ID: 1034595395

View in Genome Browser
Species Human (GRCh38)
Location 7:152185050-152185072
Sequence TAAAGTATACAGGAGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 3, 1: 6, 2: 19, 3: 45, 4: 334}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034595395 Original CRISPR TAAAGTATACAGGAGGGGCC AGG (reversed) Intronic
900143532 1:1148409-1148431 GAAAAGATACAGGAGGAGCCTGG + Intergenic
900334031 1:2152235-2152257 TAAAGTGTACAGTTAGGGCCGGG + Intronic
900352800 1:2244257-2244279 AAAAGTTGTCAGGAGGGGCCAGG - Intronic
901277424 1:8003060-8003082 AAAGATCTACAGGAGGGGCCGGG - Intergenic
901408052 1:9063339-9063361 TAAAGTATACAGGCTGGGCATGG - Intronic
902855867 1:19204294-19204316 GAAAGTATAAGGGTGGGGCCAGG - Intronic
903235066 1:21944818-21944840 TAAGGGATAAAGGAGGGCCCAGG + Intergenic
903566259 1:24267988-24268010 TAAAGTATACTGGAGGGGACTGG - Intergenic
903566297 1:24268292-24268314 TAAAGTATACAGGAGGGGGCTGG - Intergenic
904722375 1:32520258-32520280 GAAAGCAAAGAGGAGGGGCCTGG - Intronic
904812445 1:33172311-33172333 TCAAGTCTCCAGGATGGGCCAGG + Intronic
905906805 1:41623817-41623839 AAAAGGATACCCGAGGGGCCAGG - Intronic
906014990 1:42568403-42568425 TAAAGTAGACAGGCAGTGCCCGG - Intronic
906463896 1:46058899-46058921 TAAAGGATTTGGGAGGGGCCAGG + Intronic
906521613 1:46470013-46470035 CAAAGTAAACAGGAGATGCCTGG - Intergenic
906970540 1:50508997-50509019 TAAAGTATACAATTTGGGCCAGG - Intronic
907227014 1:52957222-52957244 TTAAATAGACAGAAGGGGCCAGG - Intronic
908832570 1:68193807-68193829 TAAAGTACACAGAAAGTGCCTGG + Intronic
909330964 1:74410150-74410172 TAAAATATACAAGAGGACCCAGG + Intronic
909708922 1:78621565-78621587 TAAAGAATATAGGAGAGGCTAGG - Intronic
910361079 1:86414135-86414157 TAAAGTACCCAGGTGGGACCGGG + Intergenic
910476841 1:87616535-87616557 TATAGGATAAAGGTGGGGCCTGG + Intergenic
910829912 1:91450040-91450062 TCAAGTATACAGGAGGCCCACGG - Intergenic
913042441 1:115040640-115040662 TAAAGTATACAGGAGGAGCTAGG + Intergenic
914335323 1:146709749-146709771 TAGAGTATACAGGAGGGTGTTGG - Intergenic
914345092 1:146792126-146792148 TAAAGTAGAAAGAAGGGGCCAGG - Intergenic
915407037 1:155667856-155667878 AAAAGTATATAGGCTGGGCCTGG + Intronic
915581422 1:156815314-156815336 TAAAATAGACAGGAGAGGCTGGG - Intronic
915704284 1:157828941-157828963 AAAAGTTTAGAGGAGTGGCCTGG - Intergenic
915815671 1:158962526-158962548 TGAAGTGTTCAGGAGGGGGCAGG - Intronic
916572467 1:166039640-166039662 GAAACTCTACAGGTGGGGCCTGG + Intergenic
916574417 1:166054609-166054631 TAATGCATAAAGGAGGTGCCTGG + Intergenic
916823584 1:168423730-168423752 AAAAGTCAACTGGAGGGGCCGGG + Intergenic
917171435 1:172180071-172180093 TAAACTATACAAGAGCAGCCAGG - Intronic
918200392 1:182260884-182260906 TAAAGAATACAGATGTGGCCAGG - Intergenic
918486395 1:185033156-185033178 AAAAGTATACAATATGGGCCAGG - Intergenic
918499269 1:185175991-185176013 AAAGGTATACTGGAGGGGACTGG + Intronic
919694159 1:200556561-200556583 AATTGTATACAGGATGGGCCTGG + Intronic
919817549 1:201451054-201451076 TTAAGTCTGCAGGAGGTGCCTGG + Intergenic
920123865 1:203678089-203678111 GAAAGGAAACAGGAGGGGCCCGG - Intronic
920134629 1:203759602-203759624 GAAAGTATTCAGGACAGGCCTGG - Intergenic
920140124 1:203804445-203804467 AAAGATATACAGGAAGGGCCGGG - Intronic
920207027 1:204299698-204299720 TAAAGAAGACATGAGGGGGCAGG - Intronic
923310733 1:232732297-232732319 TAAAATAAACAAGAGGGGCCTGG - Intergenic
923483617 1:234407840-234407862 GAAAGTATACAAGATGAGCCTGG - Intronic
1062989758 10:1804447-1804469 TAAAGGAAACAGAAGTGGCCCGG - Intergenic
1066069391 10:31791364-31791386 TAAAGTTTACATGACAGGCCGGG + Intergenic
