ID: 1034591534

View in Genome Browser
Species Human (GRCh38)
Location 7:152144141-152144163
Sequence ATTCCATTCTGAGACATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034591534 Original CRISPR ATTCCATTCTGAGACATCCA AGG Intronic
900736631 1:4303304-4303326 ATTCCATTCTTCCACATCCCCGG + Intergenic
900756994 1:4442916-4442938 ATTCCCTTGTGAGGCTTCCACGG + Intergenic
901531072 1:9852847-9852869 ATTCCCTCCTGGGGCATCCAGGG - Intronic
902103225 1:14011147-14011169 ATTCCATCCTGGGACACCAAGGG - Intergenic
908013747 1:59810404-59810426 TATCCATTCTGAGACATTCAGGG + Intergenic
909455620 1:75845655-75845677 ACTCCAATCTGAGAAAGCCATGG - Intronic
916193163 1:162198448-162198470 ATCCCATTCTGACATTTCCAGGG + Intronic
920172497 1:204080559-204080581 ATTCCATTCTGAGTCAAGCAGGG - Intronic
920691641 1:208151344-208151366 ATTCTATCCTGAAACAACCAGGG - Intronic
920834430 1:209495912-209495934 ATGACATTTTAAGACATCCAAGG + Intergenic
924355803 1:243174204-243174226 AATCTATTCTGTGACATCCAGGG - Intronic
924413355 1:243830842-243830864 AGTCCATTCTGGGACAATCAGGG + Intronic
1062812098 10:474641-474663 CTTCCTTTCTGAAACATTCAAGG - Intronic
1063930897 10:11027643-11027665 GTTCCATTCTACGACATACAGGG - Intronic
1065530189 10:26661558-26661580 ATTCGATGCTTTGACATCCAGGG - Intergenic
1067171439 10:43910175-43910197 ACTCCATTCTGTGACAAGCAGGG - Intergenic
1072099916 10:92219357-92219379 ATTGAATACTGAGACATCAAAGG - Intronic
1074762851 10:116680360-116680382 ATTCCAATCCAAGACATCCAAGG + Intronic
1075444397 10:122503739-122503761 ATTCCTTTCACAGAAATCCAGGG + Intronic
1075701413 10:124471922-124471944 ATTCCATTCTGAGCTAGACACGG - Intronic
1076089040 10:127663201-127663223 ATTCTATTCTGATAAATCAAGGG + Intergenic
1077243303 11:1523281-1523303 ATGCCATGCTGAGACTTGCAGGG - Intergenic
1079163457 11:18014596-18014618 AATCCGTTCTGAGAAATACAAGG + Intergenic
1079872215 11:25813519-25813541 TTTACATTCTAAGATATCCATGG - Intergenic
1084748099 11:71186030-71186052 CTGCCTTTCTGAGTCATCCATGG + Intronic
1085131036 11:74038839-74038861 CTTCTATTCTGAGACGCCCATGG - Intronic
1086325019 11:85689893-85689915 ATTCCCTTCCCAGAGATCCAAGG + Intergenic
1086536461 11:87852843-87852865 AAACAATTCTGAGACACCCATGG - Intergenic
1087371920 11:97294908-97294930 ATTTCAGTCTGAAACATCTAGGG - Intergenic
1088246183 11:107820357-107820379 CTGCAATTCTGAGACTTCCAGGG - Intronic
1089845685 11:121456194-121456216 ATTCCATTCTTTAACATCCAAGG + Intronic
1091401411 12:182725-182747 CTTTCCTTCTGAGACATCTAGGG + Intergenic
1096319177 12:50596063-50596085 ATTCTAGTCTGAGAAGTCCATGG + Intronic
1096752720 12:53772312-53772334 AATCCTTGCTGAGGCATCCAGGG + Intergenic
1097636319 12:62126630-62126652 ATTCCATGCTGAGAGAATCAAGG + Intronic
