ID: 1034590549

View in Genome Browser
Species Human (GRCh38)
Location 7:152134382-152134404
Sequence GGCAAGCTCCATGGTGGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034590538_1034590549 26 Left 1034590538 7:152134333-152134355 CCTCCCATCTAAAAAAGTCACCT No data
Right 1034590549 7:152134382-152134404 GGCAAGCTCCATGGTGGACTAGG No data
1034590544_1034590549 -10 Left 1034590544 7:152134369-152134391 CCCCTCACTAGAAGGCAAGCTCC No data
Right 1034590549 7:152134382-152134404 GGCAAGCTCCATGGTGGACTAGG No data
1034590541_1034590549 6 Left 1034590541 7:152134353-152134375 CCTGTTTTTGTCCGTGCCCCTCA No data
Right 1034590549 7:152134382-152134404 GGCAAGCTCCATGGTGGACTAGG No data
1034590539_1034590549 23 Left 1034590539 7:152134336-152134358 CCCATCTAAAAAAGTCACCTGTT No data
Right 1034590549 7:152134382-152134404 GGCAAGCTCCATGGTGGACTAGG No data
1034590540_1034590549 22 Left 1034590540 7:152134337-152134359 CCATCTAAAAAAGTCACCTGTTT No data
Right 1034590549 7:152134382-152134404 GGCAAGCTCCATGGTGGACTAGG No data
1034590536_1034590549 30 Left 1034590536 7:152134329-152134351 CCCACCTCCCATCTAAAAAAGTC No data
Right 1034590549 7:152134382-152134404 GGCAAGCTCCATGGTGGACTAGG No data
1034590537_1034590549 29 Left 1034590537 7:152134330-152134352 CCACCTCCCATCTAAAAAAGTCA No data
Right 1034590549 7:152134382-152134404 GGCAAGCTCCATGGTGGACTAGG No data
1034590543_1034590549 -5 Left 1034590543 7:152134364-152134386 CCGTGCCCCTCACTAGAAGGCAA No data
Right 1034590549 7:152134382-152134404 GGCAAGCTCCATGGTGGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034590549 Original CRISPR GGCAAGCTCCATGGTGGACT AGG Intergenic
No off target data available for this crispr