1066311694 10:34203529-34203551 TAAAGTATACAGGAGGATGTGGG - Intronic
1068893818 10:62177940-62177962 GGAAATATACAGGAGGAGCCTGG + Intergenic
1068997154 10:63220811-63220833 TAAAGTGGACAGGCAGGGCCGGG + Intronic
1069927948 10:71864190-71864212 TAAAGTGTACAACTGGGGCCAGG - Intergenic
1071335955 10:84600782-84600804 TAAAGAATCCATGAGGGGGCCGG - Intergenic
1071692451 10:87836274-87836296 TCAAGAATAAAGGAGGAGCCAGG - Intronic
1071930308 10:90462282-90462304 TAAAATCTACAGAAGGGTCCTGG - Intergenic
1072691293 10:97573720-97573742 TAAAGTGAAGAGTAGGGGCCGGG - Intronic
1073241691 10:102063354-102063376 TAAAGGATGATGGAGGGGCCGGG + Intergenic
1073311582 10:102546618-102546640 TAAAGTCTCCTGGAGGGGCCTGG - Intronic
1073835989 10:107443682-107443704 TAACTGATACAGGAGGGGGCAGG + Intergenic
1074686068 10:115963525-115963547 TAAAGTACTCAGGACAGGCCTGG + Intergenic
1074857004 10:117481007-117481029 TAAAGTGTACAGGAAGAGGCTGG + Intergenic
1075731513 10:124639300-124639322 TAAAGAGTACTGGAGGTGCCAGG + Intronic
1076353102 10:129832148-129832170 GAAAGTTTAGAGGATGGGCCAGG - Intergenic
1076716973 10:132371133-132371155 TGAAGGAAACACGAGGGGCCGGG - Intronic
1078599848 11:12720470-12720492 TAAAGTACTCACCAGGGGCCTGG - Intronic
1078704253 11:13724250-13724272 TTAAATAGACAGTAGGGGCCGGG + Intronic
1078945920 11:16068658-16068680 AAAAATATGCAGGAGGGGCAAGG - Intronic
1081184025 11:40020330-40020352 TAAAGAATTCAGGTGGGGCGTGG + Intergenic
1082043346 11:47705348-47705370 TAAAAAAGAAAGGAGGGGCCAGG + Intronic
1084651859 11:70494219-70494241 TAGAGTCTGCATGAGGGGCCTGG + Intronic
1085003036 11:73058172-73058194 TAAAGAATACAGAATTGGCCAGG - Intronic
1085442280 11:76576025-76576047 TTAAGAATACAGGAGGGGCCAGG - Intergenic
1087055266 11:93929227-93929249 TAAAGAAAACAGTATGGGCCGGG - Intergenic
1087151415 11:94863300-94863322 TAAAGTTTTCAGGCGGGGCGCGG + Intronic
1087634285 11:100686125-100686147 TAATGTAAACAGTATGGGCCAGG - Intergenic
1087778509 11:102278588-102278610 TAAAGTATACAAGAGAGGCCAGG + Intergenic
1089043341 11:115475148-115475170 TAAAGTATACAGGAGAGTATGGG - Intronic
1089054906 11:115577727-115577749 TGAAATTTACAGGAAGGGCCTGG + Intergenic
1089177911 11:116561536-116561558 GAACGTGTACAGGAGGGCCCTGG + Intergenic
1089532722 11:119141638-119141660 TAAAGTATATGGGAAGGGCCGGG + Intergenic
1091268856 11:134291530-134291552 TAAAGTACATGGGAGAGGCCAGG - Intronic
1091442067 12:518693-518715 TAAAGTATATGGGAGGGGCTGGG - Intronic
1091536001 12:1410002-1410024 TAAAGTATATGGGAGGGGCCAGG - Intronic
1092181621 12:6450664-6450686 GAATGCATACACGAGGGGCCAGG + Intronic
1093478691 12:19582963-19582985 CAAAGCATTCAGGAGGTGCCTGG + Intronic
1094647495 12:32340046-32340068 CAAAGACTACAGGAGGGGCCAGG - Intronic
1094698933 12:32849512-32849534 CAAAGAGTACAGGAGGGGCTGGG - Intronic
1095940659 12:47724764-47724786 TGAAGAATACAGAAGGGACCTGG - Intronic
1096702762 12:53396922-53396944 TCAAGAAAACAGGAGAGGCCGGG - Intronic
1097236562 12:57544292-57544314 CAAAGTATACAGGAGGGTGTAGG - Intronic
1098695067 12:73542145-73542167 TAAGGTATAAAGAAGGGGTCAGG - Intergenic
1098771026 12:74553218-74553240 GAATGCATACAGGTGGGGCCAGG + Intergenic
1099470963 12:83047239-83047261 TAAAGTATTCCAGAGGGGCAAGG + Intronic
1100559476 12:95733771-95733793 TAAAAGACACAGGAGGGGGCCGG + Intronic
1101662659 12:106779525-106779547 TAAAGTATATAGGAGAGGCCAGG - Intronic
1102226429 12:111231810-111231832 TAAAGTATACAGGAGGGGCCAGG + Intronic
1102263838 12:111464081-111464103 TAAAATACTCAGGAAGGGCCAGG - Intronic
1102393996 12:112572932-112572954 GAAAGTATAAAGGGGAGGCCAGG - Intronic
1102883448 12:116503930-116503952 AAAAGTATACAGGTGGGGCTGGG - Intergenic