1098928429 12:76380408-76380430 ATTTCATTCTGAGCCAGGCATGG + Intronic
1099304841 12:80940391-80940413 ATTTCGTTTTGAGACATGCAGGG + Intronic
1099873186 12:88372865-88372887 ATTGCATCCTTAGATATCCATGG + Intergenic
1104093495 12:125535667-125535689 ATTCTTTTCTGAGACAGACAAGG + Intronic
1105937477 13:25115591-25115613 AATCCTTTCTGTGTCATCCAAGG - Intergenic
1107328565 13:39272060-39272082 ATTCCATTCTGCCACTTCCTGGG + Intergenic
1111083113 13:83337920-83337942 ATTCCATGATGTGACTTCCAAGG + Intergenic
1111722349 13:91962619-91962641 TTTCCATTATGACTCATCCATGG + Intronic
1113207026 13:107929003-107929025 TTGTCATACTGAGACATCCAGGG - Intergenic
1114331618 14:21642725-21642747 ATTTCCTACTGAGAAATCCACGG - Intergenic
1114334645 14:21675802-21675824 CAGCCATTCTGAGACATCAAAGG - Intergenic
1116710466 14:48361409-48361431 ATTACATTTTGAGACATGAAAGG - Intergenic
1117205207 14:53435345-53435367 ATTCCATTGTGAAACATTTAAGG - Intergenic
1117732698 14:58739852-58739874 ATTACATGCTGAGATGTCCATGG + Intergenic
1117900720 14:60529777-60529799 ATTACATTCTGAGACACAGAAGG + Intergenic
1119183864 14:72622782-72622804 ATCCCATTCTCGGATATCCAGGG + Intronic
1119886792 14:78150288-78150310 ATTTCATGCTGAGCCATGCACGG + Intergenic
1120655733 14:87187912-87187934 ATTCCAAAATGAGACATGCACGG + Intergenic
1120690932 14:87591549-87591571 AATCCAATCTGAGACTTCCTGGG - Intergenic
1121075418 14:91064189-91064211 GTTTAATTTTGAGACATCCAGGG + Intronic
1121609599 14:95268343-95268365 ATTCCCTTCAGATACATCCAAGG - Intronic
1124658277 15:31525751-31525773 ATTCCATACTAGAACATCCAAGG + Intronic
1127673025 15:61213559-61213581 ATTCCAGGCTGAGGCACCCAAGG - Intronic
1128085807 15:64885950-64885972 ATTCAACTCTGTGACATCCCTGG + Intronic
1129494587 15:75966173-75966195 ATTCGATTCTGTGGCATTCAAGG + Intronic
1132436029 15:101803335-101803357 AATTCATTCTGTGCCATCCACGG - Intergenic
1135160911 16:20095449-20095471 ACTTCATTCTTAAACATCCATGG - Intergenic
1135954698 16:26946500-26946522 ATTTCAATCTCAGATATCCAAGG + Intergenic
1138183329 16:54957911-54957933 ATTCCATTCACAGGCATGCAGGG - Intergenic
1138422222 16:56906505-56906527 AGTCAATCCTCAGACATCCAGGG - Intronic
1140861159 16:79019241-79019263 ATGCAATTCTGAGAAATGCATGG + Intronic
1141134186 16:81455160-81455182 CTTCCAATCTGTGACATCCCGGG - Intronic
1144160815 17:12555932-12555954 TATCCATTCTTAGACAGCCAGGG + Intergenic
1146135329 17:30315286-30315308 ATTCCATACTGAGGTTTCCAAGG + Intergenic
1148877783 17:50701908-50701930 ATGTCACTCTGAGACATCAATGG - Intronic
1150917628 17:69452382-69452404 ATTCAATACTCAGACATCCAAGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1152923357 17:83076868-83076890 AGTCCCTTCCCAGACATCCAGGG + Intergenic
1160152456 18:76405660-76405682 CATCCCTTCAGAGACATCCACGG + Intronic
