTCCCCCACCGCCAGG - Intergenic
990041076 5:51379267-51379289 TTCGCAGCTGCCCCGATGCCGGG + Intergenic
990383002 5:55233772-55233794 GCTGCAGCTCCCCCTCCCCCCGG - Intergenic
992528142 5:77630839-77630861 GCCCCAACTCCCCAGCCGCCGGG - Intronic
992828024 5:80569279-80569301 TGCGCCGCTCGCCCGCCGGCCGG + Intronic
994525935 5:100904445-100904467 TCCCCAGCTCCCTGGTCGCCAGG + Intergenic
999696178 5:154190452-154190474 TCGGCGGCTCCCCCGCCCTCTGG - Intronic
1001257163 5:170192931-170192953 CCCCCGGCTCCCCCACCGCCTGG + Intergenic
1002082302 5:176744305-176744327 TCCCCAGCGCCCCCGGTGCCAGG + Intergenic
1002415913 5:179121033-179121055 CGCACAGCTCCCCCGCCGCAGGG - Intronic
1003290441 6:4775582-4775604 CCCGCAGCTCCCCCCACGCCAGG - Intronic
1003640591 6:7871995-7872017 CCCCCACCACCCCCGCCGCCAGG - Intronic
1005968349 6:30742783-30742805 TCCGCAGCCCGCCCGCCCGCTGG + Intergenic
1006071067 6:31498286-31498308 CCCGCCGCTCCCGCTCCGCCGGG - Intronic
1006471973 6:34234891-34234913 TCCGCACCTCCCCAGCCGCCAGG + Intergenic
1006834053 6:36986160-36986182 TCCGAAGCTCCCATGGCGCCCGG + Exonic
1006834093 6:36986261-36986283 TCCCGAGCTCCCCCGCGGCCTGG - Exonic
1007533547 6:42564282-42564304 TCCCCAGCGCTACCGCCGCCCGG - Exonic
1013372636 6:109483479-109483501 GCCGCGGCTCCCCCGACCCCAGG - Intergenic
1016796710 6:148125596-148125618 TCAGCAGCTCTCCCTCCCCCAGG - Intergenic
1017922991 6:158887442-158887464 TCCTCAGCTCGCTCCCCGCCAGG - Intronic
1018915689 6:168131096-168131118 TCCGCACCTCCCCTGCGCCCTGG - Intergenic
1019112074 6:169724453-169724475 GCCTCAGCCCCGCCGCCGCCTGG + Intronic
1019547946 7:1587397-1587419 TCCACAGCCCCTCCGCGGCCGGG - Intergenic
1020278346 7:6637635-6637657 GCGGCAGCGCCCCCGCCTCCCGG + Intronic
1025959065 7:66205013-66205035 CCCGCGGCTCCCCTGCAGCCAGG + Intergenic
1029448243 7:100626831-100626853 GCCGCAGCTTTTCCGCCGCCCGG + Exonic
1031051870 7:116953413-116953435 CCCGGAGCCCGCCCGCCGCCGGG - Exonic
1032193937 7:129779385-129779407 TCCGCAGCCCCCTCCCAGCCTGG + Intergenic
1034339268 7:150341525-150341547 TGCGCAGCTGCCCCTCCGCCCGG + Exonic
1034447865 7:151122619-151122641 GCCGCCGCTCCCCAGGCGCCTGG + Intronic
1034589738 7:152129070-152129092 TCCGCAGCTCCCCCGCCGCCAGG - Intergenic
1034687747 7:152988240-152988262 TCCCCATCTCCCCCGTCCCCAGG - Intergenic
1035048536 7:155984640-155984662 TCTGCAGCTCCCCTACCTCCTGG + Intergenic
1036294978 8:7528352-7528374 CCCGCATCTCCCCTGCCTCCAGG - Intergenic
1036327586 8:7792639-7792661 CCCGCATCTCCCCTGCCTCCAGG + Intergenic
1036454224 8:8893484-8893506 CCCGCAGCATGCCCGCCGCCGGG - Exonic