1102960024 12:117086395-117086417 TAAAGTATACAGTTCAGGCCAGG - Intronic
1103134411 12:118495208-118495230 TAAAGAAAACTGGATGGGCCTGG - Intergenic
1103569932 12:121838339-121838361 TAAAGCAGGTAGGAGGGGCCTGG - Intergenic
1104644013 12:130484431-130484453 TGGTGTATCCAGGAGGGGCCGGG - Intronic
1106167872 13:27265142-27265164 TAAAGTAGGAAGGAAGGGCCGGG + Intergenic
1106372536 13:29149697-29149719 TATAGTGTAAAGAAGGGGCCTGG + Intronic
1106622639 13:31385737-31385759 TAAATGATACAGAAGGGGGCGGG - Intergenic
1107191841 13:37597458-37597480 GAAAGTCTACAGGAGGTGGCAGG + Intronic
1107561448 13:41560719-41560741 TAAAGTGTTCAGGAAGTGCCTGG + Intergenic
1108665374 13:52624732-52624754 AAAAGTATTCTCGAGGGGCCTGG + Intergenic
1109631144 13:65048013-65048035 TAAATTATCCAAGAGAGGCCAGG + Intergenic
1111579761 13:90207749-90207771 TAAATTATACAGGCCGGGCGCGG - Intergenic
1111989464 13:95102577-95102599 CAAAGTATAATGTAGGGGCCAGG - Intronic
1112539232 13:100291115-100291137 TAAAGTATACGGAAAGGGCTGGG + Intronic
1112605502 13:100901543-100901565 GACAATATACAGGAGGAGCCTGG - Intergenic
1114991297 14:28293448-28293470 TAAAAGATACAGAAGGGGCCAGG - Intergenic
1115600977 14:34955824-34955846 TAAAAAATACAGGAGAGGCCAGG + Intergenic
1116722990 14:48524649-48524671 TAAAATATACAGGCTGGGCATGG - Intergenic
1116805701 14:49492235-49492257 TAAATTGTTAAGGAGGGGCCAGG + Intergenic
1117551874 14:56844856-56844878 TAAAGTACAAGGGAGTGGCCGGG - Intergenic
1117653781 14:57933316-57933338 AAAAGTAAATAGGAGAGGCCAGG - Intronic
1118218067 14:63828342-63828364 TAAAGTATATGGGATGGGCCTGG + Intergenic
1118618175 14:67590121-67590143 TGAAGTATACAGGAGCTGCCAGG - Exonic
1118996273 14:70839623-70839645 TAAGGTATGCAGGAGCAGCCGGG + Intergenic
1120929647 14:89835921-89835943 AAAAATATACAGGTTGGGCCAGG - Intronic
1122191959 14:100052454-100052476 AAAAATATGCAGGAGGGGCCAGG + Intronic
1122646870 14:103200506-103200528 TAAAGTGTACAGGAGGGGCTGGG - Intergenic
1123996936 15:25725334-25725356 TAAAGTATAGAGGAGGGTATAGG + Intronic
1125712181 15:41795902-41795924 TAAAATATAAATGAGAGGCCGGG - Intronic
1126052992 15:44704309-44704331 AAAAGCATACAACAGGGGCCAGG - Intronic
1126173222 15:45711720-45711742 TAAAGAAAAAAGCAGGGGCCAGG - Intergenic
1126622273 15:50652035-50652057 TAAAGAAAACAGAATGGGCCGGG + Intronic
1126703462 15:51386944-51386966 TGAAGTATACAGGAGGAGGTGGG + Intronic
1127413306 15:58731321-58731343 TAAAGTATATGGGAGGGGCCAGG + Intronic
1127431245 15:58911037-58911059 TAAAGAATCTATGAGGGGCCAGG - Intronic
1127447545 15:59080415-59080437 AAGAGTACACAGGAAGGGCCAGG - Intronic
1127514363 15:59677258-59677280 TGAAGTATACAGGAGCTGCCAGG + Intronic
1127602282 15:60549995-60550017 AAAAGTGTAGAAGAGGGGCCGGG + Intronic
1128134202 15:65250679-65250701 TAAACTACACTGGAGGAGCCTGG - Intronic
1128387948 15:67164014-67164036 TAAAAAAGAAAGGAGGGGCCAGG + Intronic
1128930009 15:71695995-71696017 TAAAGCATGCAGGATGTGCCTGG + Intronic
1129201101 15:74000601-74000623 TAAAGTATACAGGAGGGGATGGG - Intronic
1129446182 15:75620042-75620064 TAAAATATACATAAGAGGCCGGG - Intronic
1129634841 15:77304740-77304762 AAATGTATACAGGATTGGCCAGG - Intronic
1129696098 15:77741439-77741461 TAGAGGATACAGCAGAGGCCAGG + Intronic
1129758884 15:78116161-78116183 TAAAGTATATAGGAGGGGCTGGG + Intronic
1129790426 15:78337460-78337482 CAGAGCAGACAGGAGGGGCCAGG - Intergenic
1131162068 15:90112787-90112809 TAAAGTATACAGACAGGGCTGGG + Intergenic
1131710892 15:95054965-95054987 AAAAGTAGCCAGGAGTGGCCAGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132538528 16:496043-496065 AAAAGTCTACTGGAGGGGCCGGG - Intronic