1162190955 19:8946385-8946407 AATCCACTCGGAGCCATCCAAGG - Exonic
1164611799 19:29637361-29637383 ATTCCATTGTGGGCCACCCATGG - Intergenic
925753101 2:7107600-7107622 ACTCCATTCTGAAGCAGCCAAGG + Intergenic
926757662 2:16249325-16249347 CTTCCATTGTGAGACCTCCGTGG + Intergenic
927232298 2:20835809-20835831 GTTCCATTCTGAAGCTTCCAGGG + Intergenic
928451667 2:31383574-31383596 ATTCATTGCTGAAACATCCATGG - Intronic
930308812 2:49712159-49712181 ATTCCCTTCTGAGACGTCTTTGG + Intergenic
931620308 2:64203822-64203844 ATTCCATTCTAAGCCTTTCATGG + Intergenic
933298324 2:80515409-80515431 ATGTCATTCTGAGCTATCCAAGG - Intronic
933611272 2:84438513-84438535 ATTCCATTCAGAAATATCCAAGG + Intronic
933988634 2:87616459-87616481 ATTTCATTATGAGATGTCCAGGG + Intergenic
936305206 2:111334350-111334372 ATTTCATTATGAGATGTCCAGGG - Intergenic
940377531 2:152972383-152972405 ATGCCCTTCTAGGACATCCAGGG - Intergenic
944643184 2:201749007-201749029 ATTCCATTCTGTCACATGGAGGG + Intronic
947184477 2:227442873-227442895 AATACATTCTGAGAAATGCATGG - Intergenic
947460195 2:230297627-230297649 CTTTCATAATGAGACATCCAAGG - Intronic
948721170 2:239901146-239901168 TTTCCATTCTGAAAAATCCTAGG + Intronic
1169236024 20:3930630-3930652 AATACATCCTGATACATCCAGGG - Intronic
1169574898 20:6948809-6948831 ATACCATTTTGAGACAGCAATGG + Intergenic
1170939505 20:20836760-20836782 AATCTATTCTGAGACAAACAGGG - Intergenic
1175138887 20:56844999-56845021 ATCCCATCCTGTCACATCCATGG + Intergenic
1175274656 20:57759962-57759984 ATTCCTTTCTGGGATCTCCAGGG + Intergenic
1176589080 21:8623072-8623094 ATTTTATTCTGAGACATCAAGGG - Intergenic
1177300675 21:19241569-19241591 ATTTCATTCTGAGAACTACAGGG + Intergenic
1178608449 21:34058964-34058986 AAGCCATACTGAGACATCCTGGG + Intergenic
1179708101 21:43194103-43194125 ATTCGATTCTGAGACATCTGGGG - Intergenic
1180271906 22:10600069-10600091 ATTTTATTCTGAGACATCAAGGG - Intergenic
1181424524 22:22824752-22824774 ATTCTTTGCTGAGACATCCTAGG + Intronic
949138236 3:598697-598719 ATTTTATTCTGAGACATCAAGGG + Intergenic
949357495 3:3197547-3197569 ATTCCATTCTGGAAATTCCAGGG + Intergenic
950467666 3:13164871-13164893 AATCCAATTTGGGACATCCAGGG - Intergenic
954349190 3:50028545-50028567 ATTCCATTGTTAGACATGCTTGG + Intronic
954384711 3:50237985-50238007 ATGCCATTTTGAAACCTCCAAGG - Intronic
954864042 3:53713828-53713850 ATTACAGTCTGGGACATGCAGGG + Intronic
955121523 3:56064346-56064368 ATTCCATTTGGAGACAGCCTTGG + Intronic
955688306 3:61565745-61565767 CTCCAATTCTGACACATCCAAGG - Intronic
956351637 3:68343534-68343556 ATTCCATGCTGAGGTACCCATGG + Intronic
961924220 3:130460121-130460143 ATTGGCTTCTGAGTCATCCAAGG + Intronic
962227660 3:133629286-133629308 AATACATTCTGATACATACATGG - Intronic