1036664880 8:10731504-10731526 ACCGCAGCTCCCCTGTCACCCGG + Intronic
1036723731 8:11201070-11201092 GCCGCAGCGCCGCCGCCGACGGG - Exonic
1040081880 8:43292889-43292911 TCCTCAGGTCCCACGCCACCCGG + Intergenic
1045516139 8:102863154-102863176 ACCGGGGCTTCCCCGCCGCCAGG + Intronic
1048333243 8:133485366-133485388 TCTGCAGCTGCCCCGCTGCCTGG - Intronic
1049527132 8:143133059-143133081 TCCCCAGCCCCACCGTCGCCTGG + Intergenic
1049664229 8:143835906-143835928 GCCGCTGCCCACCCGCCGCCTGG + Intronic
1053066449 9:35072447-35072469 GCCGCTGCTCGCCCACCGCCTGG - Exonic
1053552773 9:39101652-39101674 TGCGCACCTCCCCCGCGGCCAGG - Intronic
1053816895 9:41921838-41921860 TGCGCACCTCCCCCGCGGCCAGG - Intronic
1053933348 9:43127877-43127899 CCCGGAGCTCCCACGCCGCTGGG - Intergenic
1054107148 9:61065497-61065519 TGCGCACCTCCCCCGCGGCCAGG - Intergenic
1054394489 9:64639565-64639587 CCCGGAGCTCCCACGCCGCTGGG - Intergenic
1054429138 9:65144764-65144786 CCCGGAGCTCCCACGCCGCTGGG - Intergenic
1054613709 9:67265628-67265650 TGCGCACCTCCCCCGCGGCCAGG + Intergenic
1055611689 9:78031330-78031352 GCCGCCGAGCCCCCGCCGCCCGG + Exonic
1060051749 9:120383139-120383161 TCCTCCTCACCCCCGCCGCCAGG + Intergenic
1060478012 9:123999897-123999919 TCCTCGGCTCCCCGGGCGCCGGG + Intergenic
1060498802 9:124137380-124137402 TCCTCAGCTGCCTCGCAGCCAGG + Intergenic
1060916890 9:127397276-127397298 CCCGGAGCTCACCTGCCGCCAGG - Exonic
1061288089 9:129635634-129635656 TCAGCAGCACCCTCCCCGCCGGG - Exonic
1062571524 9:137188034-137188056 TCAGAACCTCCACCGCCGCCCGG + Exonic
1062659219 9:137619408-137619430 TCCGCACCTCCCCGGCACCCTGG - Intronic
1203469141 Un_GL000220v1:108633-108655 TCCGCCTCTCGCTCGCCGCCCGG + Intergenic
1203476962 Un_GL000220v1:152605-152627 TCCGCCTCTCGCTCGCCGCCCGG + Intergenic
1185599621 X:1329919-1329941 TCCGCTGCTCTTCCGCAGCCTGG - Intergenic
1186310060 X:8308083-8308105 TCCCCACCTCCCCCTCCCCCAGG - Intergenic
1188007109 X:25022945-25022967 CCCGGAGCTCCCCTGCCCCCGGG - Intergenic
1189381864 X:40507746-40507768 ACCTCAGCTCCCTCGCCCCCAGG - Intergenic
1193235076 X:79096644-79096666 TCCTTAGCTCTCCCCCCGCCAGG - Intergenic
1195156061 X:102125734-102125756 CTCGCTGCTCCCCCGCCGCCTGG - Exonic
1195158055 X:102142403-102142425 CTCGCTGCTCCCCCGCCGCCTGG + Exonic
1195308402 X:103607986-103608008 CTCGCTGCTCCCCCGCTGCCCGG - Intronic
1197980999 X:132217923-132217945 TCCGCACCCGCCCGGCCGCCGGG + Exonic
1202378663 Y:24258910-24258932 GCCCCCGCTACCCCGCCGCCAGG - Intergenic
1202492119 Y:25411211-25411233 GCCCCCGCTACCCCGCCGCCAGG + Intergenic