1133147007 16:3795606-3795628 TAAAAAATAAAGGAGGGGCCAGG - Intronic
1134087641 16:11369224-11369246 TAAAATATAGAGATGGGGCCGGG - Intronic
1134871512 16:17656231-17656253 TACATTATACAGCAGTGGCCGGG - Intergenic
1135122740 16:19780464-19780486 AAAAATAAACAGGATGGGCCAGG - Intronic
1135141562 16:19926511-19926533 TTAAGAATACAGATGGGGCCGGG - Intergenic
1135991786 16:27222978-27223000 TAATGCCTGCAGGAGGGGCCGGG - Intergenic
1137974208 16:53017253-53017275 TAAAGAATCCAGTAAGGGCCAGG + Intergenic
1138124576 16:54428346-54428368 TAAAGTAGACTAGAGGGGCAGGG + Intergenic
1138222529 16:55265093-55265115 CAAAGAAAACAGGAGGGGCAAGG + Intergenic
1138555365 16:57767969-57767991 TAAAGTACATGGGAGGGGCTGGG - Intronic
1138568822 16:57854330-57854352 AAAAGTATAAAGATGGGGCCAGG + Intronic
1139988902 16:70923170-70923192 TAAAGTAGAAAGAAGGGGCCAGG + Intronic
1139998300 16:71001479-71001501 TAGAGTATACAGGAGGGTGTTGG + Intronic
1140273136 16:73484048-73484070 TCAAGTTTGCAGGAGGGTCCGGG + Intergenic
1141613879 16:85199245-85199267 TAAAATATACAGGCGGGGCACGG - Intergenic
1143605974 17:7986230-7986252 TTAATCATACAGGATGGGCCAGG + Intergenic
1144141260 17:12350760-12350782 AAAAATATATAGGATGGGCCAGG + Intergenic
1147296977 17:39491831-39491853 TAAAAGATACAGGAGTGGCTGGG + Intronic
1147814389 17:43198357-43198379 TAAAGTATACATGTAAGGCCAGG + Intronic
1147814908 17:43202215-43202237 TAGAGTATGCAGGAGGAGCATGG - Intronic
1148324483 17:46775320-46775342 TCAAGTATGGAGGAGGGACCCGG - Intronic
1148828025 17:50408663-50408685 AAAAGCATACAGAGGGGGCCAGG + Intergenic
1151014793 17:70541970-70541992 AAAACTATACACCAGGGGCCAGG - Intergenic
1151672214 17:75577370-75577392 GAAAGTGAACTGGAGGGGCCGGG + Intergenic
1153322511 18:3787186-3787208 TAAAGTAAATGAGAGGGGCCAGG + Intronic
1154115710 18:11611523-11611545 TAAAGTATACAGGAGGATGTGGG + Intergenic
1154120154 18:11645742-11645764 TAAAGTATACAGGAGGATGTGGG + Intergenic
1154154671 18:11934663-11934685 AAAAATAGACAGAAGGGGCCGGG + Intergenic
1154387199 18:13904862-13904884 TAAGGTATAAGGAAGGGGCCCGG - Intronic
1154959308 18:21291943-21291965 TAGAGGATACAGGATGGGCTTGG + Intronic
1155015554 18:21835469-21835491 TCAAGAATATAGGAGGAGCCCGG + Intronic
1155103839 18:22641123-22641145 TAAAGTATACTGGAAGGGTTGGG + Intergenic
1155304797 18:24468335-24468357 TAAAGTATACGGGAGGGGCCGGG - Intronic
1157613400 18:48973275-48973297 TAAAATATAAAATAGGGGCCGGG - Intergenic
1157903987 18:51549692-51549714 TAAAATTTACATGAGGGGCCAGG - Intergenic
1160771361 19:832782-832804 AAAATTACACAGGAGAGGCCGGG + Intergenic
1161148826 19:2695861-2695883 GAAAGCAGACAGAAGGGGCCGGG + Intronic
1161369250 19:3900829-3900851 CAAAAAATACAGGATGGGCCAGG - Intronic
1161785130 19:6319814-6319836 TAAATAATACAGAAGGGGCCAGG + Intronic
1161965810 19:7547956-7547978 TAAAGTATACTGAAGGGGCTGGG - Intronic
1162347516 19:10128540-10128562 TAAAGTACACAGGAGAGGCCGGG - Intergenic
1163352119 19:16783914-16783936 TAAAATATACAGGAGTGGCCGGG + Intronic
1163373893 19:16918288-16918310 TAAAGTACACAGGAGGGGCCGGG - Intronic
1164453801 19:28390053-28390075 TAAAATATACATGATTGGCCAGG - Intergenic
1165215796 19:34271541-34271563 GAAAGTGCACAGAAGGGGCCGGG - Intronic
1165563945 19:36706948-36706970 AAAAGTATAAAGGATGGGCAAGG - Intronic
1166171652 19:41031870-41031892 TAAAGAAAACAGGTGGGGCTTGG - Intergenic
1166441362 19:42818246-42818268 TTAGAAATACAGGAGGGGCCGGG + Intronic
1166833276 19:45651158-45651180 TAAATTATATATGAGTGGCCAGG + Intergenic
1167302083 19:48683885-48683907 TAAAGAACACAGGAGGGGCCAGG + Intergenic
1168418527 19:56185003-56185025 GAAAGTAGAGAGAAGGGGCCAGG + Intronic