962405217 3:135094523-135094545 ATTCTATTCTGAGGCAGGCAGGG + Intronic
963452767 3:145505665-145505687 ATTCTATTTTGATACATCTAGGG - Intergenic
965667426 3:171110275-171110297 ATTTCATTTTGAGAAATACATGG + Intronic
974020184 4:56686500-56686522 ATTCCATTTAGATTCATCCAGGG + Intergenic
976104362 4:81601047-81601069 AACACATTCTGTGACATCCAGGG + Intronic
976124488 4:81819015-81819037 ATTCCATTGTGAAACATTCCTGG - Intronic
978496627 4:109366384-109366406 ATTCCACTCTTACACGTCCAAGG - Intergenic
979246009 4:118505427-118505449 AATCTATTCTGTGACATCCAGGG + Intergenic
979307787 4:119167730-119167752 TTACCATTCTGAGAATTCCAGGG + Intronic
980416657 4:132497139-132497161 ATTCCACTCTGAGACAAACATGG + Intergenic
982342548 4:154317424-154317446 GTTTCATTCTGAGGCATGCATGG - Intronic
982831544 4:160067500-160067522 ATGACCTTCTGAGGCATCCAAGG - Intergenic
989597282 5:43168285-43168307 TTTCCTTTCTGAGTCATCAAAGG - Intronic
990724081 5:58734124-58734146 ATTCATTTCTGTGACATTCAGGG + Intronic
992034215 5:72755723-72755745 TTTCCATTATGTTACATCCATGG + Intergenic
992099636 5:73394613-73394635 ATTCAATTCTCAAACATCCTTGG + Intergenic
993015204 5:82527621-82527643 ATTTAATTCTGTGCCATCCAAGG - Intergenic
993397388 5:87407111-87407133 ATTCCAATCAGAGACTTCCCTGG - Intronic
993896618 5:93542761-93542783 CTTCAATTCTGAAACATCAAAGG + Intergenic
997619600 5:135277445-135277467 AATACATTCTCAGACATGCAAGG - Intronic
997792659 5:136775352-136775374 ATTTCATTATGACACAGCCATGG + Intergenic
999904117 5:156120604-156120626 AATCCATTCTAAGTCATCCAAGG - Intronic
1000578930 5:163011383-163011405 ATTCCATTTAGACACATTCAGGG + Intergenic
1002210203 5:177594360-177594382 AATTCATTCTGAGACCCCCAAGG + Intronic
1004270171 6:14188219-14188241 ATTCCATTCTTAGCCAGGCATGG - Intergenic
1010351503 6:74880478-74880500 ATTTCCTTCTGAGAAATTCAGGG - Intergenic
1010406123 6:75507888-75507910 AATCCATTCTGGGACATGGATGG + Intergenic
1010527669 6:76923778-76923800 ATTTCACTCTGAGACCTCCTCGG - Intergenic
1014171412 6:118283052-118283074 ATTCCTTTCTGAGACCTGCAAGG + Intronic
1014611307 6:123550725-123550747 ATTCCATTCTGAGGGATTCGTGG + Intronic
1021050432 7:15976865-15976887 ATTTCATTCTGAGACGTCAATGG + Intergenic
1021475146 7:21052383-21052405 ATACCCTTCTAAGACTTCCAAGG - Intergenic
1022249846 7:28596338-28596360 ATTCAGTTCTGAGATATCCAGGG - Intronic
1023229632 7:38013053-38013075 ATTCCTTTCTGAGATCCCCAAGG + Intronic
1024086112 7:45892953-45892975 TTTGCAGTGTGAGACATCCATGG + Exonic
1029665009 7:101989431-101989453 TTTCCCATCTGAGAAATCCAGGG - Intronic
1030389521 7:108908862-108908884 ATTACATTCTAATACATCAATGG + Intergenic
1032401823 7:131629317-131629339 GATTCATTCTGAGGCATCCATGG + Intergenic
1032903787 7:136340662-136340684 ATTCCATTCTCTAATATCCATGG + Intergenic