925270540 2:2603763-2603785 TAAAGTATACAAGAGGTGGCCGG - Intergenic
926811315 2:16757418-16757440 TAGAGCATACTGGAGGGACCAGG + Intergenic
928515108 2:32037841-32037863 TAAAGCATACAGGCTGGGCGTGG - Intronic
928655359 2:33445832-33445854 TAAAGAATCCAGGAAGTGCCAGG + Intronic
928673813 2:33630321-33630343 AAAATGATACAGGAGGGGGCGGG + Intergenic
929288780 2:40165638-40165660 TAAAGTAAACAGGGAGGGCGAGG + Intronic
931396489 2:61892396-61892418 AAAAGAAGAGAGGAGGGGCCAGG + Intronic
933318871 2:80747018-80747040 TCAAGTTTAGAGGTGGGGCCTGG + Intergenic
933633442 2:84681878-84681900 TTGAGTAGACAGGAGGGGACTGG - Intronic
935168051 2:100586839-100586861 TAAACTAAACAGGAGTGGCCAGG - Intergenic
936401951 2:112171340-112171362 GAAAGGAGACAGGAGGGGCCGGG + Intronic
938005072 2:127782712-127782734 TAAAGTATACAGCAGGAGCCAGG + Intronic
939209656 2:139157708-139157730 TAAAGTATACAGGAGGATGTGGG + Intergenic
940671760 2:156678826-156678848 TAAAGTGTACAAGGTGGGCCGGG + Intergenic
943026531 2:182636251-182636273 TAAAAAATACAGGTGAGGCCGGG - Intergenic
944833584 2:203556835-203556857 GAAAGTGTACAGGAGAGGCTGGG + Intergenic
944953847 2:204785347-204785369 TACAGTTTAAAGGAGGGGCTGGG - Intronic
945514129 2:210741055-210741077 TAAAGTGTGCAGGAGAGGCCAGG - Intergenic
947019233 2:225656319-225656341 TTAAGTATACAGAAGGGACTGGG - Intergenic
947448161 2:230180396-230180418 TGATGTATACATGAGGGGTCTGG + Intronic
947688151 2:232109150-232109172 TAAACTATACTACAGGGGCCAGG + Intronic
948535332 2:238642201-238642223 AAAAATATACTGGTGGGGCCGGG + Intergenic
949024670 2:241761241-241761263 TAAAGTATACAGGAGGGGCCGGG + Intronic
1169431799 20:5542811-5542833 TTAAGAATATAGCAGGGGCCGGG - Intergenic
1169520100 20:6361783-6361805 TTAAGGATACAGGACGGGCGCGG - Intergenic
1169572718 20:6924160-6924182 AAAAATATAAAGGAGAGGCCGGG + Intergenic
1170683994 20:18552516-18552538 TAAAATATACAGCACAGGCCGGG + Intronic
1170985294 20:21252523-21252545 TAAAATGTACAGAAGTGGCCAGG + Intergenic
1171954435 20:31449605-31449627 TAAAGACTACAGGGTGGGCCAGG + Intronic
1173152561 20:40580366-40580388 TATAGTATACAGGAGGATGCGGG + Intergenic
1180658581 22:17445872-17445894 TAAAGTATACAGCAGTGGCCAGG - Intronic
1181386750 22:22551293-22551315 TCAAGTGTAGAGGAGGGGACAGG + Intronic
1182365258 22:29774507-29774529 TAAACAATAAAGCAGGGGCCAGG + Intergenic
1182388951 22:29973892-29973914 TAAAGTACATGGGAAGGGCCGGG - Intronic
1182557050 22:31134791-31134813 TAATGTATACAGCTGGTGCCTGG - Exonic
949231470 3:1755985-1756007 TAAAATATTCAGATGGGGCCAGG + Intergenic
950010391 3:9718703-9718725 TGAAGTAAACAGGAGAGGCCAGG + Intronic
951196330 3:19827691-19827713 TTAAGTATTAAGTAGGGGCCAGG + Intergenic
951214070 3:20007165-20007187 TAAAGTATACAGGAGGGCCCGGG - Intronic
952415746 3:33090276-33090298 TAAAGAGTACAGGTGGGGCAGGG + Intronic
952881805 3:37990399-37990421 TAAAGTTTGCTGGAGTGGCCTGG + Intronic
954832302 3:53432426-53432448 TACAGTATACAGCAGGGACAGGG - Intergenic
955142277 3:56281140-56281162 AAAAGTATAGAGGACAGGCCGGG + Intronic
955758567 3:62252454-62252476 TAAAGTACACAGAAAGTGCCTGG + Intronic
955789451 3:62573175-62573197 TAATGTATATGGGAGGGGCCAGG - Intronic
956814243 3:72893531-72893553 TTAAGTGTACATGAGGGGGCAGG - Intronic
957274085 3:78067927-78067949 GGAAATATACAGGATGGGCCTGG + Intergenic
957431772 3:80119318-80119340 TAAAGTGTACAGTTGTGGCCAGG - Intergenic
958514916 3:95101663-95101685 TAAAATATACAGGAGTGTACAGG - Intergenic
958612471 3:96445397-96445419 TAAAATATACATCAGAGGCCAGG - Intergenic
959495601 3:107047824-107047846 TACAGTATCTAGGAGTGGCCTGG + Intergenic
960794169 3:121467012-121467034 TAGAGTATTGAGGAGGGGTCAGG + Intronic
960899850 3:122543570-122543592 TAAACTATTTAGGAAGGGCCGGG - Intronic
962230919 3:133664613-133664635 TAAAGTACATGGGAGTGGCCAGG - Intergenic
962356630 3:134699663-134699685 TGATGTGTACAGGAGGGACCAGG - Intronic
963064713 3:141254206-141254228 TAAAATATTCCAGAGGGGCCGGG - Intronic
965254878 3:166393577-166393599 TAAAATATACAGAATGGGCGGGG - Intergenic
966618928 3:181943291-181943313 TAAAGTAAACAGCAGGGGAGAGG - Intergenic
967478060 3:189943474-189943496 TAAAGCATAGGGCAGGGGCCAGG - Intergenic
968982690 4:3859050-3859072 TCTAGTATACAGCAGGTGCCAGG - Intergenic
969464189 4:7344956-7344978 AAAAGCAGACTGGAGGGGCCTGG - Intronic
971204011 4:24544815-24544837 TAAACTATACAGAATAGGCCAGG + Intronic
972282361 4:37614973-37614995 TAAGCTAAAAAGGAGGGGCCTGG + Intronic
972443279 4:39117777-39117799 AAAAGTAAACAGAAGAGGCCAGG + Intronic
972625592 4:40795908-40795930 TAAAGTAAGCAGCAGGTGCCAGG - Intronic
975871444 4:78783513-78783535 TAAATTGTACAGGATGGGCATGG + Intronic
976482001 4:85556606-85556628 TAAAGTGTTCAGGTGGGGGCAGG + Intronic
976888604 4:90016175-90016197 TAAGGAATACAAGAGAGGCCGGG - Intergenic
977002281 4:91519098-91519120 TGAAGTATCCAGGTGGGGGCAGG + Intronic
977310123 4:95375780-95375802 TAAAATATACAGAATAGGCCGGG + Intronic
977567815 4:98598761-98598783 TAAAAAATTTAGGAGGGGCCAGG - Intronic
978154719 4:105475482-105475504 TAAAGTATCCAGGCTGGGCGTGG + Intergenic
978193520 4:105943712-105943734 TAATGTATAAAGGAGGAGACAGG - Intronic
978499470 4:109393629-109393651 TTAAAAACACAGGAGGGGCCGGG - Intergenic
978535922 4:109762241-109762263 TAAAGTTTACAGCATGGGGCAGG - Intronic
979473304 4:121126063-121126085 TAAAGAATTCAGGAGAGGTCAGG + Intergenic
981025362 4:140072378-140072400 TAAAGTATACAGGCCAGGCGTGG + Intronic
982600285 4:157441170-157441192 AAAAGTATATGGGAGGGGGCCGG + Intergenic
982793328 4:159617156-159617178 TAAGGTATACAGGCTGGGCTGGG + Intergenic
982813873 4:159861375-159861397 TAAAGCACACAGAAGAGGCCTGG - Intergenic
984245837 4:177274661-177274683 TAAAGAATAAAAAAGGGGCCAGG + Intergenic
984936178 4:184891240-184891262 TAAAGTATATGGGAAGGGGCTGG + Intergenic
985541062 5:487961-487983 TAAAAAATACATGAGTGGCCGGG - Intronic
985810645 5:2081813-2081835 CAAAATATACAGGATGAGCCTGG + Intergenic
986422287 5:7597477-7597499 TAAAGAATGCAGTAGTGGCCAGG + Intronic
986763434 5:10900721-10900743 CACAGTATACAGGTGTGGCCTGG + Intergenic
989027490 5:37084482-37084504 TAAAAGATACAGAATGGGCCAGG + Intergenic
989630922 5:43482136-43482158 AACAGTAGACAGTAGGGGCCAGG - Intronic
990541327 5:56775854-56775876 AAAATTAAATAGGAGGGGCCGGG + Intergenic
992373051 5:76164887-76164909 TAAAGTATACAGGAGGATGTGGG - Intronic
992629097 5:78663772-78663794 TAAAGTATACAGAAGGATGCTGG + Intronic
993050793 5:82923650-82923672 CAAAGAATACAGGACGGGCTGGG - Intergenic
993760443 5:91789574-91789596 TAAAGTATTCAGGCTGGGCAGGG + Intergenic
995150465 5:108838598-108838620 TAATTTATACAGCAGGGGTCAGG - Intronic
995507920 5:112879769-112879791 TAAAGTATATGGAAGAGGCCGGG - Intronic
995554429 5:113313049-113313071 AAAAGTGTAGAGAAGGGGCCTGG + Intronic
995611640 5:113916908-113916930 GAAACCATACGGGAGGGGCCGGG - Intergenic
997298849 5:132787627-132787649 GAAAGAGTACAGGAGGGACCAGG - Intronic
997983329 5:138484278-138484300 TAAAGTGTACAGGCCGGGCGCGG + Intergenic
998867811 5:146522765-146522787 TAGAATATACAGGGTGGGCCTGG - Intergenic
999414862 5:151386171-151386193 AAAAAGATACAGAAGGGGCCGGG - Intergenic
1000953787 5:167517890-167517912 AAAAGCATTCAGCAGGGGCCGGG + Intronic
1001613679 5:173024500-173024522 GAAAATATAGAAGAGGGGCCTGG - Intronic
1001714582 5:173804417-173804439 TAAAGTATACAGGAGAGGTTGGG - Intergenic