1034591534 7:152144141-152144163 ATTCCATTCTGAGACATCCAAGG + Intronic
1034593769 7:152167891-152167913 ATTCCATTCTAAAACATTCTGGG - Intronic
1034716739 7:153250277-153250299 ATTCTATTTTGAGAGCTCCAAGG - Intergenic
1034935155 7:155194552-155194574 AATCCACTCTGTGCCATCCAGGG + Intergenic
1036015581 8:4780035-4780057 ATTCAATTCTGAGACCCTCATGG + Intronic
1037781358 8:21871434-21871456 ATTCCATTTTGAGCCAGCTAAGG + Intergenic
1038010893 8:23475074-23475096 ATTTCAGCCTGAGCCATCCATGG - Intergenic
1038300938 8:26347266-26347288 ATTCCATTTTGAGAGAAACAAGG + Intronic
1041333164 8:56750531-56750553 ATTACATTCTGAGACACTGAGGG + Intergenic
1043161269 8:76850982-76851004 ATTCCATTCTGAGACTTCCAAGG - Exonic
1049069579 8:140346098-140346120 AATCCATACTCAGACATGCAAGG + Intronic
1050858860 9:10397906-10397928 AATACATTCTGAGAAATGCATGG - Intronic
1051149178 9:14062008-14062030 TTTCCATTTTGAGACATCATGGG + Intergenic
1052205867 9:25839293-25839315 CTCCCTTTCTGAGACAGCCAAGG - Intergenic
1053233411 9:36431209-36431231 AATACATTCTGAGAAATGCATGG + Intronic
1055712627 9:79080890-79080912 ATGCCTTTCTGAGACAACAATGG - Intergenic
1056036564 9:82612357-82612379 ATTCCTTTGTGTGACAACCATGG + Intergenic
1057355795 9:94330360-94330382 CGTCCATTCTGAGACAAGCAAGG + Intergenic
1057651963 9:96927269-96927291 CGTCCATTCTGAGACAAGCAAGG - Intronic
1057912749 9:99033171-99033193 AGCCCCTTCTGAGACATGCAGGG + Intronic
1058170311 9:101672421-101672443 ATTGCATTATGATAAATCCATGG + Intronic
1059643813 9:116244077-116244099 ATTTCATTCTGAGAAATACTTGG - Intronic
1059898646 9:118896618-118896640 GTTCCCTTCAGAGACATCCTAGG - Intergenic
1060104310 9:120863904-120863926 TTTCCATTCTCCGAGATCCAGGG - Intronic
1060849433 9:126861515-126861537 CTTCCAATTTGAGACATACACGG - Intronic
1060921360 9:127422786-127422808 ATTCAATTCTGAAACGACCACGG + Intergenic
1203619085 Un_KI270749v1:101652-101674 ATTTTATTCTGAGACATCAAGGG - Intergenic
1187203659 X:17160480-17160502 CTTTCATTCCGTGACATCCATGG + Intergenic
1187616630 X:21001525-21001547 ATGCAAATCTGAGACATCTATGG - Intergenic
1190153878 X:47972240-47972262 TTTCTATTCTGAGACTTCTAGGG + Intronic
1193937760 X:87642757-87642779 ATTACATTCTGAGACTTTCCAGG - Intronic
1194027669 X:88773676-88773698 ATTCCATTCTGCAACATAAAAGG + Intergenic
1194733038 X:97478254-97478276 ATCCCATGCTTAGACATCCATGG + Intronic
1196137316 X:112223997-112224019 ATTCAATACTGAGACCTCAAAGG - Intergenic
1199219961 X:145306350-145306372 ATACCATGCTGAGAGATCCAGGG - Intergenic
1199695293 X:150339577-150339599 ATTCCATTCAGAGAAATCAGGGG - Intergenic
1200863784 Y:8020879-8020901 AATCCACTCTGAGGCATGCATGG + Intergenic
1200876519 Y:8161318-8161340 ATTCCTTTCTGTAACATCCCTGG + Intergenic