1002514640 5:179748376-179748398 TAAAGTATACAGTAGTCGGCTGG - Intronic
1004948801 6:20645202-20645224 TAAAGTCTACAGTAGGGTGCAGG - Intronic
1005616934 6:27582526-27582548 TAATCTATACAGGACAGGCCGGG - Intergenic
1006308401 6:33239386-33239408 TAAAATCCACAGGATGGGCCGGG - Intergenic
1006813681 6:36837081-36837103 GAAAGCAAACAGGAGGGGCCAGG + Intronic
1007492345 6:42233214-42233236 TAAAGTATACAGAAGGGAAATGG - Intronic
1007600787 6:43079749-43079771 TAAAGTATACAGGAGAAGCTGGG - Intronic
1007683102 6:43647972-43647994 TAGAGAATACAGGATGGGCCGGG + Intronic
1007879040 6:45141042-45141064 TAAAGAATTCAGAAGAGGCCGGG + Intronic
1007941444 6:45785254-45785276 TGCACTGTACAGGAGGGGCCAGG + Intergenic
1010189279 6:73178290-73178312 AAAAATCTACAGGAGGGGCCAGG + Intronic
1011315921 6:86031023-86031045 TAAAGTTTACAGAAGAGGCAGGG - Intergenic
1012000833 6:93652455-93652477 TAAAGCATATAAGAGGGGACAGG - Intergenic
1012893653 6:104924867-104924889 TAAATTATACAAAAGCGGCCGGG - Intergenic
1012999723 6:106010011-106010033 TCAAATATTCAGGAAGGGCCAGG - Intergenic
1013832641 6:114292805-114292827 TAAAGTATACAGGAGGATATTGG - Intronic
1014348543 6:120308773-120308795 TAAAAAATAGAGGAGGGGCCGGG - Intergenic
1014853119 6:126365575-126365597 TCAAGATTACAGGAGGGGGCTGG - Intergenic
1014930174 6:127326143-127326165 TGAAGGATGAAGGAGGGGCCTGG + Intronic
1014932522 6:127351165-127351187 TAAATTATATAGGAAGGGCCAGG + Intergenic
1014952063 6:127568072-127568094 AAAAGTAGAGAGAAGGGGCCAGG + Intronic
1015629419 6:135216442-135216464 TAAAGTATACAGGAATGAACGGG - Intronic
1015654921 6:135507197-135507219 TTAATAATACAGGAGGGGGCTGG + Intergenic
1016334550 6:142990540-142990562 TGAAGTATACAATAGGGGGCTGG - Intergenic
1016774733 6:147892915-147892937 AAAAGTATTCAGTATGGGCCAGG + Intergenic
1017797279 6:157857308-157857330 TAAAACATACAAGATGGGCCTGG - Intronic
1018107975 6:160507110-160507132 TAAAGTGTTCAGGCAGGGCCAGG + Intergenic
1019278678 7:189065-189087 TAAGGTCTGCAGGTGGGGCCAGG - Intergenic
1021107518 7:16654827-16654849 TATAGTATACAGGCTGGGCACGG - Intronic
1022682531 7:32563325-32563347 TAAAGTATACGGGAGAGGCTGGG - Intronic
1022860692 7:34363541-34363563 TAAAGAATACAGGAAGGGAGGGG - Intergenic
1023090083 7:36609138-36609160 TAAAGTATACGGGATGGGAAGGG + Intronic
1023377601 7:39574300-39574322 TAAAAAGTACAGAAGGGGCCAGG + Intronic
1024267913 7:47620941-47620963 AAATGTCAACAGGAGGGGCCGGG - Intergenic
1024800652 7:53073692-53073714 TAAAGAATACATTAGCGGCCGGG + Intergenic
1025942020 7:66081916-66081938 CAAAGCCTACAGCAGGGGCCTGG + Exonic
1026336728 7:69400311-69400333 TAAAGCATACAGAGTGGGCCTGG + Intergenic
1026559076 7:71433098-71433120 TAAAGAATAGAGATGGGGCCAGG - Intronic
1027776377 7:82470432-82470454 TAAAGTGTATAGGAGGAGGCTGG - Intergenic
1028411115 7:90531167-90531189 TAAAGTATATGGGAGGGGCTGGG - Intronic
1028470767 7:91204176-91204198 TTAAGTTTCCAGGAGAGGCCTGG - Intronic
1028661155 7:93277090-93277112 TAAAGAAGACATGAGGGCCCTGG + Intronic
1029679098 7:102095571-102095593 TAACGTATCCAGCAGGAGCCAGG - Intronic
1029858725 7:103545929-103545951 TTAAATAGACAGAAGGGGCCGGG - Intronic
1031937701 7:127752556-127752578 AAAAGTATAATGCAGGGGCCAGG + Intronic
1033014566 7:137659635-137659657 AAAAGCATTCAGTAGGGGCCGGG + Intronic
1033298031 7:140159053-140159075 TAAAGGATACAGGCCGGGCTTGG + Intronic
1033524217 7:142194325-142194347 TAAAGAATGCTGGAGGGGCCGGG - Intronic
1034187678 7:149191588-149191610 TAAAGAATACAGGAGAGGCCGGG - Intergenic
1034595395 7:152185050-152185072 TAAAGTATACAGGAGGGGCCAGG - Intronic
1036165820 8:6432259-6432281 TAAAGTACATGGGAGGAGCCAGG - Intronic
1036255372 8:7202102-7202124 AAAAGTGTACATGAGGGGGCTGG - Intergenic
1036431524 8:8696164-8696186 TGCAGTAGACAGGAAGGGCCAGG + Intergenic
1036668270 8:10762614-10762636 AAAATAATTCAGGAGGGGCCAGG + Intronic
1036803344 8:11809021-11809043 TAAAGTAAACACGTAGGGCCGGG - Intronic
1037418476 8:18676712-18676734 TAAAGTATACAGGCTTGGCTGGG - Intronic
1038726532 8:30087103-30087125 TAAAGTATACAGGAGGGGCTGGG + Intergenic
1041044440 8:53877913-53877935 GAAAGAATACAGGCCGGGCCTGG + Intronic
1041094921 8:54340425-54340447 TAAAGTATATGGGAAGGGCCAGG - Intergenic
1041319457 8:56598453-56598475 TAAAGGATACAGAAGTGGCCAGG - Intergenic
1041327136 8:56679959-56679981 AAATATATACAGAAGGGGCCAGG - Intergenic
1043480341 8:80646182-80646204 AAAATTATACAGGTAGGGCCAGG + Intronic
1043978867 8:86615097-86615119 TAAAGTATACAGGAGGATGTGGG + Intronic
1044765356 8:95566393-95566415 TAAAAAATACAAAAGGGGCCGGG - Intergenic
1047255193 8:123208698-123208720 GAAAGCATACAGGAGGGGCCAGG + Exonic
1047903101 8:129445015-129445037 TGGAGGAGACAGGAGGGGCCAGG + Intergenic
1048048631 8:130796534-130796556 TAAAGTGAACAGCAGGGGTCTGG + Intronic
1048134325 8:131732764-131732786 CAAAGTATAAAGAAGGGGCCAGG + Intergenic
1050256907 9:3803269-3803291 TAAAGTATACAGGAAAGGATGGG + Intergenic
1050420952 9:5464789-5464811 TAAAGAATGCAAGAGGGGCCAGG + Intronic
1051595330 9:18819158-18819180 AAAAGAATAGGGGAGGGGCCAGG + Intronic
1051921639 9:22274023-22274045 TAAAGCATATAGGAGGGCCTGGG + Intergenic
1052359732 9:27541059-27541081 TAAAAGTTAGAGGAGGGGCCTGG + Intergenic
1052798323 9:32944706-32944728 TAAAGTATATGGGAGGGGGCTGG + Intergenic
1053167629 9:35855687-35855709 TAAAAGATTCAGGAGAGGCCAGG - Intergenic
1055924076 9:81492079-81492101 AAAAGTGTACAGGCTGGGCCCGG + Intergenic
1055925410 9:81505077-81505099 TAAAGTAAACACTAGGGACCAGG - Intergenic
1056209727 9:84354456-84354478 CAAAGGATATAGGAGTGGCCTGG + Intergenic
1056532014 9:87496654-87496676 AAAAGTAAACAGGTGAGGCCGGG + Intergenic
1057858700 9:98623132-98623154 TAAAGTCTTCAGGCGGGGCGCGG + Intronic
1059069117 9:111116994-111117016 TAAGGCACACAAGAGGGGCCAGG + Intergenic
1059811301 9:117858449-117858471 TAGAGGAGACAGGAGGGGGCAGG - Intergenic
1060748777 9:126155163-126155185 AAAAGTTTCCAGGAGGGGGCAGG - Intergenic
1061030555 9:128079695-128079717 TAAAAAACCCAGGAGGGGCCAGG + Intronic
1185740941 X:2531654-2531676 TAAATTACAAAGGAGAGGCCAGG - Intergenic
1186725027 X:12348476-12348498 TAAAATACACAGGAGGACCCAGG + Intronic
1186976039 X:14905785-14905807 TAAAGTATATAGGAGGGGCCAGG - Intronic
1187525301 X:20048633-20048655 AAAAGTATACAGGACAGGCATGG + Intronic
1188031108 X:25265496-25265518 TAAAGTAGAAATGGGGGGCCAGG + Intergenic
1189304623 X:39977614-39977636 TAAAGTATACAATTGGAGCCGGG - Intergenic
1189353332 X:40293625-40293647 TAAAGGATGCAGGCGGGGCCAGG + Intergenic
1189508561 X:41637939-41637961 TAAAATACACATGAGGGACCAGG - Intronic
1190878021 X:54473687-54473709 TAAAGTATACAGGAAGGGTCAGG + Intronic
1192466281 X:71358769-71358791 AAAAATAAAAAGGAGGGGCCAGG - Intergenic
1192569827 X:72194102-72194124 TAAAGTCTACAGTAGGGGACGGG + Intronic
1192739618 X:73880414-73880436 TAAAATATACAGAGTGGGCCGGG + Intergenic
1194339279 X:92689826-92689848 TGAAGCATACAGGAGGGACACGG + Intergenic
1194683248 X:96880022-96880044 AAAAATATACTGGATGGGCCGGG - Intronic
1195389828 X:104349898-104349920 TAAAGAATTAAGGAGGGGCTGGG - Intergenic
1196100284 X:111840320-111840342 TAAAGTATATGGAATGGGCCAGG - Intronic
1200245812 X:154524596-154524618 AAAAGTACACAGGAGGGGCCGGG + Intergenic
1200647666 Y:5806607-5806629 TGAAGCATACAGGAGGGACACGG + Intergenic
1201887878 Y:18906237-18906259 TGAAATATACAATAGGGGCCAGG + Intergenic